Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0461 Transporter Info
Gene Name	SLC6A9
Transporter Name	Sodium- and chloride-dependent glycine transporter 1
Gene ID	6536
UniProt ID	P48067

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg00143623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:4.26E-09; Z-score:-1.99E+00
Methylation in Case	4.39E-01 (Median)	Methylation in Control	7.00E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.66E+00	Statistic Test	p-value:3.63E-08; Z-score:1.58E+00
Methylation in Case	9.07E-01 (Median)	Methylation in Control	5.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg10588679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.99E-07; Z-score:1.13E+00
Methylation in Case	7.88E-01 (Median)	Methylation in Control	6.96E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:3.14E-07; Z-score:-1.28E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg12461125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:3.79E-07; Z-score:-1.43E+00
Methylation in Case	4.51E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg15114744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.08E-06; Z-score:-1.35E+00
Methylation in Case	7.43E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg24524850)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:8.15E-06; Z-score:-8.67E-01
Methylation in Case	9.00E-01 (Median)	Methylation in Control	9.24E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.63E+00	Statistic Test	p-value:5.23E-09; Z-score:-1.10E+01
Methylation in Case	2.58E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.07E-05; Z-score:-2.07E+01
Methylation in Case	7.19E-01 (Median)	Methylation in Control	9.44E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg12461125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:1.08E-04; Z-score:-3.35E+00
Methylation in Case	4.07E-02 (Median)	Methylation in Control	5.08E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg15114744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.02E-04; Z-score:2.89E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	TSS1500 (cg04093149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:2.78E-05; Z-score:3.68E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	TSS1500 (cg04833514)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:1.35E-04; Z-score:3.93E+00
Methylation in Case	6.87E-01 (Median)	Methylation in Control	5.01E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A9 in bladder cancer			[ 2 ]
Location	TSS1500 (cg12133952)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:6.81E-03; Z-score:-3.01E+00
Methylation in Case	1.46E-01 (Median)	Methylation in Control	1.98E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in breast cancer			[ 3 ]
Location	5'UTR (cg15114744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:2.27E-08; Z-score:1.09E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in breast cancer			[ 3 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:1.21E-03; Z-score:1.79E+00
Methylation in Case	3.62E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in breast cancer			[ 3 ]
Location	TSS1500 (cg12133952)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:1.01E-05; Z-score:1.90E+00
Methylation in Case	2.32E-01 (Median)	Methylation in Control	1.79E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg10588679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:4.57E-05; Z-score:9.06E-01
Methylation in Case	2.87E-02 (Median)	Methylation in Control	2.47E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:9.35E-04; Z-score:1.48E+00
Methylation in Case	9.56E-01 (Median)	Methylation in Control	9.45E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:2.08E-03; Z-score:1.96E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	3.91E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg12461125)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:1.04E-02; Z-score:4.69E-01
Methylation in Case	9.64E-03 (Median)	Methylation in Control	8.59E-03 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg12133952)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:2.88E-05; Z-score:1.35E+00
Methylation in Case	2.15E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg04093149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:3.02E-05; Z-score:2.13E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	4.25E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg18183642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.50E-03; Z-score:2.68E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:6.35E+00	Statistic Test	p-value:2.00E-05; Z-score:7.38E+00
Methylation in Case	3.67E-01 (Median)	Methylation in Control	5.79E-02 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	Body (cg07160746)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.45E-05; Z-score:1.20E+00
Methylation in Case	6.39E-01 (Median)	Methylation in Control	5.63E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	Body (cg12111714)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:1.50E-05; Z-score:1.06E+00
Methylation in Case	8.00E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	Body (cg05942022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.85E-04; Z-score:-1.65E+00
Methylation in Case	4.32E-01 (Median)	Methylation in Control	5.17E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	Body (cg25517015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.69E-04; Z-score:-1.71E+00
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	Body (cg05778820)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:3.72E-04; Z-score:1.78E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	6.59E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A9 in colon adenocarcinoma			[ 5 ]
