Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0494 Transporter Info
Gene Name	SLC9A9
Transporter Name	Sodium/hydrogen exchanger 9
Gene ID	285195
UniProt ID	Q8IVB4

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg04897230)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:6.37E-08; Z-score:-8.26E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg00044871)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:4.05E-13; Z-score:1.85E+00
Methylation in Case	4.62E-01 (Median)	Methylation in Control	3.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg00605982)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.68E+00	Statistic Test	p-value:5.22E-12; Z-score:2.01E+00
Methylation in Case	3.51E-01 (Median)	Methylation in Control	2.09E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg03506489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.79E+00	Statistic Test	p-value:2.79E-07; Z-score:1.51E+00
Methylation in Case	3.80E-01 (Median)	Methylation in Control	2.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg07493760)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:3.67E-15; Z-score:-2.49E+00
Methylation in Case	6.07E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS200 (cg07033372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:5.27E+00	Statistic Test	p-value:8.27E-14; Z-score:2.92E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	7.60E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg06987672)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:1.14E-10; Z-score:1.50E+00
Methylation in Case	2.56E-01 (Median)	Methylation in Control	1.79E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg13661968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.53E+00	Statistic Test	p-value:3.23E-13; Z-score:2.69E+00
Methylation in Case	3.00E-01 (Median)	Methylation in Control	1.97E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg22398359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.00E-08; Z-score:1.43E+00
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg16535035)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:7.47E-05; Z-score:1.20E+00
Methylation in Case	8.11E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg02079348)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.31E-02; Z-score:-7.60E-01
Methylation in Case	6.91E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	3'UTR (cg15841533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.41E-03; Z-score:6.14E-01
Methylation in Case	7.94E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC9A9 in pancretic ductal adenocarcinoma			[ 1 ]
Location	3'UTR (cg12562245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:2.63E-02; Z-score:3.55E-02
Methylation in Case	7.76E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	TSS200 (cg15360181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.66E+00	Statistic Test	p-value:1.74E-02; Z-score:-1.78E+00
Methylation in Case	8.28E-02 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg18151422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.78E+00	Statistic Test	p-value:6.94E-12; Z-score:-1.10E+01
Methylation in Case	2.54E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.58E+00	Statistic Test	p-value:2.68E-11; Z-score:-1.96E+01
Methylation in Case	3.18E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg02501410)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.55E+00	Statistic Test	p-value:1.52E-10; Z-score:8.73E+00
Methylation in Case	7.16E-01 (Median)	Methylation in Control	4.63E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg04558907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.07E+00	Statistic Test	p-value:5.46E-08; Z-score:-1.23E+01
Methylation in Case	4.25E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg26226555)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-7.18E+00	Statistic Test	p-value:2.10E-05; Z-score:-6.53E+00
Methylation in Case	4.20E-02 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg04070804)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.82E-04; Z-score:-5.03E+00
Methylation in Case	8.14E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg25945642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.18E+00	Statistic Test	p-value:3.19E-04; Z-score:-3.50E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	3.68E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg25453063)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:6.85E-04; Z-score:-7.33E+00
Methylation in Case	8.33E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg21520462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.47E-03; Z-score:-4.98E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg13408795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.82E-03; Z-score:2.86E+00
Methylation in Case	7.62E-01 (Median)	Methylation in Control	6.54E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg15266604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:2.11E-03; Z-score:-4.81E+00
Methylation in Case	7.94E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg03804400)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.37E+00	Statistic Test	p-value:2.96E-03; Z-score:-5.16E+00
Methylation in Case	3.72E-01 (Median)	Methylation in Control	5.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg14574489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.84E-02; Z-score:-2.74E+00
Methylation in Case	3.36E-01 (Median)	Methylation in Control	4.51E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg20925925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.85E-02; Z-score:-2.08E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg19974216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.90E-02; Z-score:-8.67E-01
Methylation in Case	7.98E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC9A9 in bladder cancer			[ 2 ]
Location	Body (cg06145736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:2.12E-02; Z-score:2.13E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	5.98E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Colorectal cancer	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	TSS200 (cg15360181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.70E+00	Statistic Test	p-value:1.80E-06; Z-score:-1.59E+00
Methylation in Case	3.49E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg14574489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:6.31E-15; Z-score:-3.46E+00
Methylation in Case	6.37E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg21520462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:7.22E-10; Z-score:-5.52E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	9.35E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.07E-08; Z-score:-2.26E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	9.30E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg13408795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:6.73E-08; Z-score:-1.93E+00
Methylation in Case	7.62E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg25453063)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:8.24E-08; Z-score:-4.40E+00
