Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0419 Transporter Info | ||||
Gene Name | SLC5A10 | ||||
Transporter Name | Sodium/glucose cotransporter 5 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-335 directly targets SLC5A10 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC5A10 in liver cancer than that in healthy individual | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.95E-10; Fold-change:-0.216223054; Z-score:-4.307760433 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
![]() |
![]() | ||||
Ovarian cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC5A10 in ovarian cancer than that in healthy individual | ||||
Studied Phenotype |
Ovarian cancer [ICD-11:2C73] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.017258745; Fold-change:0.310770847; Z-score:1.289637986 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Uterine carcinosarcoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC5A10 in uterine carcinosarcoma than that in healthy individual | ||||
Studied Phenotype |
Uterine carcinosarcoma [ICD-11:2B5F] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.88E-05; Fold-change:0.521404487; Z-score:2.163726228 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
References | |||||
---|---|---|---|---|---|
1 | Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.