Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0493 Transporter Info
Gene Name SLC9A8
Transporter Name Sodium/hydrogen exchanger 8
Gene ID
23315
UniProt ID
Q9Y2E8
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg11413133)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.48E+00 Statistic Test p-value:4.52E-05; Z-score:2.86E+00

Methylation in Case

 5.14E-01 (Median) Methylation in Control 3.47E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in colon adenocarcinoma [ 1 ]

Location

 Body (cg00712593)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:7.25E-04; Z-score:-3.07E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in colon adenocarcinoma [ 1 ]

Location

 Body (cg10204807)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.54E+00 Statistic Test p-value:2.21E-03; Z-score:2.90E+00

Methylation in Case

 1.79E-01 (Median) Methylation in Control 1.16E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in colon adenocarcinoma [ 1 ]

Location

 Body (cg04120420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:2.74E-03; Z-score:-1.53E+00

Methylation in Case

 7.61E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in bladder cancer [ 2 ]

Location

 TSS1500 (cg04297410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:1.72E-05; Z-score:-4.08E+00

Methylation in Case

 8.25E-02 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in bladder cancer [ 2 ]

Location

 TSS1500 (cg02003117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.18E+00 Statistic Test p-value:4.32E-04; Z-score:2.53E+00

Methylation in Case

 5.10E-01 (Median) Methylation in Control 4.33E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in bladder cancer [ 2 ]

Location

 TSS1500 (cg24083367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.45E+00 Statistic Test p-value:2.48E-02; Z-score:-1.95E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in bladder cancer [ 2 ]

Location

 3'UTR (cg01634982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:3.67E-05; Z-score:-6.12E+00

Methylation in Case

 5.27E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 TSS1500 (cg02003117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:8.36E-13; Z-score:3.60E+00

Methylation in Case

 5.71E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 TSS1500 (cg24083367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.37E+00 Statistic Test p-value:8.87E-07; Z-score:1.18E+00

Methylation in Case

 1.47E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 TSS200 (cg15488402)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:1.97E-02; Z-score:4.47E-01

Methylation in Case

 7.80E-02 (Median) Methylation in Control 6.98E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 TSS200 (cg07430237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:4.08E-02; Z-score:-4.39E-01

Methylation in Case

 4.34E-02 (Median) Methylation in Control 5.03E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 Body (cg21544475)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.39E+00 Statistic Test p-value:1.00E-11; Z-score:2.62E+00

Methylation in Case

 6.40E-01 (Median) Methylation in Control 4.59E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 Body (cg13759513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:8.02E-06; Z-score:1.16E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC9A8 in breast cancer [ 3 ]

Location

 Body (cg21690806)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:4.31E-04; Z-score:-5.36E-01

Methylation in Case

 5.90E-02 (Median) Methylation in Control 6.54E-02 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg24083367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.26E+00 Statistic Test p-value:1.59E-04; Z-score:1.03E+00

Methylation in Case

 1.23E-01 (Median) Methylation in Control 9.78E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg15488402)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:4.55E-03; Z-score:4.17E-01

Methylation in Case

 3.70E-02 (Median) Methylation in Control 3.45E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg24391458)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:1.88E-02; Z-score:2.04E-01

Methylation in Case

 1.13E-02 (Median) Methylation in Control 1.10E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg23571159)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.01E+00 Statistic Test p-value:1.50E-02; Z-score:1.00E-01

Methylation in Case

 1.80E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg04297410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.38E-02; Z-score:-5.12E-01

Methylation in Case

 8.04E-02 (Median) Methylation in Control 8.61E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in colorectal cancer [ 5 ]

Location

 TSS200 (cg20786061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.14E+00 Statistic Test p-value:1.40E-02; Z-score:-8.72E-01

Methylation in Case

 4.47E-02 (Median) Methylation in Control 5.10E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in colorectal cancer [ 5 ]

Location

 TSS200 (cg25940728)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:4.76E-02; Z-score:-5.71E-01

Methylation in Case

 2.17E-01 (Median) Methylation in Control 2.41E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in colorectal cancer [ 5 ]

Location

 3'UTR (cg01634982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.04E+00 Statistic Test p-value:1.03E-03; Z-score:-1.26E+00

Methylation in Case

 8.33E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg24083367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.27E+00 Statistic Test p-value:2.63E-05; Z-score:-9.00E-01

Methylation in Case

 1.51E-01 (Median) Methylation in Control 1.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg04297410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:4.71E-03; Z-score:-4.26E-01

Methylation in Case

 7.68E-02 (Median) Methylation in Control 8.39E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in hepatocellular carcinoma [ 6 ]

Location

 1stExon (cg05776787)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.75E+00 Statistic Test p-value:1.24E-22; Z-score:-1.41E+01

Methylation in Case

 4.67E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg08070713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.58E+00 Statistic Test p-value:8.21E-15; Z-score:-8.75E+00

Methylation in Case

 5.99E-01 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC9A8 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg21544475)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:2.00E-02; Z-score:-2.87E-01

Methylation in Case

 6.63E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg02003117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:1.58E-03; Z-score:1.63E+00

Methylation in Case

 6.56E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in lung adenocarcinoma [ 7 ]

Location

 Body (cg21544475)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.17E+00 Statistic Test p-value:1.12E-02; Z-score:1.60E+00

Methylation in Case

 7.57E-01 (Median) Methylation in Control 6.47E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS1500 (cg07323754)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.37E+00 Statistic Test p-value:6.00E-14; Z-score:1.85E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 8.15E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS1500 (cg06998507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.68E+00 Statistic Test p-value:9.93E-10; Z-score:-2.17E+00

Methylation in Case

 2.41E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg15680989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:1.90E-02; Z-score:-7.44E-01

Methylation in Case

 5.31E-02 (Median) Methylation in Control 5.86E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg00067528)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:1.30E-05; Z-score:-9.63E-01

Methylation in Case

 7.11E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC9A8 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg26540004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:6.13E-03; Z-score:-2.33E-01

Methylation in Case

 4.30E-01 (Median) Methylation in Control 4.53E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in panic disorder [ 9 ]

Location

 TSS1500 (cg02003117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:3.40E-02; Z-score:-4.16E-01

Methylation in Case

 1.19E+00 (Median) Methylation in Control 1.34E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg04297410)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.21E+00 Statistic Test p-value:1.08E-03; Z-score:-1.06E+00

Methylation in Case

 1.23E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg02003117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:7.21E-03; Z-score:6.77E-01

Methylation in Case

 6.10E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg22426397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.34E+00 Statistic Test p-value:1.56E-12; Z-score:-1.71E+00

Methylation in Case

 6.22E-02 (Median) Methylation in Control 8.35E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg07430237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.25E+00 Statistic Test p-value:5.51E-07; Z-score:-1.19E+00

Methylation in Case

 4.64E-02 (Median) Methylation in Control 5.80E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg25940728)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:5.43E-03; Z-score:-4.16E-01

Methylation in Case

 1.55E-01 (Median) Methylation in Control 1.64E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 TSS200 (cg24391458)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.05E+00 Statistic Test p-value:2.44E-02; Z-score:-3.13E-01

Methylation in Case

 3.66E-02 (Median) Methylation in Control 3.83E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 Body (cg13759513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.02E+00 Statistic Test p-value:1.66E-04; Z-score:7.20E-01

Methylation in Case

 9.17E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon8

 Methylation of SLC9A8 in papillary thyroid cancer [ 10 ]

Location

 3'UTR (cg01634982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.74E-05; Z-score:-1.07E+00

Methylation in Case

 6.59E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC9A8 in prostate cancer [ 11 ]

Location

 Body (cg19214916)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:3.66E+00 Statistic Test p-value:1.36E-02; Z-score:2.78E+01

Methylation in Case

 5.96E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC9A8 in prostate cancer [ 11 ]

Location

 Body (cg21962013)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.18E+00 Statistic Test p-value:1.76E-02; Z-score:3.08E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 6.68E-01 (Median)

Studied Phenotype

 Prostate cancer[ ICD-11:2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1199 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1199 miRNA Mature ID miR-1199-5p

miRNA Sequence

 CCUGAGCCCGGGCCGCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-1537 directly targets SLC9A8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1537 miRNA Mature ID miR-1537-5p

miRNA Sequence

 AGCUGUAAUUAGUCAGUUUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-192 directly targets SLC9A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

 CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon4

 miR-3065 directly targets SLC9A8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3065 miRNA Mature ID miR-3065-3p

miRNA Sequence

 UCAGCACCAGGAUAUUGUUGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-3134 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3134 miRNA Mature ID miR-3134

miRNA Sequence

 UGAUGGAUAAAAGACUACAUAUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-3662 directly targets SLC9A8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3662 miRNA Mature ID miR-3662

miRNA Sequence

 GAAAAUGAUGAGUAGUGACUGAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-4293 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4293 miRNA Mature ID miR-4293

miRNA Sequence

 CAGCCUGACAGGAACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-4480 directly targets SLC9A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4480 miRNA Mature ID miR-4480

miRNA Sequence

 AGCCAAGUGGAAGUUACUUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-4534 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4534 miRNA Mature ID miR-4534

miRNA Sequence

 GGAUGGAGGAGGGGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-4718 directly targets SLC9A8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4718 miRNA Mature ID miR-4718

miRNA Sequence

 AGCUGUACCUGAAACCAAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-4999 directly targets SLC9A8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4999 miRNA Mature ID miR-4999-5p

miRNA Sequence

 UGCUGUAUUGUCAGGUAGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-596 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-596 miRNA Mature ID miR-596

miRNA Sequence

 AAGCCUGCCCGGCUCCUCGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-6751 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6751 miRNA Mature ID miR-6751-3p

miRNA Sequence

 ACUGAGCCUCUCUCUCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-6787 directly targets SLC9A8 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6787 miRNA Mature ID miR-6787-3p

miRNA Sequence

 UCUCAGCUGCUGCCCUCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-6807 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-6830 directly targets SLC9A8 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6830 miRNA Mature ID miR-6830-5p

miRNA Sequence

 CCAAGGAAGGAGGCUGGACAUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-8082 directly targets SLC9A8 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8082 miRNA Mature ID miR-8082

miRNA Sequence

 UGAUGGAGCUGGGAAUACUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
13 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
14 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.