Location	Body (cg19236645)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.62E-03; Z-score:-1.48E+00
Methylation in Case	6.48E-01 (Median)	Methylation in Control	7.19E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in colorectal cancer			[ 6 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.81E-03; Z-score:-9.00E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in colorectal cancer			[ 6 ]
Location	5'UTR (cg10588679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.72E-02; Z-score:7.71E-01
Methylation in Case	9.64E-02 (Median)	Methylation in Control	8.69E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in depression			[ 7 ]
Location	5'UTR (cg10588679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.23E-02; Z-score:6.29E-01
Methylation in Case	6.33E-02 (Median)	Methylation in Control	5.91E-02 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg15114744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.56E-03; Z-score:-1.22E-01
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg24524850)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.65E-02; Z-score:4.91E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	9.88E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.51E-02; Z-score:-1.39E-01
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg10588679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.94E-02; Z-score:3.23E-01
Methylation in Case	6.07E-02 (Median)	Methylation in Control	5.80E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg11945507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.52E+00	Statistic Test	p-value:1.55E-16; Z-score:-4.32E+00
Methylation in Case	5.10E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg12440751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:1.28E-15; Z-score:-5.50E+00
Methylation in Case	5.71E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg12092346)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.70E-13; Z-score:2.22E+00
Methylation in Case	8.10E-01 (Median)	Methylation in Control	6.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg09648809)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:4.01E-10; Z-score:-5.61E+00
Methylation in Case	8.04E-01 (Median)	Methylation in Control	9.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC6A9 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg15338782)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:9.13E-10; Z-score:-2.52E+00
Methylation in Case	4.04E-01 (Median)	Methylation in Control	5.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in HIV infection			[ 9 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:6.59E-07; Z-score:1.48E+00
Methylation in Case	6.82E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in HIV infection			[ 9 ]
Location	5'UTR (cg11207893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.67E-02; Z-score:3.85E-01
Methylation in Case	9.92E-01 (Median)	Methylation in Control	9.85E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in HIV infection			[ 9 ]
Location	TSS1500 (cg12133952)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.56E-05; Z-score:1.56E+00
Methylation in Case	3.56E-01 (Median)	Methylation in Control	3.05E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in HIV infection			[ 9 ]
Location	TSS1500 (cg04093149)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:5.96E-04; Z-score:1.07E+00
Methylation in Case	8.84E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in HIV infection			[ 9 ]
Location	TSS1500 (cg04833514)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.52E-03; Z-score:3.26E-01
Methylation in Case	8.77E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg15114744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:6.77E-03; Z-score:1.28E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:4.30E-02; Z-score:1.82E+00
Methylation in Case	5.91E-01 (Median)	Methylation in Control	5.15E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg18183642)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:8.94E-03; Z-score:3.34E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	6.38E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC6A9 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg04833514)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.71E-02; Z-score:1.47E+00
Methylation in Case	7.58E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC6A9 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg12133952)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:4.69E-02; Z-score:3.31E+00
Methylation in Case	3.52E-01 (Median)	Methylation in Control	2.93E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in pancretic ductal adenocarcinoma			[ 11 ]
Location	5'UTR (cg09552652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:8.04E-05; Z-score:1.46E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	6.33E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in pancretic ductal adenocarcinoma			[ 11 ]
Location	Body (cg13767768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.98E-09; Z-score:-9.27E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in panic disorder			[ 12 ]
Location	5'UTR (cg00143623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:9.86E-01	Statistic Test	p-value:1.28E-02; Z-score:2.96E-01
Methylation in Case	-4.72E+00 (Median)	Methylation in Control	-4.78E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in panic disorder			[ 12 ]
Location	5'UTR (cg15114744)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.35E-02; Z-score:3.46E-01
