General Information of Drug Transporter (DT)
DT ID DTD0494 Transporter Info
Gene Name SLC9A9
Transporter Name Sodium/hydrogen exchanger 9
Gene ID
285195
UniProt ID
Q8IVB4
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg04897230)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.37E-08; Z-score:-8.26E-01

Methylation in Case

8.36E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg00044871)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:4.05E-13; Z-score:1.85E+00

Methylation in Case

4.62E-01 (Median) Methylation in Control 3.76E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg00605982)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.68E+00 Statistic Test p-value:5.22E-12; Z-score:2.01E+00

Methylation in Case

3.51E-01 (Median) Methylation in Control 2.09E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg03506489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.79E+00 Statistic Test p-value:2.79E-07; Z-score:1.51E+00

Methylation in Case

3.80E-01 (Median) Methylation in Control 2.12E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS200 (cg07493760)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:3.67E-15; Z-score:-2.49E+00

Methylation in Case

6.07E-01 (Median) Methylation in Control 6.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS200 (cg07033372)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:5.27E+00 Statistic Test p-value:8.27E-14; Z-score:2.92E+00

Methylation in Case

4.00E-01 (Median) Methylation in Control 7.60E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

1stExon (cg06987672)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.43E+00 Statistic Test p-value:1.14E-10; Z-score:1.50E+00

Methylation in Case

2.56E-01 (Median) Methylation in Control 1.79E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg13661968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.53E+00 Statistic Test p-value:3.23E-13; Z-score:2.69E+00

Methylation in Case

3.00E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg22398359)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.00E-08; Z-score:1.43E+00

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg16535035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:7.47E-05; Z-score:1.20E+00

Methylation in Case

8.11E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg02079348)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.31E-02; Z-score:-7.60E-01

Methylation in Case

6.91E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.41E-03; Z-score:6.14E-01

Methylation in Case

7.94E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC9A9 in pancretic ductal adenocarcinoma [ 1 ]

Location

3'UTR (cg12562245)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.63E-02; Z-score:3.55E-02

Methylation in Case

7.76E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

TSS200 (cg15360181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.66E+00 Statistic Test p-value:1.74E-02; Z-score:-1.78E+00

Methylation in Case

8.28E-02 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg18151422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.78E+00 Statistic Test p-value:6.94E-12; Z-score:-1.10E+01

Methylation in Case

2.54E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg04860674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.58E+00 Statistic Test p-value:2.68E-11; Z-score:-1.96E+01

Methylation in Case

3.18E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg02501410)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.55E+00 Statistic Test p-value:1.52E-10; Z-score:8.73E+00

Methylation in Case

7.16E-01 (Median) Methylation in Control 4.63E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg04558907)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.07E+00 Statistic Test p-value:5.46E-08; Z-score:-1.23E+01

Methylation in Case

4.25E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg26226555)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-7.18E+00 Statistic Test p-value:2.10E-05; Z-score:-6.53E+00

Methylation in Case

4.20E-02 (Median) Methylation in Control 3.01E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg04070804)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.82E-04; Z-score:-5.03E+00

Methylation in Case

8.14E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg25945642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.18E+00 Statistic Test p-value:3.19E-04; Z-score:-3.50E+00

Methylation in Case

1.68E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg25453063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.85E-04; Z-score:-7.33E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg21520462)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.47E-03; Z-score:-4.98E+00

Methylation in Case

8.78E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg13408795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.82E-03; Z-score:2.86E+00

Methylation in Case

7.62E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg15266604)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.11E-03; Z-score:-4.81E+00

Methylation in Case

7.94E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg03804400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:2.96E-03; Z-score:-5.16E+00

Methylation in Case

3.72E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg14574489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:1.84E-02; Z-score:-2.74E+00

Methylation in Case

3.36E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg20925925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.85E-02; Z-score:-2.08E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg19974216)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.90E-02; Z-score:-8.67E-01

Methylation in Case

7.98E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC9A9 in bladder cancer [ 2 ]

Location

Body (cg06145736)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:2.12E-02; Z-score:2.13E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 5.98E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colorectal cancer

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

TSS200 (cg15360181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:1.80E-06; Z-score:-1.59E+00

Methylation in Case

3.49E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg14574489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:6.31E-15; Z-score:-3.46E+00

Methylation in Case

6.37E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg21520462)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:7.22E-10; Z-score:-5.52E+00

Methylation in Case

8.59E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg04860674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.07E-08; Z-score:-2.26E+00

Methylation in Case

8.23E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg13408795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.73E-08; Z-score:-1.93E+00

Methylation in Case

7.62E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg25453063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.24E-08; Z-score:-4.40E+00

Methylation in Case

8.97E-01 (Median) Methylation in Control 9.33E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg04558907)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:8.94E-08; Z-score:-2.41E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg06145736)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:5.38E-07; Z-score:-1.85E+00

Methylation in Case

7.12E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg25945642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.18E-06; Z-score:-1.61E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg15266604)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.94E-06; Z-score:-1.73E+00

Methylation in Case

9.08E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg08988364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.41E+00 Statistic Test p-value:5.91E-06; Z-score:2.19E+00

Methylation in Case

2.35E-01 (Median) Methylation in Control 9.76E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg20925925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.60E-05; Z-score:-2.97E+00

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg19974216)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.66E-05; Z-score:-1.69E+00

Methylation in Case

8.94E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg22288315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.36E-03; Z-score:-5.66E-01

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC9A9 in colorectal cancer [ 3 ]

Location

Body (cg04070804)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.14E-02; Z-score:-3.01E-01

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

TSS200 (cg15360181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.70E+00 Statistic Test p-value:1.90E-05; Z-score:-3.32E+00

Methylation in Case

2.39E-01 (Median) Methylation in Control 4.06E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

Body (cg25945642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.32E-03; Z-score:1.64E+00

Methylation in Case

5.40E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

Body (cg14574489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:1.67E-03; Z-score:2.52E+00

Methylation in Case

4.54E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in lung adenocarcinoma [ 4 ]

Location

Body (cg06145736)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.58E-02; Z-score:-1.16E+00

Methylation in Case

6.60E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

TSS200 (cg15360181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:4.71E-06; Z-score:-1.19E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg18151422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:1.47E-16; Z-score:-2.41E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg26226555)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.24E+00 Statistic Test p-value:1.82E-14; Z-score:-1.55E+00

Methylation in Case

9.40E-02 (Median) Methylation in Control 3.04E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg02501410)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.43E-12; Z-score:-3.07E+00

Methylation in Case

6.27E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg21520462)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:9.88E-09; Z-score:-1.51E+00

Methylation in Case

9.46E-01 (Median) Methylation in Control 9.60E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg14574489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.88E+00 Statistic Test p-value:1.78E-07; Z-score:-1.93E+00

Methylation in Case

1.58E-01 (Median) Methylation in Control 2.97E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg06145736)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:3.86E-05; Z-score:1.35E+00

Methylation in Case

5.33E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg04558907)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.03E-03; Z-score:2.03E+00

Methylation in Case

8.96E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg19974216)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.14E-03; Z-score:-6.43E-01

Methylation in Case

8.72E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

Body (cg03804400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:8.63E-03; Z-score:7.65E-01

Methylation in Case

6.34E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC9A9 in papillary thyroid cancer [ 5 ]

Location

3'UTR (cg27402999)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.24E-03; Z-score:-6.18E-01

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

TSS200 (cg17364114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.87E+00 Statistic Test p-value:3.22E-02; Z-score:-1.55E+00

Methylation in Case

3.79E-02 (Median) Methylation in Control 7.07E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

TSS200 (cg00289429)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.30E+00 Statistic Test p-value:3.94E-02; Z-score:5.84E+00

Methylation in Case

2.15E-01 (Median) Methylation in Control 9.38E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

Body (cg13512394)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:2.61E-02; Z-score:-1.80E+01

Methylation in Case

5.07E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

Body (cg23691006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:3.23E-02; Z-score:1.32E+00

Methylation in Case

8.37E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

Body (cg02555727)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.81E-02; Z-score:1.69E+00

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

Body (cg16398133)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:4.09E-02; Z-score:1.59E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 6.00E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

Body (cg14918008)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.18E-02; Z-score:1.60E+00

Methylation in Case

8.62E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

Body (cg05554939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.33E-02; Z-score:1.24E+00

Methylation in Case

9.12E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in prostate cancer [ 6 ]

Location

3'UTR (cg05851505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.10E-02; Z-score:2.08E+00

Methylation in Case

9.68E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Breast cancer

         21 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

1stExon (cg23538718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:2.33E-06; Z-score:9.57E-01

Methylation in Case

1.26E-01 (Median) Methylation in Control 8.99E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg04558907)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.47E-11; Z-score:-2.99E+00

Methylation in Case

7.64E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg25453063)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.97E-10; Z-score:-3.24E+00

Methylation in Case

7.98E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg21520462)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.97E-09; Z-score:-2.42E+00

Methylation in Case

8.55E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg15266604)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.01E-09; Z-score:-1.95E+00

Methylation in Case

7.47E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg18151422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:6.63E-09; Z-score:-1.43E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg02501410)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:8.51E-09; Z-score:2.30E+00

Methylation in Case

6.23E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg19974216)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.23E-08; Z-score:-1.81E+00

Methylation in Case

7.67E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg04860674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.47E-08; Z-score:-1.54E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg02317746)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.13E-08; Z-score:-1.15E+00

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg20925925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:5.99E-07; Z-score:-1.65E+00

Methylation in Case

7.96E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg14574489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:1.03E-06; Z-score:1.43E+00

Methylation in Case

3.83E-01 (Median) Methylation in Control 2.82E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg04070804)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.45E-06; Z-score:-1.29E+00

Methylation in Case

8.15E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg14497255)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.46E-06; Z-score:-8.25E-01

Methylation in Case

8.74E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg22288315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.46E-05; Z-score:-8.51E-01

Methylation in Case

8.06E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg26226555)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.22E+00 Statistic Test p-value:3.33E-05; Z-score:-1.09E+00

Methylation in Case

7.41E-02 (Median) Methylation in Control 1.64E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg08988364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.54E+00 Statistic Test p-value:6.33E-05; Z-score:8.18E-01

Methylation in Case

2.26E-02 (Median) Methylation in Control 1.47E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg08488058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.13E-03; Z-score:-3.14E-01

Methylation in Case

8.96E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg25945642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:7.46E-03; Z-score:1.61E+00

Methylation in Case

4.62E-01 (Median) Methylation in Control 3.67E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

Body (cg03804400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:4.72E-02; Z-score:1.09E+00

Methylation in Case

6.75E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC9A9 in breast cancer [ 7 ]

Location

3'UTR (cg27402999)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.12E-06; Z-score:-6.56E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

1stExon (cg26513304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.05E+00 Statistic Test p-value:7.07E-24; Z-score:-5.27E+00

Methylation in Case

3.10E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

1stExon (cg23538718)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.11E+00 Statistic Test p-value:5.21E-09; Z-score:-1.67E+00

Methylation in Case

1.53E-01 (Median) Methylation in Control 3.23E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg22032364)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.73E+00 Statistic Test p-value:2.62E-22; Z-score:-3.82E+00

Methylation in Case

3.27E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg22054793)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.06E-13; Z-score:-2.43E+00

Methylation in Case

5.85E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg20925925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.32E-09; Z-score:-3.20E+00

Methylation in Case

7.79E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg14497255)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.63E-07; Z-score:-9.75E-01

Methylation in Case

8.13E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg14574489)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:3.41E-06; Z-score:-1.58E+00

Methylation in Case

3.89E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg13408795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:3.74E-04; Z-score:-1.06E+00

Methylation in Case

5.67E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

Body (cg18151422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.67E-03; Z-score:-6.00E-01

Methylation in Case

5.47E-01 (Median) Methylation in Control 5.84E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC9A9 in hepatocellular carcinoma [ 8 ]

Location

3'UTR (cg27402999)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:8.66E-06; Z-score:-4.35E-01

Methylation in Case

8.12E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Panic disorder

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A9 in panic disorder [ 9 ]

Location

Body (cg25945642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.56E-01 Statistic Test p-value:1.93E-04; Z-score:-9.31E-01

Methylation in Case

-8.85E-01 (Median) Methylation in Control -3.15E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A9 in panic disorder [ 9 ]

Location

Body (cg04558907)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:7.40E-03; Z-score:5.23E-01

Methylation in Case

3.44E+00 (Median) Methylation in Control 3.30E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A9 in panic disorder [ 9 ]

Location

Body (cg13408795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-6.89E-01 Statistic Test p-value:8.78E-03; Z-score:-4.65E-01

Methylation in Case

-7.94E-01 (Median) Methylation in Control -5.47E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A9 in panic disorder [ 9 ]

Location

Body (cg04860674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.41E-02; Z-score:4.36E-01

Methylation in Case

1.46E+00 (Median) Methylation in Control 1.29E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A9 in panic disorder [ 9 ]

Location

Body (cg21520462)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.79E-02; Z-score:6.11E-01

Methylation in Case

2.86E+00 (Median) Methylation in Control 2.70E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-124 directly targets SLC9A9 [ 10 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.