General Information of Drug Transporter (DT)
DT ID DTD0375 Transporter Info
Gene Name SLC48A1
Transporter Name Heme transporter HRG1
Gene ID
55652
UniProt ID
Q6P1K1
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in breast cancer [ 1 ]

Location

TSS200 (cg01379969)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:3.27E-02; Z-score:2.72E-01

Methylation in Case

8.04E-02 (Median) Methylation in Control 7.48E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in breast cancer [ 1 ]

Location

Body (cg12391174)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:3.12E-03; Z-score:-6.42E-01

Methylation in Case

5.86E-02 (Median) Methylation in Control 6.92E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in clear cell renal cell carcinoma [ 2 ]

Location

TSS200 (cg15295332)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.65E-04; Z-score:-7.31E-01

Methylation in Case

3.94E-02 (Median) Methylation in Control 4.21E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

TSS200 (cg15295332)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:3.08E-02; Z-score:-7.89E-01

Methylation in Case

4.68E-02 (Median) Methylation in Control 6.25E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

Body (cg13617811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.64E+00 Statistic Test p-value:3.78E-09; Z-score:-1.96E+00

Methylation in Case

3.27E-01 (Median) Methylation in Control 5.36E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

Body (cg06946447)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:7.70E-03; Z-score:-4.48E-01

Methylation in Case

1.40E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC48A1 in colorectal cancer [ 3 ]

Location

3'UTR (cg14736327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.91E-02; Z-score:-4.37E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in HIV infection [ 4 ]

Location

TSS200 (cg01379969)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.92E-02; Z-score:-3.69E-01

Methylation in Case

9.17E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in HIV infection [ 4 ]

Location

Body (cg16170936)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.71E+00 Statistic Test p-value:3.81E-08; Z-score:3.05E+00

Methylation in Case

3.71E-01 (Median) Methylation in Control 2.18E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC48A1 in HIV infection [ 4 ]

Location

Body (cg13617811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:1.02E-03; Z-score:9.92E-01

Methylation in Case

1.96E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC48A1 in HIV infection [ 4 ]

Location

3'UTR (cg14736327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.54E-03; Z-score:-9.41E-01

Methylation in Case

9.12E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in lung adenocarcinoma [ 5 ]

Location

TSS200 (cg15295332)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:1.39E-02; Z-score:1.52E+00

Methylation in Case

5.63E-02 (Median) Methylation in Control 4.01E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in lung adenocarcinoma [ 5 ]

Location

Body (cg16170936)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:8.53E-03; Z-score:3.00E+00

Methylation in Case

3.04E-01 (Median) Methylation in Control 2.26E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

1stExon (cg15012572)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.55E+00 Statistic Test p-value:1.06E-18; Z-score:-2.98E+00

Methylation in Case

2.37E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

Body (cg01154392)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:4.83E-05; Z-score:1.20E+00

Methylation in Case

7.31E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

Body (cg05936305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.86E-03; Z-score:-7.53E-01

Methylation in Case

6.47E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

Body (cg06946447)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.14E-03; Z-score:2.82E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

Body (cg12391174)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.71E-02; Z-score:6.32E-01

Methylation in Case

6.65E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

Body (cg13617811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.76E-02; Z-score:7.97E-01

Methylation in Case

7.72E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC48A1 in atypical teratoid rhabdoid tumor [ 6 ]

Location

3'UTR (cg14736327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:4.97E-11; Z-score:1.90E+00

Methylation in Case

7.33E-01 (Median) Methylation in Control 5.06E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in systemic lupus erythematosus [ 7 ]

Location

1stExon (cg15012572)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.14E-02; Z-score:1.52E-01

Methylation in Case

2.03E-02 (Median) Methylation in Control 1.93E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in systemic lupus erythematosus [ 7 ]

Location

Body (cg06946447)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.78E-03; Z-score:-1.31E-01

Methylation in Case

1.05E-01 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

Body (cg16170936)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.03E+00 Statistic Test p-value:4.02E-03; Z-score:-3.23E+00

Methylation in Case

1.03E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

Body (cg05936305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.05E-02; Z-score:1.80E+00

Methylation in Case

3.54E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

Body (cg13617811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:2.73E-02; Z-score:2.39E+00

Methylation in Case

2.99E-01 (Median) Methylation in Control 2.18E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC48A1 in bladder cancer [ 8 ]

Location

3'UTR (cg14736327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:9.11E-04; Z-score:-2.58E+00

Methylation in Case

7.20E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in colon adenocarcinoma [ 9 ]

Location

Body (cg08181642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:8.65E-05; Z-score:2.88E+00

Methylation in Case

7.04E-01 (Median) Methylation in Control 6.58E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in depression [ 10 ]

Location

Body (cg01154392)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.63E-02; Z-score:-3.48E-01

Methylation in Case

3.67E-02 (Median) Methylation in Control 3.92E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

Body (cg09058554)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.67E+00 Statistic Test p-value:9.68E-16; Z-score:-2.95E+00

Methylation in Case

3.69E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

Body (cg21602614)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.69E+00 Statistic Test p-value:3.48E-14; Z-score:-3.44E+00

Methylation in Case

2.23E-01 (Median) Methylation in Control 3.77E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

Body (cg13617811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:1.41E-04; Z-score:-1.06E+00

Methylation in Case

2.83E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

Body (cg16170936)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:1.35E-03; Z-score:-1.13E+00

Methylation in Case

1.68E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC48A1 in hepatocellular carcinoma [ 11 ]

Location

3'UTR (cg14736327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.05E-02; Z-score:1.95E-02

Methylation in Case

8.22E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in pancretic ductal adenocarcinoma [ 12 ]

Location

Body (cg19854293)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.12E-04; Z-score:7.61E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in pancretic ductal adenocarcinoma [ 12 ]

Location

Body (cg19848599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.41E-02; Z-score:-2.96E-01

Methylation in Case

7.54E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC48A1 in papillary thyroid cancer [ 13 ]

Location

Body (cg13617811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:4.69E-12; Z-score:-1.94E+00

Methylation in Case

1.55E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC48A1 in papillary thyroid cancer [ 13 ]

Location

3'UTR (cg14736327)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.57E-05; Z-score:-9.34E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-10a directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-10b directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1245b directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1245b miRNA Mature ID miR-1245b-3p

miRNA Sequence

UCAGAUGAUCUAAAGGCCUAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1468 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1468 miRNA Mature ID miR-1468-3p

miRNA Sequence

AGCAAAAUAAGCAAAUGGAAAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-192 directly targets SLC48A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1973 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1973 miRNA Mature ID miR-1973

miRNA Sequence

ACCGUGCAAAGGUAGCAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-19a directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-19b directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-215 directly targets SLC48A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-3175 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3175 miRNA Mature ID miR-3175

miRNA Sequence

CGGGGAGAGAACGCAGUGACGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-3179 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3179 miRNA Mature ID miR-3179

miRNA Sequence

AGAAGGGGUGAAAUUUAAACGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-3190 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3190 miRNA Mature ID miR-3190-5p

miRNA Sequence

UCUGGCCAGCUACGUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-3202 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3202 miRNA Mature ID miR-3202

miRNA Sequence

UGGAAGGGAGAAGAGCUUUAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-339 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-3926 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-423 directly targets SLC48A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-423 miRNA Mature ID miR-423-5p

miRNA Sequence

UGAGGGGCAGAGAGCGAGACUUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-4421 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4421 miRNA Mature ID miR-4421

miRNA Sequence

ACCUGUCUGUGGAAAGGAGCUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-4470 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4470 miRNA Mature ID miR-4470

miRNA Sequence

UGGCAAACGUGGAAGCCGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4684 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

CUCUCUACUGACUUGCAACAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4698 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4698 miRNA Mature ID miR-4698

miRNA Sequence

UCAAAAUGUAGAGGAAGACCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-4716 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4716 miRNA Mature ID miR-4716-3p

miRNA Sequence

AAGGGGGAAGGAAACAUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-4723 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-4747 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4747 miRNA Mature ID miR-4747-5p

miRNA Sequence

AGGGAAGGAGGCUUGGUCUUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-4786 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4786 miRNA Mature ID miR-4786-5p

miRNA Sequence

UGAGACCAGGACUGGAUGCACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-5196 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5196 miRNA Mature ID miR-5196-5p

miRNA Sequence

AGGGAAGGGGACGAGGGUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-548aj directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548aj miRNA Mature ID miR-548aj-5p

miRNA Sequence

UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-548aw directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548aw miRNA Mature ID miR-548aw

miRNA Sequence

GUGCAAAAGUCAUCACGGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-548f directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548f miRNA Mature ID miR-548f-5p

miRNA Sequence

UGCAAAAGUAAUCACAGUUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-548g directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548g miRNA Mature ID miR-548g-5p

miRNA Sequence

UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-548s directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548s miRNA Mature ID miR-548s

miRNA Sequence

AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-548x directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548x miRNA Mature ID miR-548x-5p

miRNA Sequence

UGCAAAAGUAAUUGCAGUUUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-5698 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-5699 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5699 miRNA Mature ID miR-5699-3p

miRNA Sequence

UCCUGUCUUUCCUUGUUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-593 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-593 miRNA Mature ID miR-593-3p

miRNA Sequence

UGUCUCUGCUGGGGUUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-6732 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6732 miRNA Mature ID miR-6732-3p

miRNA Sequence

UAACCCUGUCCUCUCCCUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6794 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6794 miRNA Mature ID miR-6794-5p

miRNA Sequence

CAGGGGGACUGGGGGUGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6818 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6818 miRNA Mature ID miR-6818-3p

miRNA Sequence

UUGUCUCUUGUUCCUCACACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6849 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6870 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

UGGGGGAGAUGGGGGUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-6895 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6895 miRNA Mature ID miR-6895-3p

miRNA Sequence

UGUCUCUCGCCCUUGGCCUUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-7111 directly targets SLC48A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-877 directly targets SLC48A1 [ 17 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-877 miRNA Mature ID miR-877-3p

miRNA Sequence

UCCUCUUCUCCCUCCUCCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-942 directly targets SLC48A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-942 miRNA Mature ID miR-942-3p

miRNA Sequence

CACAUGGCCGAAACAGAGAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 DNA Methylation Dynamics in Urological Tumors.
9 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
15 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
16 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
17 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.