Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0488 Transporter Info | ||||
Gene Name | SLC9A4 | ||||
Transporter Name | Sodium/hydrogen exchanger 4 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS1500 (cg27375012) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.42E-03; Z-score:-5.49E-01 | ||
Methylation in Case |
9.08E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
1stExon (cg13223402) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:3.13E+00 | Statistic Test | p-value:6.51E-31; Z-score:1.09E+01 | ||
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 5.96E-02 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC9A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg08876130) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:1.27E-03; Z-score:-1.02E+00 | ||
Methylation in Case |
2.50E-01 (Median) | Methylation in Control | 3.31E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC9A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg10275969) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.46E-03; Z-score:-7.14E-01 | ||
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in bladder cancer | [ 2 ] | |||
Location |
TSS200 (cg04239558) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.63E+00 | Statistic Test | p-value:5.01E-04; Z-score:-3.32E+00 | ||
Methylation in Case |
9.41E-02 (Median) | Methylation in Control | 2.48E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in bladder cancer | [ 2 ] | |||
Location |
Body (cg02552255) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.78E+00 | Statistic Test | p-value:2.56E-08; Z-score:-1.09E+01 | ||
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC9A4 in bladder cancer | [ 2 ] | |||
Location |
Body (cg16237262) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.23E-02; Z-score:2.49E+00 | ||
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC9A4 in bladder cancer | [ 2 ] | |||
Location |
3'UTR (cg20061812) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.93E-04; Z-score:-3.27E+00 | ||
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in colorectal cancer | [ 3 ] | |||
Location |
TSS200 (cg05751189) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:3.31E-02; Z-score:6.52E-01 | ||
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in colorectal cancer | [ 3 ] | |||
Location |
Body (cg02552255) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:4.79E-12; Z-score:-2.44E+00 | ||
Methylation in Case |
6.62E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in hepatocellular carcinoma | [ 4 ] | |||
Location |
TSS200 (cg10608615) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:2.89E-18; Z-score:-5.39E+00 | ||
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in hepatocellular carcinoma | [ 4 ] | |||
Location |
Body (cg21620524) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:4.63E-17; Z-score:-6.66E+00 | ||
Methylation in Case |
5.90E-01 (Median) | Methylation in Control | 7.67E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC9A4 in hepatocellular carcinoma | [ 4 ] | |||
Location |
Body (cg10403518) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:2.57E-08; Z-score:-2.61E+00 | ||
Methylation in Case |
6.68E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in breast cancer | [ 5 ] | |||
Location |
Body (cg03405781) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:8.80E-08; Z-score:-1.61E+00 | ||
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in breast cancer | [ 5 ] | |||
Location |
Body (cg10403518) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:7.52E-03; Z-score:-5.76E-01 | ||
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC9A4 in breast cancer | [ 5 ] | |||
Location |
Body (cg02552255) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.41E-02; Z-score:7.67E-01 | ||
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 4.09E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC9A4 in breast cancer | [ 5 ] | |||
Location |
3'UTR (cg20061812) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.93E-03; Z-score:-2.56E-01 | ||
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in lung adenocarcinoma | [ 6 ] | |||
Location |
Body (cg03405781) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:4.02E-03; Z-score:-9.45E+00 | ||
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in lung adenocarcinoma | [ 6 ] | |||
Location |
Body (cg02552255) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:6.18E-03; Z-score:-1.66E+00 | ||
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC9A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg02552255) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.52E-10; Z-score:-2.05E+00 | ||
Methylation in Case |
7.30E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC9A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg16237262) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.75E-02; Z-score:-5.15E-01 | ||
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC9A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
3'UTR (cg20061812) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.36E-02; Z-score:-3.45E-01 | ||
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant/significant hypermethylation of SLC9A4 in liver cancer than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000123451; Fold-change:-0.353722453; Z-score:-1.193346582 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:3.95E-11; Fold-change:-0.370088402; Z-score:-2.850790588 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
![]() |
![]() | ||||
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC9A4 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.00357527; Fold-change:-0.24761719; Z-score:-0.844074398 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC9A4 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.001834399; Fold-change:-0.252257802; Z-score:-0.914248722 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC9A4 in prostate cancer than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer [ICD-11:2C82] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.044895679; Fold-change:0.307468911; Z-score:1.126293175 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Chordoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A4 in chordoma than that in healthy individual | ||||
Studied Phenotype |
Chordoma [ICD-11:5A61.0] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.92E-06; Fold-change:-0.497255122; Z-score:-6.897892165 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A4 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.79E-10; Fold-change:-0.790067618; Z-score:-2.359496241 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A4 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:5.60E-06; Fold-change:-0.472941374; Z-score:-1.606261339 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Multilayered rosettes embryonal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A4 in multilayered rosettes embryonal tumour than that in healthy individual | ||||
Studied Phenotype |
Multilayered rosettes embryonal tumour [ICD-11:2A00.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.16E-12; Fold-change:-0.716012396; Z-score:-2.327814511 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Peripheral neuroectodermal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A4 in peripheral neuroectodermal tumour than that in healthy individual | ||||
Studied Phenotype |
Peripheral neuroectodermal tumour [ICD-11:2B52] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000521221; Fold-change:-0.47907578; Z-score:-1.62943807 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A4 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.013349598; Fold-change:-0.324345406; Z-score:-15.413542 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
microRNA |
|||||
Unclear Phenotype |
32 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-369 directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-369 | miRNA Mature ID | miR-369-3p | ||
miRNA Sequence |
AAUAAUACAUGGUUGAUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon2 |
miR-374a directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-374a | miRNA Mature ID | miR-374a-5p | ||
miRNA Sequence |
UUAUAAUACAACCUGAUAAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon3 |
miR-374b directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-374b | miRNA Mature ID | miR-374b-5p | ||
miRNA Sequence |
AUAUAAUACAACCUGCUAAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon4 |
miR-548a directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548a | miRNA Mature ID | miR-548a-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGAGUUUUACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon5 |
miR-548ab directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ab | miRNA Mature ID | miR-548ab | ||
miRNA Sequence |
AAAAGUAAUUGUGGAUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon6 |
miR-548ad directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ad | miRNA Mature ID | miR-548ad-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon7 |
miR-548ae directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ae | miRNA Mature ID | miR-548ae-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon8 |
miR-548ak directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ak | miRNA Mature ID | miR-548ak | ||
miRNA Sequence |
AAAAGUAACUGCGGUUUUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon9 |
miR-548am directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548am | miRNA Mature ID | miR-548am-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon10 |
miR-548ap directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ap | miRNA Mature ID | miR-548ap-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon11 |
miR-548aq directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548aq | miRNA Mature ID | miR-548aq-5p | ||
miRNA Sequence |
GAAAGUAAUUGCUGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon12 |
miR-548ar directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ar | miRNA Mature ID | miR-548ar-5p | ||
miRNA Sequence |
AAAAGUAAUUGCAGUUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon13 |
miR-548as directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548as | miRNA Mature ID | miR-548as-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGGUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon14 |
miR-548au directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548au | miRNA Mature ID | miR-548au-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon15 |
miR-548av directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548av | miRNA Mature ID | miR-548av-5p | ||
miRNA Sequence |
AAAAGUACUUGCGGAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon16 |
miR-548ay directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ay | miRNA Mature ID | miR-548ay-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon17 |
miR-548b directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548b | miRNA Mature ID | miR-548b-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon18 |
miR-548bb directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548bb | miRNA Mature ID | miR-548bb-5p | ||
miRNA Sequence |
AAAAGUAACUAUGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon19 |
miR-548c directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon20 |
miR-548d directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548d | miRNA Mature ID | miR-548d-5p | ||
miRNA Sequence |
AAAAGUAAUUGUGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon21 |
miR-548h directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548h | miRNA Mature ID | miR-548h-5p | ||
miRNA Sequence |
AAAAGUAAUCGCGGUUUUUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon22 |
miR-548i directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548i | miRNA Mature ID | miR-548i | ||
miRNA Sequence |
AAAAGUAAUUGCGGAUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon23 |
miR-548j directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548j | miRNA Mature ID | miR-548j-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUCUUUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon24 |
miR-548k directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548k | miRNA Mature ID | miR-548k | ||
miRNA Sequence |
AAAAGUACUUGCGGAUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon25 |
miR-548l directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548l | miRNA Mature ID | miR-548l | ||
miRNA Sequence |
AAAAGUAUUUGCGGGUUUUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon26 |
miR-548o directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548o | miRNA Mature ID | miR-548o-5p | ||
miRNA Sequence |
AAAAGUAAUUGCGGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon27 |
miR-548w directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548w | miRNA Mature ID | miR-548w | ||
miRNA Sequence |
AAAAGUAACUGCGGUUUUUGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon28 |
miR-548y directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548y | miRNA Mature ID | miR-548y | ||
miRNA Sequence |
AAAAGUAAUCACUGUUUUUGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon29 |
miR-559 directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-559 | miRNA Mature ID | miR-559 | ||
miRNA Sequence |
UAAAGUAAAUAUGCACCAAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon30 |
miR-5692b directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5692b | miRNA Mature ID | miR-5692b | ||
miRNA Sequence |
AAUAAUAUCACAGUAGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon31 |
miR-5692c directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5692c | miRNA Mature ID | miR-5692c | ||
miRNA Sequence |
AAUAAUAUCACAGUAGGUGUAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon32 |
miR-8054 directly targets SLC9A4 | [ 8 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8054 | miRNA Mature ID | miR-8054 | ||
miRNA Sequence |
GAAAGUACAGAUCGGAUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.