Methylation in Case	3.26E+00 (Median)	Methylation in Control	3.15E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in systemic lupus erythematosus			[ 13 ]
Location	5'UTR (cg00143623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.38E-02; Z-score:-1.80E-01
Methylation in Case	7.27E-02 (Median)	Methylation in Control	7.58E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC6A9 in systemic lupus erythematosus			[ 13 ]
Location	5'UTR (cg04682775)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.46E-02; Z-score:9.86E-02
Methylation in Case	6.80E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC6A9 in systemic lupus erythematosus			[ 13 ]
Location	5'UTR (cg10588679)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.15E-02; Z-score:-1.56E-01
Methylation in Case	8.31E-02 (Median)	Methylation in Control	8.56E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in papillary thyroid cancer			[ 14 ]
Location	TSS1500 (cg04833514)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:3.36E-06; Z-score:1.10E+00
Methylation in Case	6.46E-01 (Median)	Methylation in Control	5.62E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC6A9 in prostate cancer			[ 15 ]
Location	TSS1500 (cg00727912)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.43E+00	Statistic Test	p-value:4.37E-02; Z-score:5.34E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	3.82E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Arterial aneurysm	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC6A9 in arterial aneurysm than that in healthy individual
Studied Phenotype	Arterial aneurysm [ICD-11:BD51]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.002990999; Fold-change:0.458538016; Z-score:1.637808379
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC6A9 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.41E-20; Fold-change:-0.34785182; Z-score:-1.69584376
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Glioblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypomethylation of SLC6A9 in glioblastoma than that in healthy individual
Studied Phenotype	Glioblastoma [ICD-11:2A00.00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.57E-07; Fold-change:-0.513340354; Z-score:-2.034342377
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-103a directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-103a	miRNA Mature ID	miR-103a-3p
miRNA Sequence	AGCAGCAUUGUACAGGGCUAUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	miR-221 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-221	miRNA Mature ID	miR-221-3p
miRNA Sequence	AGCUACAUUGUCUGCUGGGUUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	miR-26b directly targets SLC6A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon4	miR-3122 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3122	miRNA Mature ID	miR-3122
miRNA Sequence	GUUGGGACAAGAGGACGGUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon5	miR-335 directly targets SLC6A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-3616 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3616	miRNA Mature ID	miR-3616-3p
miRNA Sequence	CGAGGGCAUUUCAUGAUGCAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon7	miR-3913 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3913	miRNA Mature ID	miR-3913-5p
miRNA Sequence	UUUGGGACUGAUCUUGAUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon8	miR-4436b directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4436b	miRNA Mature ID	miR-4436b-3p
miRNA Sequence	CAGGGCAGGAAGAAGUGGACAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon9	miR-4463 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4463	miRNA Mature ID	miR-4463
miRNA Sequence	GAGACUGGGGUGGGGCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon10	miR-4632 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4632	miRNA Mature ID	miR-4632-5p
miRNA Sequence	GAGGGCAGCGUGGGUGUGGCGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon11	miR-4747 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4747	miRNA Mature ID	miR-4747-5p
miRNA Sequence	AGGGAAGGAGGCUUGGUCUUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon12	miR-5196 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5196	miRNA Mature ID	miR-5196-5p
miRNA Sequence	AGGGAAGGGGACGAGGGUUGGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon13	miR-6513 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6513	miRNA Mature ID	miR-6513-5p
miRNA Sequence	UUUGGGAUUGACGCCACAUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon14	miR-6735 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6735	miRNA Mature ID	miR-6735-5p
miRNA Sequence	CAGGGCAGAGGGCACAGGAAUCUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon15	miR-6879 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6879	miRNA Mature ID	miR-6879-5p
miRNA Sequence	CAGGGCAGGGAAGGUGGGAGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon16	miR-7 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing//PAR-CLIP
miRNA Stemloop ID	miR-7	miRNA Mature ID	miR-7-5p
miRNA Sequence	UGGAAGACUAGUGAUUUUGUUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon17	miR-7843 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7843	miRNA Mature ID	miR-7843-5p
miRNA Sequence	GAGGGCAGAGCCAGCUUCCUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon18	miR-887 directly targets SLC6A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-887	miRNA Mature ID	miR-887-5p
miRNA Sequence	CUUGGGAGCCCUGUUAGACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
18	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence