Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0383 Transporter Info
Gene Name	SLC4A2
Transporter Name	Anion exchange protein 2
Gene ID	6522
UniProt ID	P04920

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg10842164)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:2.38E-07; Z-score:-1.42E+00
Methylation in Case	5.93E-01 (Median)	Methylation in Control	6.87E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg10920230)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.96E-07; Z-score:-1.12E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg13145017)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:4.89E-07; Z-score:-1.21E+00
Methylation in Case	3.44E-01 (Median)	Methylation in Control	5.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg01971363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:1.07E-04; Z-score:1.13E+00
Methylation in Case	7.99E-01 (Median)	Methylation in Control	6.11E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg03426615)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.44E-04; Z-score:-5.97E-01
Methylation in Case	8.48E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04824535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:9.65E-04; Z-score:-6.52E-01
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg06018240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:2.06E-03; Z-score:1.13E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	4.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg02367856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:3.75E-15; Z-score:-2.58E+00
Methylation in Case	7.29E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg15387987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:5.92E-11; Z-score:-1.80E+00
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC4A2 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg24316073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:1.33E-09; Z-score:-1.60E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	5'UTR (cg10842164)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.51E+00	Statistic Test	p-value:8.16E-12; Z-score:1.35E+01
Methylation in Case	7.31E-01 (Median)	Methylation in Control	4.82E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg22151713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:7.01E-08; Z-score:1.29E+01
Methylation in Case	8.02E-01 (Median)	Methylation in Control	5.47E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg06018240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:8.83E-08; Z-score:7.18E+00
Methylation in Case	8.13E-01 (Median)	Methylation in Control	6.77E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg19502841)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.13E-05; Z-score:4.17E+00
Methylation in Case	7.29E-01 (Median)	Methylation in Control	6.72E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg01971363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.60E-03; Z-score:2.86E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg17497176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:4.11E-03; Z-score:1.68E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg20898078)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.50E-02; Z-score:1.40E+00
Methylation in Case	9.69E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC4A2 in bladder cancer			[ 2 ]
Location	Body (cg18955629)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:4.21E-02; Z-score:2.77E+00
Methylation in Case	6.05E-01 (Median)	Methylation in Control	4.93E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	5'UTR (cg13145017)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:6.00E-03; Z-score:6.85E-01
Methylation in Case	4.01E-02 (Median)	Methylation in Control	3.12E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	5'UTR (cg10842164)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.21E-02; Z-score:1.05E+00
Methylation in Case	6.94E-01 (Median)	Methylation in Control	6.50E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	5'UTR (cg10920230)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.65E-02; Z-score:2.21E-01
Methylation in Case	1.61E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg17497176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.03E-20; Z-score:2.57E+00
Methylation in Case	7.58E-01 (Median)	Methylation in Control	6.69E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg19502841)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.39E-10; Z-score:1.51E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg03426615)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:6.26E-10; Z-score:1.43E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg22168987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:7.14E-07; Z-score:-1.29E+00
Methylation in Case	6.59E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg06018240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.28E-06; Z-score:1.12E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	7.75E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg18955629)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.52E-03; Z-score:1.08E+00
Methylation in Case	4.88E-01 (Median)	Methylation in Control	4.23E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC4A2 in breast cancer			[ 3 ]
Location	Body (cg20898078)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:6.74E-03; Z-score:4.45E-01
Methylation in Case	9.62E-01 (Median)	Methylation in Control	9.50E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg10842164)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:4.60E-06; Z-score:2.71E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg13145017)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:2.05E-02; Z-score:-5.61E-01
Methylation in Case	2.83E-02 (Median)	Methylation in Control	3.02E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg22168987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.36E-03; Z-score:-1.76E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	6.60E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	5'UTR (cg13145017)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:4.71E-03; Z-score:-6.93E-01
Methylation in Case	3.94E-02 (Median)	Methylation in Control	4.56E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	Body (cg25903588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.47E-03; Z-score:7.18E-01
Methylation in Case	9.51E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	Body (cg03426615)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.12E-02; Z-score:-2.68E-01
Methylation in Case	8.73E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	Body (cg04824535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:2.48E-02; Z-score:1.64E-01
Methylation in Case	9.26E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	3'UTR (cg15387987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:4.29E-08; Z-score:-2.09E+00
Methylation in Case	8.18E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	3'UTR (cg02367856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.41E-04; Z-score:-9.08E-01
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC4A2 in colorectal cancer			[ 5 ]
Location	3'UTR (cg24316073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.61E-03; Z-score:-5.28E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg10842164)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.94E-04; Z-score:-6.94E-01
Methylation in Case	6.98E-01 (Median)	Methylation in Control	7.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg20122849)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:4.07E-15; Z-score:-7.11E+00
Methylation in Case	5.45E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg22151713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.15E-08; Z-score:-1.44E+00
Methylation in Case	3.95E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg03426615)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.44E-02; Z-score:-3.15E-01
Methylation in Case	9.23E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg15387987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.25E-04; Z-score:-7.32E-01
Methylation in Case	7.63E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg02367856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.18E-03; Z-score:-3.48E-01
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	5'UTR (cg13145017)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:4.38E-02; Z-score:-5.06E-01
Methylation in Case	8.81E-02 (Median)	Methylation in Control	9.32E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg18955629)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:7.04E-14; Z-score:-4.22E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	7.94E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg17497176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:9.51E-07; Z-score:1.40E+00
Methylation in Case	8.46E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg01971363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.48E-04; Z-score:-8.53E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg22151713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.74E-03; Z-score:8.79E-01
Methylation in Case	7.23E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg20898078)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:3.61E-03; Z-score:6.30E-01
Methylation in Case	9.39E-01 (Median)	Methylation in Control	9.34E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	Body (cg04824535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.10E-02; Z-score:-6.71E-01
Methylation in Case	8.72E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC4A2 in papillary thyroid cancer			[ 7 ]
Location	3'UTR (cg15387987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.14E-04; Z-score:1.64E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in colon adenocarcinoma			[ 8 ]
Location	TSS1500 (cg11742202)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:3.00E-03; Z-score:-1.76E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	2.24E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in colon adenocarcinoma			[ 8 ]
Location	Body (cg13889508)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:4.02E-06; Z-score:-4.18E+00
Methylation in Case	7.16E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in colon adenocarcinoma			[ 8 ]
Location	Body (cg08792812)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:6.87E-04; Z-score:-1.76E+00
Methylation in Case	3.60E-01 (Median)	Methylation in Control	4.41E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg27036111)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:1.28E-10; Z-score:1.81E+00
Methylation in Case	5.41E-01 (Median)	Methylation in Control	4.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg12133118)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:1.08E-03; Z-score:9.90E-01
Methylation in Case	5.96E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg06288351)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:1.75E-14; Z-score:-2.37E+00
Methylation in Case	2.36E-01 (Median)	Methylation in Control	3.15E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg22165524)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.97E-04; Z-score:1.06E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	7.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg15523980)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.25E-03; Z-score:-4.16E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.98E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg08411738)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:2.67E-03; Z-score:8.89E-01
Methylation in Case	8.50E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC4A2 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg12583394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:2.27E-02; Z-score:7.18E-02
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in prostate cancer			[ 10 ]
Location	TSS1500 (cg10678459)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.84E-02; Z-score:1.85E+00
Methylation in Case	7.67E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in prostate cancer			[ 10 ]
Location	Body (cg02295574)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:3.72E-03; Z-score:6.35E+00
Methylation in Case	9.41E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in prostate cancer			[ 10 ]
Location	Body (cg08450807)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:2.64E-02; Z-score:-7.72E+00
Methylation in Case	7.64E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
HIV infection	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in HIV infection			[ 11 ]
Location	Body (cg03426615)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.33E-09; Z-score:1.67E+00
Methylation in Case	9.54E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC4A2 in HIV infection			[ 11 ]
Location	Body (cg17497176)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:8.81E-05; Z-score:7.16E-01
Methylation in Case	8.88E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC4A2 in HIV infection			[ 11 ]
Location	Body (cg18955629)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.04E-02; Z-score:5.04E-01
Methylation in Case	9.03E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC4A2 in HIV infection			[ 11 ]
Location	Body (cg01971363)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.00E+00	Statistic Test	p-value:1.46E-02; Z-score:4.32E-01
Methylation in Case	9.65E-01 (Median)	Methylation in Control	9.61E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC4A2 in lung adenocarcinoma			[ 12 ]
Location	Body (cg25903588)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.04E-02; Z-score:8.93E-01
Methylation in Case	9.21E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	48 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1205 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1205	miRNA Mature ID	miR-1205
miRNA Sequence	UCUGCAGGGUUUGCUUUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-1253 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1253	miRNA Mature ID	miR-1253
miRNA Sequence	AGAGAAGAAGAUCAGCCUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-1275 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1275	miRNA Mature ID	miR-1275
miRNA Sequence	GUGGGGGAGAGGCUGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-1296 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1296	miRNA Mature ID	miR-1296-3p
miRNA Sequence	GAGUGGGGCUUCGACCCUAACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-16 directly targets SLC4A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon6	miR-1909 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1909	miRNA Mature ID	miR-1909-3p
miRNA Sequence	CGCAGGGGCCGGGUGCUCACCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-194 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-194	miRNA Mature ID	miR-194-3p
miRNA Sequence	CCAGUGGGGCUGCUGUUAUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-3150b directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3150b	miRNA Mature ID	miR-3150b-3p
miRNA Sequence	UGAGGAGAUCGUCGAGGUUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-330 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-330	miRNA Mature ID	miR-330-3p
miRNA Sequence	GCAAAGCACACGGCCUGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-34a directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-34a	miRNA Mature ID	miR-34a-5p
miRNA Sequence	UGGCAGUGUCUUAGCUGGUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-34c directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-34c	miRNA Mature ID	miR-34c-5p
miRNA Sequence	AGGCAGUGUAGUUAGCUGAUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-3926 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3926	miRNA Mature ID	miR-3926
miRNA Sequence	UGGCCAAAAAGCAGGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-4418 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4418	miRNA Mature ID	miR-4418
miRNA Sequence	CACUGCAGGACUCAGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-4434 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4434	miRNA Mature ID	miR-4434
miRNA Sequence	AGGAGAAGUAAAGUAGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-4447 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4447	miRNA Mature ID	miR-4447
miRNA Sequence	GGUGGGGGCUGUUGUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-4472 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4472	miRNA Mature ID	miR-4472
miRNA Sequence	GGUGGGGGGUGUUGUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-449a directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-449a	miRNA Mature ID	miR-449a
miRNA Sequence	UGGCAGUGUAUUGUUAGCUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-449b directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-449b	miRNA Mature ID	miR-449b-5p
miRNA Sequence	AGGCAGUGUAUUGUUAGCUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-4516 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4516	miRNA Mature ID	miR-4516
miRNA Sequence	GGGAGAAGGGUCGGGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-4525 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4525	miRNA Mature ID	miR-4525
miRNA Sequence	GGGGGGAUGUGCAUGCUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-455 directly targets SLC4A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-455	miRNA Mature ID	miR-455-3p
miRNA Sequence	GCAGUCCAUGGGCAUAUACAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon22	miR-4665 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4665	miRNA Mature ID	miR-4665-5p
miRNA Sequence	CUGGGGGACGCGUGAGCGCGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-4688 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4688	miRNA Mature ID	miR-4688
miRNA Sequence	UAGGGGCAGCAGAGGACCUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-4723 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4723	miRNA Mature ID	miR-4723-5p
miRNA Sequence	UGGGGGAGCCAUGAGAUAAGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-4784 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4784	miRNA Mature ID	miR-4784
miRNA Sequence	UGAGGAGAUGCUGGGACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-484 directly targets SLC4A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-484	miRNA Mature ID	miR-484
miRNA Sequence	UCAGGCUCAGUCCCCUCCCGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon27	miR-486 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-486	miRNA Mature ID	miR-486-3p
miRNA Sequence	CGGGGCAGCUCAGUACAGGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-5010 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5010	miRNA Mature ID	miR-5010-5p
miRNA Sequence	AGGGGGAUGGCAGAGCAAAAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-509 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-509	miRNA Mature ID	miR-509-5p
miRNA Sequence	UACUGCAGACAGUGGCAAUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-5698 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-5703 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5703	miRNA Mature ID	miR-5703
miRNA Sequence	AGGAGAAGUCGGGAAGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-6132 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6132	miRNA Mature ID	miR-6132
miRNA Sequence	AGCAGGGCUGGGGAUUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-615 directly targets SLC4A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-615	miRNA Mature ID	miR-615-3p
miRNA Sequence	UCCGAGCCUGGGUCUCCCUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon34	miR-625 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-625	miRNA Mature ID	miR-625-5p
miRNA Sequence	AGGGGGAAAGUUCUAUAGUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon35	miR-6722 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6722	miRNA Mature ID	miR-6722-3p
miRNA Sequence	UGCAGGGGUCGGGUGGGCCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon36	miR-6743 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6743	miRNA Mature ID	miR-6743-5p
miRNA Sequence	AAGGGGCAGGGACGGGUGGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon37	miR-6807 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6807	miRNA Mature ID	miR-6807-3p
miRNA Sequence	CACUGCAUUCCUGCUUGGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon38	miR-6825 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon39	miR-6835 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6835	miRNA Mature ID	miR-6835-3p
miRNA Sequence	AAAAGCACUUUUCUGUCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon40	miR-6836 directly targets SLC4A2			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6836	miRNA Mature ID	miR-6836-5p
miRNA Sequence	CGCAGGGCCCUGGCGCAGGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon41	miR-6870 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6870	miRNA Mature ID	miR-6870-5p
miRNA Sequence	UGGGGGAGAUGGGGGUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon42	miR-7106 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-7109 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7109	miRNA Mature ID	miR-7109-5p
miRNA Sequence	CUGGGGGGAGGAGACCCUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-7111 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-5p
miRNA Sequence	UGGGGGAGGAAGGACAGGCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon45	miR-765 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-765	miRNA Mature ID	miR-765
miRNA Sequence	UGGAGGAGAAGGAAGGUGAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon46	miR-8087 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8087	miRNA Mature ID	miR-8087
miRNA Sequence	GAAGACUUCUUGGAUUACAGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon47	miR-92a directly targets SLC4A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon48	miR-944 directly targets SLC4A2			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-944	miRNA Mature ID	miR-944
miRNA Sequence	AAAUUAUUGUACAUCGGAUGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
14	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
15	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence