General Information of Drug Transporter (DT)
DT ID DTD0388 Transporter Info
Gene Name SLC4A8
Transporter Name Electroneutral sodium bicarbonate exchanger 1
Gene ID
9498
UniProt ID
Q2Y0W8
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in prostate cancer [ 1 ]

Location

Body (cg19599368)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:4.36E-02; Z-score:1.58E+00

Methylation in Case

8.47E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:3.71E-10; Z-score:-1.71E+00

Methylation in Case

7.26E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in bladder cancer [ 3 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.52E+00 Statistic Test p-value:5.83E-06; Z-score:-3.12E+01

Methylation in Case

5.70E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in breast cancer [ 4 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.20E-08; Z-score:-1.36E+00

Methylation in Case

8.02E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in colorectal cancer [ 5 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.49E-05; Z-score:-1.79E+00

Methylation in Case

9.01E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:7.09E-07; Z-score:-8.85E-01

Methylation in Case

7.13E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in HIV infection [ 7 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.17E-03; Z-score:-5.62E-01

Methylation in Case

9.00E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in panic disorder [ 8 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.82E-04; Z-score:8.16E-01

Methylation in Case

3.15E+00 (Median) Methylation in Control 2.93E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in papillary thyroid cancer [ 9 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.79E-03; Z-score:-6.69E-01

Methylation in Case

9.14E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC4A8 in systemic lupus erythematosus [ 10 ]

Location

3'UTR (cg20445094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.10E-02; Z-score:-3.08E-01

Methylation in Case

8.84E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC4A8 in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.53E-08; Fold-change:0.309187693; Z-score:2.764612831
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC4A8 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.73E-15; Fold-change:-0.445506373; Z-score:-17.31416746
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC4A8 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.33E-08; Fold-change:-0.348642763; Z-score:-2.56712193
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets SLC4A8 [ 11 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.