Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0453 Transporter Info | ||||
| Gene Name | SLC6A20 | ||||
| Transporter Name | Sodium/imino-acid transporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC6A20 in bladder cancer | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Frequency |
33 (16%) out of the 212 studied tumor sample | ||||
|
Experimental Material |
Chinese patient tissue samples | ||||
|
Mesothelioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC6A20 in mesothelioma | [ 2 ] | |||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Studied Phenotype |
Mesothelioma[ ICD-11:2C26] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SLC6A20 methylation-associated silencing might affect resistance of cells to chemotherapy. | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1228 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1228 | miRNA Mature ID | miR-1228-3p | ||
|
miRNA Sequence |
UCACACCUGCCUCGCCCCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-3074 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3074 | miRNA Mature ID | miR-3074-5p | ||
|
miRNA Sequence |
GUUCCUGCUGAACUGAGCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-6072 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6072 | miRNA Mature ID | miR-6072 | ||
|
miRNA Sequence |
UCCUCAUCACACUGCACCUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-670 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-670 | miRNA Mature ID | miR-670-3p | ||
|
miRNA Sequence |
UUUCCUCAUAUUCAUUCAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-6891 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6891 | miRNA Mature ID | miR-6891-3p | ||
|
miRNA Sequence |
CCCUCAUCUUCCCCUCCUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-7702 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7702 | miRNA Mature ID | miR-7702 | ||
|
miRNA Sequence |
CUUAGACUGCCAGACUCCCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-8064 directly targets SLC6A20 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8064 | miRNA Mature ID | miR-8064 | ||
|
miRNA Sequence |
AGCACACUGAGCGAGCGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.