Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0465 Transporter Info
Gene Name SLC7A13
Transporter Name Sodium-independent aspartate/glutamate transporter 1
Gene ID
157724
UniProt ID
Q8TCU3
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in bladder cancer [ 1 ]

Location

 TSS1500 (cg17719360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.11E+00 Statistic Test p-value:7.22E-05; Z-score:-4.64E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in bladder cancer [ 1 ]

Location

 TSS1500 (cg02279147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:3.25E-03; Z-score:-5.07E+00

Methylation in Case

 7.70E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC7A13 in bladder cancer [ 1 ]

Location

 TSS1500 (cg10207510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.96E-03; Z-score:-2.87E+00

Methylation in Case

 8.41E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC7A13 in bladder cancer [ 1 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.92E+00 Statistic Test p-value:1.79E-04; Z-score:-3.54E+00

Methylation in Case

 3.27E-01 (Median) Methylation in Control 6.28E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in breast cancer [ 2 ]

Location

 TSS1500 (cg02279147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.43E-02; Z-score:-3.28E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg17719360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.08E+00 Statistic Test p-value:2.09E-08; Z-score:-3.18E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg10207510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.55E-05; Z-score:-1.70E+00

Methylation in Case

 8.86E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC7A13 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg02279147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:8.85E-05; Z-score:-7.02E-01

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC7A13 in colorectal cancer [ 3 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.23E+00 Statistic Test p-value:4.42E-08; Z-score:-1.68E+00

Methylation in Case

 5.57E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in HIV infection [ 4 ]

Location

 TSS1500 (cg02279147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:3.72E-02; Z-score:-5.56E-01

Methylation in Case

 8.64E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in HIV infection [ 4 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:9.96E-03; Z-score:-3.95E-01

Methylation in Case

 5.02E-01 (Median) Methylation in Control 5.37E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in lung adenocarcinoma [ 5 ]

Location

 TSS1500 (cg02279147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:2.63E-03; Z-score:-6.77E+00

Methylation in Case

 8.00E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in lung adenocarcinoma [ 5 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:2.95E-03; Z-score:-1.91E+00

Methylation in Case

 5.51E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in panic disorder [ 6 ]

Location

 TSS1500 (cg17719360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.07E+00 Statistic Test p-value:1.65E-03; Z-score:5.96E-01

Methylation in Case

 2.44E+00 (Median) Methylation in Control 2.27E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in panic disorder [ 6 ]

Location

 TSS1500 (cg10207510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:2.11E-02; Z-score:3.72E-01

Methylation in Case

 1.62E+00 (Median) Methylation in Control 1.49E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC7A13 in panic disorder [ 6 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.54E-01 Statistic Test p-value:4.52E-02; Z-score:1.59E-01

Methylation in Case

 -9.98E-01 (Median) Methylation in Control -1.05E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg10207510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:2.57E-02; Z-score:-4.79E-02

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:8.83E-06; Z-score:-1.02E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in systemic lupus erythematosus [ 8 ]

Location

 TSS1500 (cg02279147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:1.53E-02; Z-score:-1.55E-01

Methylation in Case

 8.69E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in systemic lupus erythematosus [ 8 ]

Location

 TSS200 (cg14588399)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:4.36E-03; Z-score:-3.24E-01

Methylation in Case

 5.75E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg15275965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.55E+00 Statistic Test p-value:1.18E-19; Z-score:-2.78E+00

Methylation in Case

 4.89E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC7A13 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg26327804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.76E+00 Statistic Test p-value:3.38E-19; Z-score:4.84E+00

Methylation in Case

 4.69E-01 (Median) Methylation in Control 2.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg14511417)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:3.61E-03; Z-score:1.34E+00

Methylation in Case

 8.07E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC7A13 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 3'UTR (cg09548292)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.58E+00 Statistic Test p-value:1.39E-12; Z-score:-1.97E+00

Methylation in Case

 3.61E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-335 directly targets SLC7A13 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.