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.33E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg04558907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.94E-08; Z-score:-2.41E+00
Methylation in Case	8.82E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg06145736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:5.38E-07; Z-score:-1.85E+00
Methylation in Case	7.12E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg25945642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:2.18E-06; Z-score:-1.61E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg15266604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.94E-06; Z-score:-1.73E+00
Methylation in Case	9.08E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg08988364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.41E+00	Statistic Test	p-value:5.91E-06; Z-score:2.19E+00
Methylation in Case	2.35E-01 (Median)	Methylation in Control	9.76E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg20925925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.60E-05; Z-score:-2.97E+00
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg19974216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:6.66E-05; Z-score:-1.69E+00
Methylation in Case	8.94E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg22288315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.36E-03; Z-score:-5.66E-01
Methylation in Case	9.13E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC9A9 in colorectal cancer			[ 3 ]
Location	Body (cg04070804)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.14E-02; Z-score:-3.01E-01
Methylation in Case	9.37E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in lung adenocarcinoma			[ 4 ]
Location	TSS200 (cg15360181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.70E+00	Statistic Test	p-value:1.90E-05; Z-score:-3.32E+00
Methylation in Case	2.39E-01 (Median)	Methylation in Control	4.06E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in lung adenocarcinoma			[ 4 ]
Location	Body (cg25945642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:1.32E-03; Z-score:1.64E+00
Methylation in Case	5.40E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in lung adenocarcinoma			[ 4 ]
Location	Body (cg14574489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.44E+00	Statistic Test	p-value:1.67E-03; Z-score:2.52E+00
Methylation in Case	4.54E-01 (Median)	Methylation in Control	3.15E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in lung adenocarcinoma			[ 4 ]
Location	Body (cg06145736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.58E-02; Z-score:-1.16E+00
Methylation in Case	6.60E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	TSS200 (cg15360181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:4.71E-06; Z-score:-1.19E+00
Methylation in Case	4.66E-01 (Median)	Methylation in Control	5.79E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg18151422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.47E-16; Z-score:-2.41E+00
Methylation in Case	7.51E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg26226555)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.24E+00	Statistic Test	p-value:1.82E-14; Z-score:-1.55E+00
Methylation in Case	9.40E-02 (Median)	Methylation in Control	3.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg02501410)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:1.43E-12; Z-score:-3.07E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg21520462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:9.88E-09; Z-score:-1.51E+00
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.60E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg14574489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.88E+00	Statistic Test	p-value:1.78E-07; Z-score:-1.93E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	2.97E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg06145736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:3.86E-05; Z-score:1.35E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg04558907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.03E-03; Z-score:2.03E+00
Methylation in Case	8.96E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg19974216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.14E-03; Z-score:-6.43E-01
Methylation in Case	8.72E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	Body (cg03804400)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:8.63E-03; Z-score:7.65E-01
Methylation in Case	6.34E-01 (Median)	Methylation in Control	5.84E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC9A9 in papillary thyroid cancer			[ 5 ]
Location	3'UTR (cg27402999)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.24E-03; Z-score:-6.18E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.30E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	TSS200 (cg17364114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.87E+00	Statistic Test	p-value:3.22E-02; Z-score:-1.55E+00
Methylation in Case	3.79E-02 (Median)	Methylation in Control	7.07E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	TSS200 (cg00289429)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.30E+00	Statistic Test	p-value:3.94E-02; Z-score:5.84E+00
Methylation in Case	2.15E-01 (Median)	Methylation in Control	9.38E-02 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	Body (cg13512394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.49E+00	Statistic Test	p-value:2.61E-02; Z-score:-1.80E+01
Methylation in Case	5.07E-01 (Median)	Methylation in Control	7.55E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	Body (cg23691006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:3.23E-02; Z-score:1.32E+00
Methylation in Case	8.37E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	Body (cg02555727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.81E-02; Z-score:1.69E+00
Methylation in Case	9.10E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	Body (cg16398133)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:4.09E-02; Z-score:1.59E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	6.00E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	Body (cg14918008)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:4.18E-02; Z-score:1.60E+00
Methylation in Case	8.62E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	Body (cg05554939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.33E-02; Z-score:1.24E+00
Methylation in Case	9.12E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in prostate cancer			[ 6 ]
Location	3'UTR (cg05851505)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.10E-02; Z-score:2.08E+00
Methylation in Case	9.68E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Breast cancer	21 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	1stExon (cg23538718)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:2.33E-06; Z-score:9.57E-01
Methylation in Case	1.26E-01 (Median)	Methylation in Control	8.99E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg04558907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.47E-11; Z-score:-2.99E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg25453063)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:2.97E-10; Z-score:-3.24E+00
Methylation in Case	7.98E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg21520462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.97E-09; Z-score:-2.42E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg15266604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:2.01E-09; Z-score:-1.95E+00
Methylation in Case	7.47E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg18151422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:6.63E-09; Z-score:-1.43E+00
Methylation in Case	7.20E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg02501410)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:8.51E-09; Z-score:2.30E+00
Methylation in Case	6.23E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg19974216)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.23E-08; Z-score:-1.81E+00
Methylation in Case	7.67E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.47E-08; Z-score:-1.54E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg02317746)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.13E-08; Z-score:-1.15E+00
Methylation in Case	8.48E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg20925925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:5.99E-07; Z-score:-1.65E+00
Methylation in Case	7.96E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg14574489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.36E+00	Statistic Test	p-value:1.03E-06; Z-score:1.43E+00
Methylation in Case	3.83E-01 (Median)	Methylation in Control	2.82E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg04070804)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.45E-06; Z-score:-1.29E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg14497255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.46E-06; Z-score:-8.25E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg22288315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:2.46E-05; Z-score:-8.51E-01
Methylation in Case	8.06E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg26226555)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.22E+00	Statistic Test	p-value:3.33E-05; Z-score:-1.09E+00
Methylation in Case	7.41E-02 (Median)	Methylation in Control	1.64E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg08988364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.54E+00	Statistic Test	p-value:6.33E-05; Z-score:8.18E-01
Methylation in Case	2.26E-02 (Median)	Methylation in Control	1.47E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg08488058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.13E-03; Z-score:-3.14E-01
Methylation in Case	8.96E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon19	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg25945642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:7.46E-03; Z-score:1.61E+00
Methylation in Case	4.62E-01 (Median)	Methylation in Control	3.67E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon20	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	Body (cg03804400)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:4.72E-02; Z-score:1.09E+00
Methylation in Case	6.75E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon21	Methylation of SLC9A9 in breast cancer			[ 7 ]
Location	3'UTR (cg27402999)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.12E-06; Z-score:-6.56E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	1stExon (cg26513304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.05E+00	Statistic Test	p-value:7.07E-24; Z-score:-5.27E+00
Methylation in Case	3.10E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	1stExon (cg23538718)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.11E+00	Statistic Test	p-value:5.21E-09; Z-score:-1.67E+00
Methylation in Case	1.53E-01 (Median)	Methylation in Control	3.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg22032364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.73E+00	Statistic Test	p-value:2.62E-22; Z-score:-3.82E+00
Methylation in Case	3.27E-01 (Median)	Methylation in Control	5.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg22054793)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:1.06E-13; Z-score:-2.43E+00
Methylation in Case	5.85E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg20925925)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.32E-09; Z-score:-3.20E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg14497255)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.63E-07; Z-score:-9.75E-01
Methylation in Case	8.13E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg14574489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:3.41E-06; Z-score:-1.58E+00
Methylation in Case	3.89E-01 (Median)	Methylation in Control	4.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg13408795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.74E-04; Z-score:-1.06E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	6.11E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg18151422)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.67E-03; Z-score:-6.00E-01
Methylation in Case	5.47E-01 (Median)	Methylation in Control	5.84E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC9A9 in hepatocellular carcinoma			[ 8 ]
Location	3'UTR (cg27402999)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:8.66E-06; Z-score:-4.35E-01
Methylation in Case	8.12E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Panic disorder	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC9A9 in panic disorder			[ 9 ]
Location	Body (cg25945642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.56E-01	Statistic Test	p-value:1.93E-04; Z-score:-9.31E-01
Methylation in Case	-8.85E-01 (Median)	Methylation in Control	-3.15E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC9A9 in panic disorder			[ 9 ]
Location	Body (cg04558907)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:7.40E-03; Z-score:5.23E-01
Methylation in Case	3.44E+00 (Median)	Methylation in Control	3.30E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC9A9 in panic disorder			[ 9 ]
Location	Body (cg13408795)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-6.89E-01	Statistic Test	p-value:8.78E-03; Z-score:-4.65E-01
Methylation in Case	-7.94E-01 (Median)	Methylation in Control	-5.47E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC9A9 in panic disorder			[ 9 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.41E-02; Z-score:4.36E-01
Methylation in Case	1.46E+00 (Median)	Methylation in Control	1.29E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC9A9 in panic disorder			[ 9 ]
Location	Body (cg21520462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:3.79E-02; Z-score:6.11E-01
Methylation in Case	2.86E+00 (Median)	Methylation in Control	2.70E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-124 directly targets SLC9A9			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7	Genome-wide Scan for Methylation Profiles in Breast Cancer
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence