Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0371 Transporter Info | ||||
| Gene Name | SLC45A4 | ||||
| Transporter Name | Solute carrier family 45 member 4 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg10633958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:1.76E-05; Z-score:8.11E-01 | ||
|
Methylation in Case |
2.38E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg16029760) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.46E-02; Z-score:-1.69E-01 | ||
|
Methylation in Case |
8.60E-02 (Median) | Methylation in Control | 9.89E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg06942027) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.53E+00 | Statistic Test | p-value:4.12E-08; Z-score:9.43E-01 | ||
|
Methylation in Case |
1.48E-01 (Median) | Methylation in Control | 9.65E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg17052964) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.38E-07; Z-score:1.67E+00 | ||
|
Methylation in Case |
6.07E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg02870829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.58E-02; Z-score:8.22E-01 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 6.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg01493016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:1.89E-07; Z-score:-1.51E+00 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 2.08E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg18004239) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:9.92E-03; Z-score:-4.42E-01 | ||
|
Methylation in Case |
8.40E-02 (Median) | Methylation in Control | 8.95E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg17263061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.73E+00 | Statistic Test | p-value:3.46E-17; Z-score:2.10E+00 | ||
|
Methylation in Case |
7.39E-02 (Median) | Methylation in Control | 4.28E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg08380411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:1.58E-06; Z-score:1.03E+00 | ||
|
Methylation in Case |
3.65E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg23212579) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.02E-24; Z-score:-7.28E+00 | ||
|
Methylation in Case |
9.12E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg08805144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.42E+00 | Statistic Test | p-value:1.96E-20; Z-score:4.34E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 5.15E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02471153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:5.91E-07; Z-score:1.34E+00 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 3.34E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg10204807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:6.79E-07; Z-score:5.77E-01 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 9.95E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02344497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:3.61E-06; Z-score:-1.05E+00 | ||
|
Methylation in Case |
4.85E-01 (Median) | Methylation in Control | 5.87E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02229775) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:6.01E-06; Z-score:-5.70E-01 | ||
|
Methylation in Case |
8.45E-02 (Median) | Methylation in Control | 9.48E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg05770947) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:3.12E-05; Z-score:1.31E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24928433) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:5.92E-04; Z-score:6.91E-01 | ||
|
Methylation in Case |
9.56E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02419920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.58E-03; Z-score:9.31E-01 | ||
|
Methylation in Case |
5.29E-01 (Median) | Methylation in Control | 4.57E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg22615255) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.03E-03; Z-score:-1.84E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02713266) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.65E-03; Z-score:-4.24E-02 | ||
|
Methylation in Case |
9.32E-02 (Median) | Methylation in Control | 9.42E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09153713) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.18E-02; Z-score:-3.98E-01 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg01454004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.75E-02; Z-score:-4.39E-01 | ||
|
Methylation in Case |
6.85E-02 (Median) | Methylation in Control | 7.29E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:3.11E-02; Z-score:-6.17E-01 | ||
|
Methylation in Case |
4.66E-02 (Median) | Methylation in Control | 5.18E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg08783639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.14E-02; Z-score:-7.75E-01 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00095276) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.69E-02; Z-score:5.75E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg08743199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.89E-02; Z-score:6.52E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC45A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg16920502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.35E-02; Z-score:-4.53E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
5'UTR (cg10581876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:3.89E-03; Z-score:-7.24E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg24302235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:7.13E+00 | Statistic Test | p-value:3.06E-04; Z-score:2.35E+01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 9.59E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg17816637) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:2.05E-03; Z-score:3.62E+00 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg04766365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.90E-02; Z-score:2.00E+00 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS200 (cg17404000) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.67E+00 | Statistic Test | p-value:1.85E-04; Z-score:5.92E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 9.10E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS200 (cg18500192) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.94E+00 | Statistic Test | p-value:1.60E-03; Z-score:4.13E+00 | ||
|
Methylation in Case |
9.00E-02 (Median) | Methylation in Control | 4.64E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS200 (cg16513459) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:7.11E-03; Z-score:2.91E+00 | ||
|
Methylation in Case |
7.12E-01 (Median) | Methylation in Control | 4.67E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS200 (cg27634724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:1.92E-02; Z-score:6.44E+00 | ||
|
Methylation in Case |
6.20E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
TSS200 (cg25022560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:4.61E-02; Z-score:-8.92E-01 | ||
|
Methylation in Case |
1.59E-02 (Median) | Methylation in Control | 2.25E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
Body (cg02762475) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:6.92E-03; Z-score:2.49E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
Body (cg17143291) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:7.64E-03; Z-score:-2.88E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
Body (cg18151422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.02E-02; Z-score:2.10E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
Body (cg06228648) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.86E-02; Z-score:1.99E+00 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
Body (cg13352894) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:3.81E-02; Z-score:1.99E+00 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
Body (cg15647725) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:4.02E-02; Z-score:7.49E+00 | ||
|
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 6.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in prostate cancer | [ 2 ] | |||
|
Location |
3'UTR (cg22669120) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.88E+00 | Statistic Test | p-value:9.42E-03; Z-score:-8.99E+00 | ||
|
Methylation in Case |
4.42E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.99E+00 | Statistic Test | p-value:6.01E-14; Z-score:-2.50E+01 | ||
|
Methylation in Case |
3.52E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg08955358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.23E+00 | Statistic Test | p-value:7.93E-14; Z-score:-2.66E+01 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 7.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg25367206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.47E+00 | Statistic Test | p-value:7.29E-07; Z-score:-1.77E+01 | ||
|
Methylation in Case |
6.16E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.57E+00 | Statistic Test | p-value:5.83E-05; Z-score:-4.56E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 4.48E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg07769015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.47E+00 | Statistic Test | p-value:7.34E-05; Z-score:-4.44E+00 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 4.22E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.69E+00 | Statistic Test | p-value:2.13E-03; Z-score:-2.68E+00 | ||
|
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 4.26E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg21207636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:7.52E-05; Z-score:4.33E+00 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:9.81E-05; Z-score:-6.92E+00 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg20703664) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.29E-04; Z-score:-5.33E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg06588735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:5.01E-04; Z-score:-2.83E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg20555854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:2.94E-03; Z-score:-3.02E+00 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.15E-03; Z-score:-1.53E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg19923238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.78E-03; Z-score:2.04E+00 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg22335882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:6.84E-03; Z-score:2.34E+00 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:7.77E-03; Z-score:-2.22E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:9.15E-03; Z-score:-1.60E+00 | ||
|
Methylation in Case |
8.37E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg07217030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.25E-02; Z-score:1.57E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.40E-02; Z-score:-1.56E+00 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg26952928) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.64E-02; Z-score:1.80E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg24855956) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.23E-02; Z-score:-2.10E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg07437919) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.30E-02; Z-score:-9.36E-01 | ||
|
Methylation in Case |
3.18E-01 (Median) | Methylation in Control | 3.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg19345940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.80E-02; Z-score:-1.50E+00 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg00966749) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.88E-02; Z-score:-7.40E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:3.53E-02; Z-score:2.48E+00 | ||
|
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg23638455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:4.69E-02; Z-score:1.73E+00 | ||
|
Methylation in Case |
7.08E-01 (Median) | Methylation in Control | 4.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in bladder cancer | [ 3 ] | |||
|
Location |
3'UTR (cg10113820) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.26E-02; Z-score:-9.19E-01 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
34 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg08955358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:2.08E-14; Z-score:-5.11E+00 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.01E-08; Z-score:-2.12E+00 | ||
|
Methylation in Case |
6.45E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg25367206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:1.28E-07; Z-score:-2.06E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:2.17E-07; Z-score:-1.36E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 6.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg07769015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:2.03E-04; Z-score:-1.23E+00 | ||
|
Methylation in Case |
4.86E-01 (Median) | Methylation in Control | 5.61E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.71E-04; Z-score:-7.62E-01 | ||
|
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg22335882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:2.68E-28; Z-score:3.42E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg07217030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:3.57E-20; Z-score:4.60E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 6.23E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg21207636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:2.24E-16; Z-score:3.47E+00 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 5.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg03653399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.54E+00 | Statistic Test | p-value:3.10E-16; Z-score:2.85E+00 | ||
|
Methylation in Case |
7.22E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg02231909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:5.78E-16; Z-score:1.98E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 6.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:2.01E-11; Z-score:2.57E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 4.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg19923238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:3.28E-11; Z-score:1.61E+00 | ||
|
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg11945507) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.39E+00 | Statistic Test | p-value:6.53E-10; Z-score:2.19E+00 | ||
|
Methylation in Case |
5.54E-01 (Median) | Methylation in Control | 3.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg20555854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:7.53E-10; Z-score:-1.83E+00 | ||
|
Methylation in Case |
7.22E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg04685302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:6.52E-09; Z-score:1.39E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg26952928) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.85E-08; Z-score:-1.43E+00 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg22261640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.37E-07; Z-score:-1.15E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.88E-05; Z-score:-1.00E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg03569283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.52E-05; Z-score:5.57E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.08E-05; Z-score:-9.21E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg23707719) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:8.88E-05; Z-score:1.84E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg07437919) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:9.50E-05; Z-score:8.58E-01 | ||
|
Methylation in Case |
4.96E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg01866330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.55E-04; Z-score:1.43E+00 | ||
|
Methylation in Case |
7.91E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg23301539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:5.24E-04; Z-score:3.58E-01 | ||
|
Methylation in Case |
9.61E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:6.73E-04; Z-score:4.18E-01 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg13560841) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.75E-03; Z-score:-8.85E-01 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:8.18E-03; Z-score:1.35E+00 | ||
|
Methylation in Case |
7.83E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg08266905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.50E-02; Z-score:-8.03E-01 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg20703664) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.43E-02; Z-score:-8.35E-01 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg16995299) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.63E-02; Z-score:2.68E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:2.90E-02; Z-score:4.28E-01 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.42E-02; Z-score:-9.07E-01 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC45A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg22284058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.75E-02; Z-score:2.13E-01 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 6.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.13E-03; Z-score:-2.59E+00 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg08955358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.57E-02; Z-score:-2.82E-02 | ||
|
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.61E-03; Z-score:-1.38E+00 | ||
|
Methylation in Case |
5.86E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:1.08E-02; Z-score:-1.61E+00 | ||
|
Methylation in Case |
5.28E-01 (Median) | Methylation in Control | 6.03E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg07769015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.21E-02; Z-score:-9.85E-01 | ||
|
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 6.46E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg22261640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.23E-11; Z-score:-2.28E+00 | ||
|
Methylation in Case |
9.30E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg11945507) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.87E+00 | Statistic Test | p-value:2.91E-07; Z-score:1.88E+00 | ||
|
Methylation in Case |
3.68E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg00966749) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.58E-07; Z-score:-1.47E+00 | ||
|
Methylation in Case |
9.53E-01 (Median) | Methylation in Control | 9.66E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg03653399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.70E+00 | Statistic Test | p-value:2.62E-06; Z-score:1.34E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 2.41E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.35E-06; Z-score:-1.51E+00 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:1.25E-05; Z-score:8.74E-01 | ||
|
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 3.77E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg08266905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.81E-05; Z-score:-1.44E+00 | ||
|
Methylation in Case |
9.66E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.81E-05; Z-score:-8.23E-01 | ||
|
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 9.47E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg26952928) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.84E-04; Z-score:-1.06E+00 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg23750338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.34E-04; Z-score:-1.17E+00 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg06588735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.72E-04; Z-score:-9.47E-01 | ||
|
Methylation in Case |
9.49E-01 (Median) | Methylation in Control | 9.61E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg22284058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.88E-03; Z-score:1.67E+00 | ||
|
Methylation in Case |
6.76E-01 (Median) | Methylation in Control | 5.75E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg15331837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.96E-03; Z-score:-3.90E-01 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.61E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg27000496) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:2.05E-03; Z-score:1.85E+00 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.29E-03; Z-score:-2.04E-01 | ||
|
Methylation in Case |
9.64E-01 (Median) | Methylation in Control | 9.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:6.62E-03; Z-score:1.73E+00 | ||
|
Methylation in Case |
7.22E-01 (Median) | Methylation in Control | 6.22E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg01866330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:8.59E-03; Z-score:-2.84E+00 | ||
|
Methylation in Case |
9.63E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg22335882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:9.12E-03; Z-score:1.88E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg04685302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.04E-02; Z-score:-5.38E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg07217030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.07E-02; Z-score:6.31E-01 | ||
|
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.43E-02; Z-score:-2.10E+00 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg24701309) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.13E-02; Z-score:5.00E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg23707719) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.76E-02; Z-score:-1.04E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC45A4 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg13560841) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.94E-02; Z-score:-4.81E-01 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.68E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg03308494) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:1.81E-05; Z-score:-1.51E+00 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 4.15E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg20259557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:5.37E-04; Z-score:-2.07E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg19828146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.29E-03; Z-score:-1.47E+00 | ||
|
Methylation in Case |
6.74E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg09168997) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:1.37E-03; Z-score:-2.66E+00 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg01823544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.78E+00 | Statistic Test | p-value:1.65E-03; Z-score:2.95E+00 | ||
|
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 1.38E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg20336809) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.13E-03; Z-score:-1.95E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg12180703) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.71E-08; Z-score:1.77E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 4.74E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg18771173) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.15E+00 | Statistic Test | p-value:2.59E-06; Z-score:2.99E+00 | ||
|
Methylation in Case |
6.70E-01 (Median) | Methylation in Control | 3.12E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg09448875) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:4.52E-03; Z-score:-1.15E+00 | ||
|
Methylation in Case |
5.36E-01 (Median) | Methylation in Control | 6.25E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg13688474) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:7.11E-07; Z-score:-1.35E+00 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg03851835) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:1.27E-06; Z-score:-2.76E+00 | ||
|
Methylation in Case |
2.72E-01 (Median) | Methylation in Control | 4.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg13558509) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:3.95E-06; Z-score:-2.86E+00 | ||
|
Methylation in Case |
6.19E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg04836214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:8.64E-06; Z-score:-3.42E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg11827453) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.38E+00 | Statistic Test | p-value:1.11E-05; Z-score:1.36E+00 | ||
|
Methylation in Case |
4.57E-01 (Median) | Methylation in Control | 3.32E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg25370753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:6.26E-05; Z-score:-4.25E+00 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg15030789) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.11E-04; Z-score:-1.79E+00 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg03722901) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.90E-04; Z-score:-1.49E+00 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 6.03E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg26107890) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:3.30E-04; Z-score:1.00E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:3.40E-04; Z-score:-2.41E+00 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg14528916) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.03E-03; Z-score:-1.76E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg02646297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.61E-03; Z-score:-5.51E+00 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg20122849) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.63E-03; Z-score:-8.36E-01 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg12146829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.43E+00 | Statistic Test | p-value:1.89E-03; Z-score:-7.81E-01 | ||
|
Methylation in Case |
1.95E-01 (Median) | Methylation in Control | 2.78E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg06885175) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:5.31E-05; Z-score:-1.55E+00 | ||
|
Methylation in Case |
1.89E-01 (Median) | Methylation in Control | 2.69E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg15554087) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:8.77E-05; Z-score:-1.64E+00 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg14592673) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.63E-04; Z-score:-1.52E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 4.83E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
34 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:8.79E-09; Z-score:-2.95E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg08955358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:8.83E-07; Z-score:-1.64E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg25367206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.86E-06; Z-score:-1.78E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg18254417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.77E-02; Z-score:2.73E-01 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:1.52E-03; Z-score:-1.04E+00 | ||
|
Methylation in Case |
4.34E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg07769015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:8.03E-03; Z-score:-7.89E-01 | ||
|
Methylation in Case |
4.57E-01 (Median) | Methylation in Control | 5.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:9.50E-03; Z-score:-1.02E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg20080616) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.53E-08; Z-score:-2.89E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg16995299) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.18E-08; Z-score:1.59E+00 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.42E-06; Z-score:-1.72E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.59E-06; Z-score:-1.62E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg22261640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.03E-05; Z-score:-1.07E+00 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg10555010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.46E-05; Z-score:1.33E+00 | ||
|
Methylation in Case |
9.83E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.56E-05; Z-score:-1.27E+00 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg04685302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.62E-05; Z-score:-7.48E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.29E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03653399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.73E-05; Z-score:-9.76E-01 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg23750338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.63E-05; Z-score:-1.40E+00 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg23707719) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.97E-05; Z-score:-1.10E+00 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg15331837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.29E-04; Z-score:-1.01E+00 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.70E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg13474450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.92E-04; Z-score:-7.76E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg16341495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.38E-04; Z-score:8.37E-01 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg02231909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.68E-04; Z-score:-1.06E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.80E-04; Z-score:-5.59E-01 | ||
|
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg01866330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.42E-04; Z-score:-1.18E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg08266905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.23E-03; Z-score:-8.30E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg20703664) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.71E-03; Z-score:-4.29E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg26952928) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.92E-03; Z-score:-5.53E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg07437919) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.44E-02; Z-score:5.31E-01 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 6.54E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg13560841) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.58E-02; Z-score:-5.16E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg06588735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.08E-02; Z-score:-1.10E+00 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.28E-02; Z-score:-2.12E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg07695089) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.95E-07; Z-score:-1.40E+00 | ||
|
Methylation in Case |
9.49E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg05851505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.62E-04; Z-score:1.05E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC45A4 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg08203794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:7.40E-04; Z-score:-2.87E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
39 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg05193162) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.70E+00 | Statistic Test | p-value:2.39E-19; Z-score:-3.84E+00 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg11391828) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:1.24E-13; Z-score:-4.12E+00 | ||
|
Methylation in Case |
4.61E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg08955358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.11E-07; Z-score:-1.92E+00 | ||
|
Methylation in Case |
5.35E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg18254417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.15E-05; Z-score:-5.15E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg19788741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.01E+00 | Statistic Test | p-value:1.16E-09; Z-score:3.75E+00 | ||
|
Methylation in Case |
1.31E-01 (Median) | Methylation in Control | 4.33E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg13557594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:6.24E-24; Z-score:-5.25E+00 | ||
|
Methylation in Case |
4.30E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg16898334) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.92E+00 | Statistic Test | p-value:2.99E-22; Z-score:-1.30E+01 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:5.98E-22; Z-score:-2.81E+00 | ||
|
Methylation in Case |
4.40E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg25375916) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.85E+00 | Statistic Test | p-value:5.29E-19; Z-score:-2.92E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 3.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg12384004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:1.91E-14; Z-score:-2.67E+00 | ||
|
Methylation in Case |
3.41E-01 (Median) | Methylation in Control | 5.25E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg24798414) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:3.03E-12; Z-score:-6.30E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg04350355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:2.24E-11; Z-score:-3.02E+00 | ||
|
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg10526817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:7.49E-11; Z-score:-8.95E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg26858144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:1.97E-10; Z-score:-1.57E+00 | ||
|
Methylation in Case |
1.87E-01 (Median) | Methylation in Control | 2.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg13594863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.34E-09; Z-score:-2.53E+00 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.53E-09; Z-score:-3.47E+00 | ||
|
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:4.10E-09; Z-score:-3.26E+00 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:4.48E-09; Z-score:-3.07E+00 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg15992532) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.40E-08; Z-score:-4.41E+00 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg02607124) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:6.64E-08; Z-score:-1.23E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 8.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg26441120) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:7.33E-08; Z-score:-1.70E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg13560841) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:6.16E-07; Z-score:-1.99E+00 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg23301539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.66E-07; Z-score:-9.77E-01 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.01E-06; Z-score:-1.07E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg03653399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.42E-06; Z-score:-1.28E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg16995299) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.99E-06; Z-score:-8.09E-01 | ||
|
Methylation in Case |
6.97E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.81E-06; Z-score:-1.45E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg19345940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:9.84E-06; Z-score:-7.55E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg16341495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.51E-05; Z-score:-6.29E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.25E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg27000496) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.46E-05; Z-score:-4.98E-01 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg20555854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.46E-05; Z-score:-9.02E-01 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg03569283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.03E-05; Z-score:-2.34E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg13474450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.95E-04; Z-score:-4.23E-01 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg15331837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:6.35E-04; Z-score:-3.10E-01 | ||
|
Methylation in Case |
9.60E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg23638455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:2.44E-02; Z-score:5.15E-01 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg03825810) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.70E+00 | Statistic Test | p-value:7.89E-24; Z-score:-3.76E+00 | ||
|
Methylation in Case |
3.76E-01 (Median) | Methylation in Control | 6.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg08203794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.48E-08; Z-score:-2.71E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg10113820) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.89E-07; Z-score:-2.40E+00 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC45A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg05851505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.68E-07; Z-score:-2.15E+00 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.62E-05; Z-score:7.84E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:2.67E-14; Z-score:4.07E+00 | ||
|
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 5.23E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg07769015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:4.66E-14; Z-score:3.58E+00 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 5.39E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.49E+00 | Statistic Test | p-value:3.68E-12; Z-score:3.51E+00 | ||
|
Methylation in Case |
7.49E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg20080616) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:2.41E-15; Z-score:2.72E+00 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg13474450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.59E+00 | Statistic Test | p-value:5.66E-14; Z-score:4.79E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 5.29E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg23750338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:4.19E-13; Z-score:1.90E+00 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg24855956) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.03E-10; Z-score:1.58E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:1.41E-09; Z-score:2.54E+00 | ||
|
Methylation in Case |
7.30E-01 (Median) | Methylation in Control | 5.56E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg22284058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:8.52E-09; Z-score:2.97E+00 | ||
|
Methylation in Case |
6.53E-01 (Median) | Methylation in Control | 5.15E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg23707719) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.19E-08; Z-score:1.60E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg04685302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.11E-07; Z-score:9.85E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:4.70E-07; Z-score:1.06E+00 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg03569283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.87E-07; Z-score:8.95E-01 | ||
|
Methylation in Case |
9.72E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg20555854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:8.09E-07; Z-score:7.76E-01 | ||
|
Methylation in Case |
9.12E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg26952928) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.03E-05; Z-score:1.30E+00 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.06E-04; Z-score:-9.09E-01 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.39E-03; Z-score:1.14E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg00966749) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.83E-03; Z-score:-7.83E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.05E-03; Z-score:-6.29E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg19923238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.93E-03; Z-score:-6.71E-01 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg23638455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:8.20E-03; Z-score:4.29E-01 | ||
|
Methylation in Case |
6.22E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg01866330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.25E-02; Z-score:8.13E-01 | ||
|
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg02231909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.12E-02; Z-score:-6.07E-01 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg15331837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.51E-02; Z-score:8.07E-01 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.52E-02; Z-score:5.51E-01 | ||
|
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg06588735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.71E-02; Z-score:-6.58E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.18E-02; Z-score:7.63E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC45A4 in HIV infection | [ 9 ] | |||
|
Location |
3'UTR (cg08203794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.13E-02; Z-score:6.16E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg25367206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:2.50E-02; Z-score:1.55E+00 | ||
|
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.07E-02; Z-score:1.25E+00 | ||
|
Methylation in Case |
8.64E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.48E+00 | Statistic Test | p-value:4.26E-04; Z-score:3.53E+00 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg07769015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:1.77E-03; Z-score:3.12E+00 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:2.83E-03; Z-score:2.25E+00 | ||
|
Methylation in Case |
6.15E-01 (Median) | Methylation in Control | 4.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.01E-05; Z-score:3.91E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 6.63E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg23638455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:4.47E-05; Z-score:3.01E+00 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 4.63E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg22284058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.54E-04; Z-score:1.79E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.68E-04; Z-score:2.55E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg22335882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.03E-03; Z-score:1.82E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.31E-03; Z-score:1.60E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 7.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg03653399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.34E-03; Z-score:2.01E+00 | ||
|
Methylation in Case |
9.08E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg19345940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.69E-03; Z-score:2.26E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg11945507) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:3.05E-03; Z-score:1.89E+00 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg24701309) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.26E-02; Z-score:1.40E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg08266905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.63E-02; Z-score:-1.37E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.62E-02; Z-score:-6.25E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg06588735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.85E-02; Z-score:-1.06E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg00966749) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.91E-02; Z-score:-9.15E-01 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
3'UTR (cg05851505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.97E-02; Z-score:1.16E+00 | ||
|
Methylation in Case |
9.72E-01 (Median) | Methylation in Control | 9.65E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in panic disorder | [ 11 ] | |||
|
Location |
TSS1500 (cg08955358) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.88E-02; Z-score:3.79E-01 | ||
|
Methylation in Case |
2.76E+00 (Median) | Methylation in Control | 2.62E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in panic disorder | [ 11 ] | |||
|
Location |
TSS1500 (cg25367206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.02E-02; Z-score:9.56E-02 | ||
|
Methylation in Case |
3.22E+00 (Median) | Methylation in Control | 3.19E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg23750338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:5.95E-03; Z-score:-4.38E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 9.90E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-5.35E-01 | Statistic Test | p-value:2.48E-02; Z-score:-3.59E-01 | ||
|
Methylation in Case |
-4.81E-01 (Median) | Methylation in Control | -2.58E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg08266905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.35E-02; Z-score:4.59E-01 | ||
|
Methylation in Case |
3.35E+00 (Median) | Methylation in Control | 3.14E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.91E-12; Z-score:1.18E+00 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS200 (cg15586392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.38E-05; Z-score:-1.16E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS200 (cg01081737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:6.48E-03; Z-score:-2.78E-01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg27000496) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:2.02E-14; Z-score:1.72E+00 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.33E-10; Z-score:1.84E+00 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg22335882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.94E-09; Z-score:1.33E+00 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.25E-06; Z-score:1.10E+00 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg07217030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:2.52E-06; Z-score:1.12E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:2.78E-06; Z-score:1.31E+00 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg22261640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.34E-04; Z-score:-1.04E+00 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.58E-04; Z-score:-8.53E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg04685302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.36E-03; Z-score:-8.89E-01 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg22284058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.61E-03; Z-score:6.13E-01 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.78E-02; Z-score:-2.43E-01 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg20555854) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.55E-02; Z-score:5.04E-01 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg19345940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.61E-02; Z-score:-5.64E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg23301539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.43E-02; Z-score:-5.20E-01 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00767977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.36E-05; Z-score:-1.00E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00966749) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.99E+00 | Statistic Test | p-value:4.43E-05; Z-score:-1.50E+00 | ||
|
Methylation in Case |
2.97E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg01866330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:9.22E-05; Z-score:1.28E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02231909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.22E-04; Z-score:-8.84E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02607124) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.80E+00 | Statistic Test | p-value:1.80E-04; Z-score:-1.00E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 3.57E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.48E-04; Z-score:-6.02E-01 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg03569283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.74E-04; Z-score:-1.12E+00 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg03653399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.05E-04; Z-score:6.52E-01 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg04685302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:9.35E-04; Z-score:-6.22E-01 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 2.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:9.57E-04; Z-score:6.06E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg05073386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.67E+00 | Statistic Test | p-value:1.23E-03; Z-score:8.41E-01 | ||
|
Methylation in Case |
1.70E-01 (Median) | Methylation in Control | 4.63E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg06588735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.61E-03; Z-score:5.31E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg07115035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:3.40E-03; Z-score:-6.05E-01 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg07217030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.52E+00 | Statistic Test | p-value:3.61E-03; Z-score:-2.25E-01 | ||
|
Methylation in Case |
2.23E-02 (Median) | Methylation in Control | 5.62E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg07437919) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.91E-03; Z-score:4.61E-01 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg08266905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:5.64E-03; Z-score:7.82E-01 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 6.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg08829393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:8.01E-03; Z-score:5.70E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:8.35E-03; Z-score:-4.31E-01 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg10555010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.53E-02; Z-score:3.46E-02 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 1.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11945507) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.60E-02; Z-score:-4.85E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg13474450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.62E-02; Z-score:5.49E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg13560841) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:3.70E-02; Z-score:-4.87E-02 | ||
|
Methylation in Case |
1.55E-02 (Median) | Methylation in Control | 1.76E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg05851505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:4.81E-14; Z-score:-2.82E+00 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg07695089) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.35E-13; Z-score:-2.93E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg08203794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:4.57E-13; Z-score:-2.55E+00 | ||
|
Methylation in Case |
6.45E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC45A4 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg10113820) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.38E-12; Z-score:-1.87E+00 | ||
|
Methylation in Case |
7.00E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg19923238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.44E-03; Z-score:-1.23E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg01866330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.71E-03; Z-score:-3.65E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg15331837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.06E-02; Z-score:-2.92E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg24855956) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.62E-02; Z-score:-1.65E-01 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg03569283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.84E-02; Z-score:-1.07E-01 | ||
|
Methylation in Case |
9.63E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg02996583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.86E-02; Z-score:-3.31E-01 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC45A4 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
3'UTR (cg10113820) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.38E-02; Z-score:-1.45E-01 | ||
|
Methylation in Case |
9.56E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate/moderate hypomethylation of SLC45A4 in liver cancer than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.001555698; Fold-change:-0.249177044; Z-score:-0.83220465 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:2.65E-11; Fold-change:-0.216135999; Z-score:-1.888244287 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC45A4 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:5.04E-63; Fold-change:-0.276297356; Z-score:-2.462814076 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Central neurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC45A4 in central neurocytoma than that in healthy individual | ||||
Studied Phenotype |
Central neurocytoma [ICD-11:2A00.3] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.58E-06; Fold-change:-0.373775851; Z-score:-2.666316591 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC45A4 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:9.22E-13; Fold-change:-0.682715797; Z-score:-4.428084977 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Third ventricle chordoid glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC45A4 in third ventricle chordoid glioma than that in healthy individual | ||||
Studied Phenotype |
Third ventricle chordoid glioma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.37E-05; Fold-change:-0.4035165; Z-score:-2.458759474 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC45A4 in lung cancer than that in adjacent tissue | ||||
Studied Phenotype |
Lung cancer [ICD-11:2C25] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:3.57E-06; Fold-change:-0.258628474; Z-score:-3.041740174 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1264 directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1264 | miRNA Mature ID | miR-1264 | ||
|
miRNA Sequence |
CAAGUCUUAUUUGAGCACCUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1277 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
|
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-1301 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1301 | miRNA Mature ID | miR-1301-5p | ||
|
miRNA Sequence |
CGCUCUAGGCACCGCAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-1304 directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-5p | ||
|
miRNA Sequence |
UUUGAGGCUACAGUGAGAUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-1827 directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1827 | miRNA Mature ID | miR-1827 | ||
|
miRNA Sequence |
UGAGGCAGUAGAUUGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-190a directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-190a | miRNA Mature ID | miR-190a-3p | ||
|
miRNA Sequence |
CUAUAUAUCAAACAUAUUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon7 |
miR-203a directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-203a | miRNA Mature ID | miR-203a-3p | ||
|
miRNA Sequence |
GUGAAAUGUUUAGGACCACUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-2116 directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2116 | miRNA Mature ID | miR-2116-5p | ||
|
miRNA Sequence |
GGUUCUUAGCAUAGGAGGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-22 directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-22 | miRNA Mature ID | miR-22-5p | ||
|
miRNA Sequence |
AGUUCUUCAGUGGCAAGCUUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-3616 directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3616 | miRNA Mature ID | miR-3616-5p | ||
|
miRNA Sequence |
AUGAAGUGCACUCAUGAUAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-4635 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4635 | miRNA Mature ID | miR-4635 | ||
|
miRNA Sequence |
UCUUGAAGUCAGAACCCGCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-4677 directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4677 | miRNA Mature ID | miR-4677-5p | ||
|
miRNA Sequence |
UUGUUCUUUGGUCUUUCAGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-5011 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-5p | ||
|
miRNA Sequence |
UAUAUAUACAGCCAUGCACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon14 |
miR-526b directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-5p | ||
|
miRNA Sequence |
CUCUUGAGGGAAGCACUUUCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-545 directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-545 | miRNA Mature ID | miR-545-3p | ||
|
miRNA Sequence |
UCAGCAAACAUUUAUUGUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-548f directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548f | miRNA Mature ID | miR-548f-5p | ||
|
miRNA Sequence |
UGCAAAAGUAAUCACAGUUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-548g directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548g | miRNA Mature ID | miR-548g-5p | ||
|
miRNA Sequence |
UGCAAAAGUAAUUGCAGUUUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-548l directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548l | miRNA Mature ID | miR-548l | ||
|
miRNA Sequence |
AAAAGUAUUUGCGGGUUUUGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-548n directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548n | miRNA Mature ID | miR-548n | ||
|
miRNA Sequence |
CAAAAGUAAUUGUGGAUUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-548p directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548p | miRNA Mature ID | miR-548p | ||
|
miRNA Sequence |
UAGCAAAAACUGCAGUUACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-548x directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548x | miRNA Mature ID | miR-548x-5p | ||
|
miRNA Sequence |
UGCAAAAGUAAUUGCAGUUUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-5691 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5691 | miRNA Mature ID | miR-5691 | ||
|
miRNA Sequence |
UUGCUCUGAGCUCCGAGAAAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon23 |
miR-573 directly targets SLC45A4 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-573 | miRNA Mature ID | miR-573 | ||
|
miRNA Sequence |
CUGAAGUGAUGUGUAACUGAUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon24 |
miR-6502 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6502 | miRNA Mature ID | miR-6502-5p | ||
|
miRNA Sequence |
AGCUCUAGAAAGAUUGUUGACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon25 |
miR-6765 directly targets SLC45A4 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6765 | miRNA Mature ID | miR-6765-5p | ||
|
miRNA Sequence |
GUGAGGCGGGGCCAGGAGGGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-6805 directly targets SLC45A4 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6805 | miRNA Mature ID | miR-6805-3p | ||
|
miRNA Sequence |
UUGCUCUGCUCCCCCGCCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.