Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0361 Transporter Info | ||||
| Gene Name | SLC43A2 | ||||
| Transporter Name | L-type amino acid transporter 4 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
33 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg00761755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:6.36E-09; Z-score:1.66E+00 | ||
|
Methylation in Case |
6.03E-01 (Median) | Methylation in Control | 4.99E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg03317151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.46E+00 | Statistic Test | p-value:1.60E-08; Z-score:1.71E+00 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 4.40E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg12025027) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:3.43E-07; Z-score:1.19E+00 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg13251490) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.55E-07; Z-score:-1.09E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg18405360) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:2.54E-06; Z-score:1.15E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg00691874) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:3.23E-05; Z-score:-8.04E-01 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg01438467) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:6.87E-05; Z-score:-4.77E-01 | ||
|
Methylation in Case |
6.55E-01 (Median) | Methylation in Control | 6.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg02188939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.22E-04; Z-score:-1.33E+00 | ||
|
Methylation in Case |
6.23E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg02238950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.31E+00 | Statistic Test | p-value:1.27E-04; Z-score:-7.92E-01 | ||
|
Methylation in Case |
6.48E-02 (Median) | Methylation in Control | 2.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.62E-04; Z-score:-8.80E-01 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg03720572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:4.12E-04; Z-score:8.82E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:6.04E-04; Z-score:9.62E-01 | ||
|
Methylation in Case |
6.25E-01 (Median) | Methylation in Control | 4.87E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:6.13E-04; Z-score:-5.35E-01 | ||
|
Methylation in Case |
4.15E-01 (Median) | Methylation in Control | 5.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:7.18E-04; Z-score:1.34E+00 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 7.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg05291429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:1.35E-03; Z-score:1.06E+00 | ||
|
Methylation in Case |
8.14E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg07943111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:5.05E-03; Z-score:-8.12E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08186671) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:5.56E-03; Z-score:4.73E-01 | ||
|
Methylation in Case |
9.49E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg08488915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.80E+00 | Statistic Test | p-value:6.86E-03; Z-score:-1.19E+00 | ||
|
Methylation in Case |
8.39E-02 (Median) | Methylation in Control | 1.51E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:9.44E-03; Z-score:-5.96E-01 | ||
|
Methylation in Case |
3.70E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:9.93E-03; Z-score:5.55E-02 | ||
|
Methylation in Case |
4.59E-02 (Median) | Methylation in Control | 4.51E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg09361598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.03E-02; Z-score:4.52E-01 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg10754697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.76E-02; Z-score:-3.26E-01 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.00E-02; Z-score:-1.70E-01 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg12564034) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.81E-02; Z-score:3.57E-01 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg14131824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.26E-02; Z-score:3.12E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
Body (cg14401583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.62E-02; Z-score:-6.62E-01 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.24E-15; Z-score:-2.65E+00 | ||
|
Methylation in Case |
6.19E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:6.03E-14; Z-score:-2.26E+00 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg06126721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.46E+00 | Statistic Test | p-value:7.44E-14; Z-score:-2.27E+00 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:1.68E-12; Z-score:-2.02E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg17442852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.13E-10; Z-score:-1.79E+00 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:9.69E-10; Z-score:-1.59E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC43A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:1.18E-09; Z-score:1.78E+00 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 6.51E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg00761755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:2.74E-03; Z-score:-2.93E+00 | ||
|
Methylation in Case |
6.43E-02 (Median) | Methylation in Control | 7.56E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg24314549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.39E+00 | Statistic Test | p-value:4.44E-09; Z-score:-7.42E+00 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 1.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg02703843) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:1.39E-02; Z-score:-2.13E+00 | ||
|
Methylation in Case |
5.47E-02 (Median) | Methylation in Control | 7.00E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg21881273) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.17E-02; Z-score:-1.24E+00 | ||
|
Methylation in Case |
3.80E-02 (Median) | Methylation in Control | 4.37E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg12683602) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.91E+00 | Statistic Test | p-value:6.55E-04; Z-score:-4.02E+00 | ||
|
Methylation in Case |
2.43E-02 (Median) | Methylation in Control | 4.65E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg17172593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.64E+00 | Statistic Test | p-value:1.09E-09; Z-score:-7.43E+00 | ||
|
Methylation in Case |
3.32E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg17812026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:1.36E-08; Z-score:-2.56E+01 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08488915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.89E+00 | Statistic Test | p-value:3.07E-07; Z-score:-6.11E+00 | ||
|
Methylation in Case |
4.41E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg05291429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.56E+00 | Statistic Test | p-value:3.59E-07; Z-score:-8.57E+00 | ||
|
Methylation in Case |
5.26E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg23691006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.43E+00 | Statistic Test | p-value:2.78E-06; Z-score:5.59E+00 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 4.96E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:1.92E-04; Z-score:-3.37E+00 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 3.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg18964590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.70E+00 | Statistic Test | p-value:3.35E-04; Z-score:-6.05E+00 | ||
|
Methylation in Case |
3.61E-01 (Median) | Methylation in Control | 6.13E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg19272348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.71E+00 | Statistic Test | p-value:6.28E-04; Z-score:-5.35E+00 | ||
|
Methylation in Case |
3.84E-01 (Median) | Methylation in Control | 6.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.25E+00 | Statistic Test | p-value:8.07E-04; Z-score:3.77E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 1.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:1.09E-03; Z-score:3.17E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 4.46E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08186671) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:2.72E-03; Z-score:-2.63E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg12564034) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.27E-03; Z-score:4.14E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:6.15E-03; Z-score:2.53E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:7.13E-03; Z-score:2.57E+00 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 5.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg14401583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.54E-03; Z-score:-1.30E+00 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg21949830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:9.75E-03; Z-score:5.58E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg03720572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.70E-02; Z-score:3.15E+00 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.35E-02; Z-score:1.28E+00 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg00691874) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.98E+00 | Statistic Test | p-value:3.68E-02; Z-score:-3.07E+00 | ||
|
Methylation in Case |
2.16E-01 (Median) | Methylation in Control | 4.28E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg07943111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.64E-02; Z-score:1.62E+00 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:8.05E-06; Z-score:1.63E+01 | ||
|
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 4.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:1.45E-04; Z-score:5.48E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:1.50E-03; Z-score:8.47E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:2.81E-03; Z-score:3.11E+00 | ||
|
Methylation in Case |
2.86E-01 (Median) | Methylation in Control | 2.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC43A2 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:2.43E-02; Z-score:2.96E+00 | ||
|
Methylation in Case |
1.57E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg12025027) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.17E-03; Z-score:3.33E-01 | ||
|
Methylation in Case |
1.29E-02 (Median) | Methylation in Control | 1.25E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg24314549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.57E+00 | Statistic Test | p-value:3.76E-04; Z-score:-1.93E+00 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 1.95E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.67E+00 | Statistic Test | p-value:6.68E-10; Z-score:-5.69E+00 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 4.16E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:2.98E-07; Z-score:4.63E+00 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:6.40E-06; Z-score:2.97E+00 | ||
|
Methylation in Case |
6.31E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:5.49E-05; Z-score:2.95E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 3.83E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg17172593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.15E-04; Z-score:-2.33E+00 | ||
|
Methylation in Case |
4.18E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg14131824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:7.92E-04; Z-score:-1.59E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg25212453) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.03E-03; Z-score:1.30E+00 | ||
|
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.10E-03; Z-score:-9.41E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg21949830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:5.57E-03; Z-score:1.04E+00 | ||
|
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 4.29E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg08488915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.17E-02; Z-score:-6.26E-01 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg06126721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.78E+00 | Statistic Test | p-value:4.65E-05; Z-score:1.63E+00 | ||
|
Methylation in Case |
1.18E-01 (Median) | Methylation in Control | 6.63E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.84E+00 | Statistic Test | p-value:5.28E-04; Z-score:-2.28E+00 | ||
|
Methylation in Case |
1.12E-01 (Median) | Methylation in Control | 2.05E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:2.30E-03; Z-score:-1.56E+00 | ||
|
Methylation in Case |
3.20E-01 (Median) | Methylation in Control | 3.77E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg09960171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.79E+00 | Statistic Test | p-value:5.09E-06; Z-score:3.20E+00 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 2.48E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg24507762) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:7.80E-07; Z-score:3.28E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 3.28E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg11388325) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.78E+00 | Statistic Test | p-value:3.38E-05; Z-score:4.29E+00 | ||
|
Methylation in Case |
2.42E-01 (Median) | Methylation in Control | 6.39E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg00727912) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:1.20E-04; Z-score:-1.40E+00 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg24125468) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:3.59E-04; Z-score:-2.31E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg14684675) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:3.75E-04; Z-score:1.66E+00 | ||
|
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg20662930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.01E+00 | Statistic Test | p-value:3.98E-04; Z-score:5.22E+00 | ||
|
Methylation in Case |
2.94E-01 (Median) | Methylation in Control | 1.46E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg21197919) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.15E-04; Z-score:-1.80E+00 | ||
|
Methylation in Case |
6.26E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
1stExon (cg14848594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.01E+00 | Statistic Test | p-value:4.90E-08; Z-score:5.48E+00 | ||
|
Methylation in Case |
4.50E-01 (Median) | Methylation in Control | 2.24E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:2.05E-05; Z-score:-2.35E+00 | ||
|
Methylation in Case |
2.73E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg26169668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:8.91E-05; Z-score:-3.00E+00 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg14688905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.60E-04; Z-score:-3.75E+00 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg17258460) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:8.98E-04; Z-score:-2.42E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg14930674) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.80E-03; Z-score:-2.19E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
3'UTR (cg18046311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:2.29E-05; Z-score:-3.92E+00 | ||
|
Methylation in Case |
6.16E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg18405360) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:3.19E-04; Z-score:1.04E+00 | ||
|
Methylation in Case |
3.76E-02 (Median) | Methylation in Control | 3.03E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg26591144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.07E-02; Z-score:6.60E-01 | ||
|
Methylation in Case |
1.92E-02 (Median) | Methylation in Control | 1.62E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg12683602) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.57E-02; Z-score:-6.13E-01 | ||
|
Methylation in Case |
2.76E-02 (Median) | Methylation in Control | 3.08E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:5.13E-13; Z-score:-2.81E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.42E-08; Z-score:-1.40E+00 | ||
|
Methylation in Case |
4.69E-01 (Median) | Methylation in Control | 5.45E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg07943111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.33E-06; Z-score:-1.52E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg08186671) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.74E-04; Z-score:-1.06E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg16061354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.41E-03; Z-score:-1.14E+00 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.41E-03; Z-score:-7.03E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg14131824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.53E-03; Z-score:-9.29E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg15090217) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.40E-02; Z-score:-2.13E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.52E-02; Z-score:-7.80E-01 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg10754697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.72E-02; Z-score:1.74E-01 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.32E-02; Z-score:-6.99E-01 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg14401583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.40E-02; Z-score:-5.93E-01 | ||
|
Methylation in Case |
9.53E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg21949830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.90E-02; Z-score:-3.61E-01 | ||
|
Methylation in Case |
6.87E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg17442852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:3.05E-07; Z-score:-1.86E+00 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:3.89E-05; Z-score:-1.44E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.14E-03; Z-score:-8.83E-01 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.39E-03; Z-score:-9.01E-01 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
31 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg12025027) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:2.11E-06; Z-score:1.54E-01 | ||
|
Methylation in Case |
2.87E-02 (Median) | Methylation in Control | 2.51E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg00761755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.45E-02; Z-score:-2.20E-01 | ||
|
Methylation in Case |
6.14E-02 (Median) | Methylation in Control | 6.70E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg02870829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.37E+00 | Statistic Test | p-value:1.33E-13; Z-score:-2.43E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg17901858) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.48E-09; Z-score:-3.21E+00 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.97E+00 | Statistic Test | p-value:8.28E-20; Z-score:-6.76E+00 | ||
|
Methylation in Case |
3.28E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg11224188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:2.82E-19; Z-score:-6.39E+00 | ||
|
Methylation in Case |
4.25E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg11411564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.86E+00 | Statistic Test | p-value:3.63E-19; Z-score:-6.52E+00 | ||
|
Methylation in Case |
4.09E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg20194982) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.64E+00 | Statistic Test | p-value:1.34E-18; Z-score:-1.28E+01 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg08225137) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.67E+00 | Statistic Test | p-value:5.68E-18; Z-score:-6.32E+00 | ||
|
Methylation in Case |
4.47E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.64E+00 | Statistic Test | p-value:1.34E-17; Z-score:-6.18E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg03700302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.67E+00 | Statistic Test | p-value:1.02E-16; Z-score:-4.86E+00 | ||
|
Methylation in Case |
3.54E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg13405678) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:1.75E-16; Z-score:-3.13E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 5.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16618218) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.72E+00 | Statistic Test | p-value:4.94E-16; Z-score:-3.75E+00 | ||
|
Methylation in Case |
3.84E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg23691006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:3.91E-09; Z-score:1.70E+00 | ||
|
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 4.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:4.67E-07; Z-score:-1.59E+00 | ||
|
Methylation in Case |
3.41E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg19272348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.64E-06; Z-score:1.31E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg00691874) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.50E-05; Z-score:7.28E-01 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 5.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.78E-04; Z-score:7.79E-01 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg01438467) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:4.18E-04; Z-score:-9.70E-01 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg08488915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.73E-04; Z-score:-3.85E-01 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg18964590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:8.01E-04; Z-score:7.88E-01 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16061354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.52E-03; Z-score:5.56E-01 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg09361598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.86E-03; Z-score:-7.99E-01 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg17172593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.94E-03; Z-score:1.18E+00 | ||
|
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 5.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.26E-02; Z-score:9.19E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:3.77E-02; Z-score:-6.45E-01 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 1.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg00928751) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.70E+00 | Statistic Test | p-value:3.01E-20; Z-score:-4.28E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg06126721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:1.75E-03; Z-score:-7.05E-01 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.30E-03; Z-score:-4.84E-01 | ||
|
Methylation in Case |
7.30E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:4.41E-03; Z-score:-7.15E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC43A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.06E-03; Z-score:-2.09E-01 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
37 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg18405360) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:4.41E-03; Z-score:4.36E-01 | ||
|
Methylation in Case |
3.54E-02 (Median) | Methylation in Control | 3.14E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg12025027) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.41E+00 | Statistic Test | p-value:2.56E-02; Z-score:9.66E-01 | ||
|
Methylation in Case |
1.24E-02 (Median) | Methylation in Control | 8.81E-03 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
5'UTR (cg00761755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:4.25E-02; Z-score:6.47E-01 | ||
|
Methylation in Case |
5.93E-02 (Median) | Methylation in Control | 5.30E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
TSS1500 (cg02703843) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.19E-04; Z-score:9.38E-01 | ||
|
Methylation in Case |
7.34E-02 (Median) | Methylation in Control | 6.16E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
TSS1500 (cg03734322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:8.68E-03; Z-score:9.80E-01 | ||
|
Methylation in Case |
9.19E-02 (Median) | Methylation in Control | 7.94E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg19272348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.01E-10; Z-score:3.12E+00 | ||
|
Methylation in Case |
7.26E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg00691874) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:2.76E-09; Z-score:2.64E+00 | ||
|
Methylation in Case |
6.22E-01 (Median) | Methylation in Control | 4.85E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg16061354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:9.05E-08; Z-score:2.05E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 4.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg07943111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:1.46E-07; Z-score:2.80E+00 | ||
|
Methylation in Case |
6.58E-01 (Median) | Methylation in Control | 5.34E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg14131824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.46E+00 | Statistic Test | p-value:1.87E-07; Z-score:2.53E+00 | ||
|
Methylation in Case |
5.40E-01 (Median) | Methylation in Control | 3.69E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.93E+00 | Statistic Test | p-value:3.17E-07; Z-score:3.97E+00 | ||
|
Methylation in Case |
3.20E-01 (Median) | Methylation in Control | 1.65E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg18964590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.25E-06; Z-score:2.12E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 6.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:4.58E-06; Z-score:2.88E+00 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 4.32E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg02188939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.11E-05; Z-score:-2.20E+00 | ||
|
Methylation in Case |
6.68E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg17172593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:2.73E-05; Z-score:1.66E+00 | ||
|
Methylation in Case |
2.22E-01 (Median) | Methylation in Control | 1.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:9.57E-05; Z-score:8.11E-01 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg09361598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.99E-04; Z-score:-1.57E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg24466448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.78E-04; Z-score:-1.13E+00 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg08186671) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:8.37E-04; Z-score:5.28E-01 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg02238950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.87E-03; Z-score:-7.03E-01 | ||
|
Methylation in Case |
6.60E-01 (Median) | Methylation in Control | 6.81E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg23691006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:6.18E-03; Z-score:1.15E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:1.02E-02; Z-score:1.25E+00 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 1.64E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg01438467) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.14E-02; Z-score:-6.39E-01 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg19880947) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.22E-02; Z-score:-7.38E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg12564034) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.45E-02; Z-score:8.43E-02 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg15090217) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.51E-02; Z-score:4.17E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg21949830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.59E-02; Z-score:-9.11E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg03720572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.84E-02; Z-score:1.08E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg17812026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:3.96E-02; Z-score:5.65E-01 | ||
|
Methylation in Case |
9.97E-01 (Median) | Methylation in Control | 9.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:4.27E-02; Z-score:7.73E-01 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 4.69E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:3.36E-09; Z-score:2.55E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 4.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg06126721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.41E+00 | Statistic Test | p-value:3.89E-09; Z-score:2.48E+00 | ||
|
Methylation in Case |
6.93E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg17442852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.45E-06; Z-score:1.19E+00 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 7.13E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.35E+00 | Statistic Test | p-value:2.48E-06; Z-score:2.10E+00 | ||
|
Methylation in Case |
3.14E-01 (Median) | Methylation in Control | 2.32E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.19E-06; Z-score:1.28E+00 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:4.33E-06; Z-score:2.25E+00 | ||
|
Methylation in Case |
3.51E-01 (Median) | Methylation in Control | 2.77E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC43A2 in HIV infection | [ 7 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.09E-04; Z-score:9.53E-01 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
22 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
5'UTR (cg00162231) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.23E+00 | Statistic Test | p-value:2.74E-09; Z-score:1.95E+00 | ||
|
Methylation in Case |
4.09E-01 (Median) | Methylation in Control | 1.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
5'UTR (cg05669210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:3.10E-02; Z-score:-4.47E-01 | ||
|
Methylation in Case |
5.63E-02 (Median) | Methylation in Control | 6.62E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg11871280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.06E-05; Z-score:-6.42E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg09617319) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.00E-02; Z-score:9.49E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg05504606) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:3.69E-02; Z-score:-4.96E-01 | ||
|
Methylation in Case |
6.06E-02 (Median) | Methylation in Control | 6.48E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.76E+00 | Statistic Test | p-value:3.12E-32; Z-score:6.08E+00 | ||
|
Methylation in Case |
5.07E-01 (Median) | Methylation in Control | 1.35E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg08763626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:4.31E-02; Z-score:7.11E-01 | ||
|
Methylation in Case |
4.01E-01 (Median) | Methylation in Control | 3.63E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg04014105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.96E+00 | Statistic Test | p-value:3.33E-17; Z-score:3.24E+00 | ||
|
Methylation in Case |
3.71E-01 (Median) | Methylation in Control | 1.89E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg27650699) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:9.01E-13; Z-score:-1.88E+00 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg13481132) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.20E+00 | Statistic Test | p-value:9.65E-10; Z-score:2.16E+00 | ||
|
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg15603311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.07E-08; Z-score:5.02E-01 | ||
|
Methylation in Case |
1.44E-01 (Median) | Methylation in Control | 1.25E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg17669365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.05E-08; Z-score:1.55E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg09035529) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.90E-06; Z-score:1.21E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg24866407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:2.90E-05; Z-score:1.18E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg20050113) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:6.31E-05; Z-score:-1.01E+00 | ||
|
Methylation in Case |
3.10E-01 (Median) | Methylation in Control | 3.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg21156276) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.75E-04; Z-score:-6.14E-01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg16419706) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.05E-02; Z-score:-5.87E-01 | ||
|
Methylation in Case |
8.71E-02 (Median) | Methylation in Control | 9.69E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg08543327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.77E-02; Z-score:8.49E-02 | ||
|
Methylation in Case |
5.66E-01 (Median) | Methylation in Control | 5.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg11926764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.79E-02; Z-score:-2.78E-01 | ||
|
Methylation in Case |
3.11E-02 (Median) | Methylation in Control | 3.47E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg04958882) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.55E-02; Z-score:1.51E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.12E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg10778996) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.64E-02; Z-score:8.08E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC43A2 in pancretic ductal adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg05360422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:3.81E-02; Z-score:-3.86E-01 | ||
|
Methylation in Case |
3.77E-02 (Median) | Methylation in Control | 4.07E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
5'UTR (cg00761755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:9.79E-01 | Statistic Test | p-value:2.43E-02; Z-score:3.35E-01 | ||
|
Methylation in Case |
-4.46E+00 (Median) | Methylation in Control | -4.55E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg02238950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.58E-03; Z-score:7.10E-01 | ||
|
Methylation in Case |
1.17E+00 (Median) | Methylation in Control | 1.03E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-9.44E-01 | Statistic Test | p-value:1.05E-02; Z-score:-3.19E-01 | ||
|
Methylation in Case |
-3.09E+00 (Median) | Methylation in Control | -2.92E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg16061354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-5.46E-01 | Statistic Test | p-value:1.25E-02; Z-score:-6.77E-01 | ||
|
Methylation in Case |
-9.92E-01 (Median) | Methylation in Control | -5.42E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg08488915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.71E-02; Z-score:-5.46E-01 | ||
|
Methylation in Case |
2.66E+00 (Median) | Methylation in Control | 2.82E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg18964590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.77E-02; Z-score:-2.95E-01 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 9.70E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-8.47E-01 | Statistic Test | p-value:2.83E-02; Z-score:-5.08E-01 | ||
|
Methylation in Case |
-8.99E-01 (Median) | Methylation in Control | -7.61E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in panic disorder | [ 9 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-8.72E-01 | Statistic Test | p-value:1.74E-02; Z-score:-3.74E-01 | ||
|
Methylation in Case |
-5.61E-01 (Median) | Methylation in Control | -4.89E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
5'UTR (cg13251490) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.04E-02; Z-score:-4.66E-01 | ||
|
Methylation in Case |
5.01E-02 (Median) | Methylation in Control | 5.35E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg21881273) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:8.59E-03; Z-score:-4.24E-01 | ||
|
Methylation in Case |
8.20E-02 (Median) | Methylation in Control | 8.77E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg02703843) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:1.53E-02; Z-score:-6.68E-01 | ||
|
Methylation in Case |
6.03E-02 (Median) | Methylation in Control | 7.31E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg24314549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:3.62E-02; Z-score:-9.42E-01 | ||
|
Methylation in Case |
2.05E-01 (Median) | Methylation in Control | 2.42E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.43E+00 | Statistic Test | p-value:1.29E-17; Z-score:-2.41E+00 | ||
|
Methylation in Case |
2.81E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01438467) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.53E+00 | Statistic Test | p-value:9.27E-17; Z-score:2.95E+00 | ||
|
Methylation in Case |
6.09E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg19272348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:4.49E-14; Z-score:-3.86E+00 | ||
|
Methylation in Case |
5.96E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg25212453) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:6.62E-12; Z-score:2.23E+00 | ||
|
Methylation in Case |
5.70E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg00691874) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:2.01E-11; Z-score:-2.71E+00 | ||
|
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 6.25E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg15090217) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:8.50E-10; Z-score:-1.36E+00 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg21949830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:1.37E-09; Z-score:1.49E+00 | ||
|
Methylation in Case |
4.04E-01 (Median) | Methylation in Control | 3.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:8.58E-09; Z-score:1.35E+00 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 4.79E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.00E-08; Z-score:1.29E+00 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:6.21E-08; Z-score:1.54E+00 | ||
|
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 5.10E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg19880947) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.54E-07; Z-score:1.34E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 3.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg18964590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.96E-07; Z-score:-9.97E-01 | ||
|
Methylation in Case |
6.83E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03720572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.24E-07; Z-score:-1.31E+00 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02188939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.05E-06; Z-score:1.19E+00 | ||
|
Methylation in Case |
3.54E-01 (Median) | Methylation in Control | 2.90E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:3.20E-05; Z-score:-9.79E-01 | ||
|
Methylation in Case |
1.36E-01 (Median) | Methylation in Control | 2.02E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.81E-05; Z-score:-7.40E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg23691006) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.87E-03; Z-score:9.47E-01 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg24466448) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.82E-03; Z-score:-8.07E-01 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16061354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.37E-02; Z-score:-6.58E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg14401583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.31E-02; Z-score:5.27E-01 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg14131824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.37E-02; Z-score:3.94E-01 | ||
|
Methylation in Case |
6.16E-01 (Median) | Methylation in Control | 5.87E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:9.28E-06; Z-score:1.84E+00 | ||
|
Methylation in Case |
6.21E-01 (Median) | Methylation in Control | 5.43E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.64E-05; Z-score:8.89E-01 | ||
|
Methylation in Case |
7.91E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.56E-04; Z-score:7.87E-01 | ||
|
Methylation in Case |
5.61E-01 (Median) | Methylation in Control | 5.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC43A2 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.91E-02; Z-score:-2.89E-01 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 3.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in prostate cancer | [ 11 ] | |||
|
Location |
5'UTR (cg16313393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.70E+00 | Statistic Test | p-value:3.85E-02; Z-score:1.07E+01 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 2.95E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in prostate cancer | [ 11 ] | |||
|
Location |
TSS200 (cg18953011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:3.13E-02; Z-score:1.97E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg25194822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.15E+00 | Statistic Test | p-value:2.02E-02; Z-score:-1.86E+00 | ||
|
Methylation in Case |
7.43E-02 (Median) | Methylation in Control | 1.59E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg07349212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.72E+00 | Statistic Test | p-value:2.12E-02; Z-score:-2.52E+00 | ||
|
Methylation in Case |
1.05E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg22632352) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.91E-02; Z-score:1.47E+00 | ||
|
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg24314549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:1.69E-06; Z-score:-1.60E+00 | ||
|
Methylation in Case |
1.65E-01 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg21881273) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.93E-02; Z-score:-4.46E-02 | ||
|
Methylation in Case |
3.32E-02 (Median) | Methylation in Control | 3.37E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.28E+00 | Statistic Test | p-value:3.24E-11; Z-score:3.07E+00 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 7.13E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:1.56E-09; Z-score:-1.28E+00 | ||
|
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 2.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg14131824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:7.20E-09; Z-score:-1.28E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg15090217) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.11E-05; Z-score:-1.07E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg09361598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.66E-05; Z-score:-1.17E+00 | ||
|
Methylation in Case |
7.12E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg17172593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.63E-04; Z-score:-1.32E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 4.87E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg07943111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.77E-04; Z-score:-7.45E-01 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg01438467) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.01E-03; Z-score:-6.94E-01 | ||
|
Methylation in Case |
7.58E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg19880947) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.89E-03; Z-score:-6.24E-01 | ||
|
Methylation in Case |
7.10E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.70E-02; Z-score:-8.19E-01 | ||
|
Methylation in Case |
7.28E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
Body (cg08186671) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.94E-02; Z-score:-3.71E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg06126721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.80E+00 | Statistic Test | p-value:5.17E-11; Z-score:2.74E+00 | ||
|
Methylation in Case |
2.01E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:7.63E-10; Z-score:2.87E+00 | ||
|
Methylation in Case |
6.72E-01 (Median) | Methylation in Control | 5.45E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:7.99E-08; Z-score:1.85E+00 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 2.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:3.34E-07; Z-score:1.45E+00 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:7.79E-06; Z-score:2.12E+00 | ||
|
Methylation in Case |
6.53E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.14E-05; Z-score:1.76E+00 | ||
|
Methylation in Case |
5.39E-01 (Median) | Methylation in Control | 4.63E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC43A2 in breast cancer | [ 12 ] | |||
|
Location |
3'UTR (cg17442852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:6.59E-04; Z-score:1.25E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 5.50E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
TSS1500 (cg24314549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:7.73E-03; Z-score:-1.10E+00 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.89E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg02188939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:5.13E-06; Z-score:-3.67E+00 | ||
|
Methylation in Case |
5.82E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg19880947) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.33E-05; Z-score:-4.70E+00 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.07E-04; Z-score:2.70E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 5.54E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.45E-04; Z-score:2.21E+00 | ||
|
Methylation in Case |
6.13E-01 (Median) | Methylation in Control | 5.24E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg04196298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.96E+00 | Statistic Test | p-value:4.23E-04; Z-score:4.83E+00 | ||
|
Methylation in Case |
3.07E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg02426464) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:5.01E-04; Z-score:-2.14E+00 | ||
|
Methylation in Case |
3.11E-01 (Median) | Methylation in Control | 4.20E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:7.71E-04; Z-score:1.90E+00 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg18964590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.31E-03; Z-score:2.80E+00 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 6.07E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg01438467) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.99E-03; Z-score:-4.49E+00 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:4.49E-03; Z-score:2.00E+00 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg08186671) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.91E-03; Z-score:-1.83E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg09361598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:6.82E-03; Z-score:-1.66E+00 | ||
|
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg23837623) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:2.54E-03; Z-score:1.97E+00 | ||
|
Methylation in Case |
3.71E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg06126721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.70E+00 | Statistic Test | p-value:2.92E-03; Z-score:4.37E+00 | ||
|
Methylation in Case |
3.32E-01 (Median) | Methylation in Control | 1.96E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg06017212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:3.49E-03; Z-score:2.68E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg01148127) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:6.50E-03; Z-score:2.49E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg10025200) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.64E-02; Z-score:1.50E+00 | ||
|
Methylation in Case |
2.21E-01 (Median) | Methylation in Control | 1.86E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC43A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg23859051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.95E-02; Z-score:1.18E+00 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 7.25E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
TSS1500 (cg03734322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:9.09E-03; Z-score:-1.46E-01 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 1.15E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
TSS200 (cg11896345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.84E-02; Z-score:-1.17E-01 | ||
|
Methylation in Case |
8.98E-02 (Median) | Methylation in Control | 9.25E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
TSS200 (cg12683602) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:4.89E-02; Z-score:1.54E-01 | ||
|
Methylation in Case |
2.07E-02 (Median) | Methylation in Control | 2.00E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg09158821) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.01E-04; Z-score:3.15E-01 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg09329516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:1.04E-02; Z-score:2.58E-01 | ||
|
Methylation in Case |
5.73E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg05291429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.12E-02; Z-score:3.24E-03 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg11076954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.15E-02; Z-score:2.87E-01 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 5.15E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC43A2 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
Body (cg09361598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.36E-02; Z-score:-2.42E-01 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in celiac disease | [ 15 ] | |||
|
Location |
Body (cg04204452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:3.69E-02; Z-score:-8.27E-01 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease[ ICD-11:DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC43A2 in depression | [ 16 ] | |||
|
Location |
Body (cg02238950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.58E-02; Z-score:-3.42E-01 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 5.70E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC43A2 in depression | [ 16 ] | |||
|
Location |
Body (cg19880947) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.70E-02; Z-score:-3.34E-01 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.05E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
67 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1228 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1228 | miRNA Mature ID | miR-1228-3p | ||
|
miRNA Sequence |
UCACACCUGCCUCGCCCCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1238 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1238 | miRNA Mature ID | miR-1238-3p | ||
|
miRNA Sequence |
CUUCCUCGUCUGUCUGCCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-1247 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1247 | miRNA Mature ID | miR-1247-3p | ||
|
miRNA Sequence |
CCCCGGGAACGUCGAGACUGGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-1253 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1253 | miRNA Mature ID | miR-1253 | ||
|
miRNA Sequence |
AGAGAAGAAGAUCAGCCUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-1273h directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1273h | miRNA Mature ID | miR-1273h-3p | ||
|
miRNA Sequence |
CUGCAGACUCGACCUCCCAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-1281 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1281 | miRNA Mature ID | miR-1281 | ||
|
miRNA Sequence |
UCGCCUCCUCCUCUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-1304 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-3p | ||
|
miRNA Sequence |
UCUCACUGUAGCCUCGAACCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-1307 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1307 | miRNA Mature ID | miR-1307-3p | ||
|
miRNA Sequence |
ACUCGGCGUGGCGUCGGUCGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-1343 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1343 | miRNA Mature ID | miR-1343-3p | ||
|
miRNA Sequence |
CUCCUGGGGCCCGCACUCUCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-139 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-139 | miRNA Mature ID | miR-139-3p | ||
|
miRNA Sequence |
UGGAGACGCGGCCCUGUUGGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-150 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-150 | miRNA Mature ID | miR-150-5p | ||
|
miRNA Sequence |
UCUCCCAACCCUUGUACCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-1976 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1976 | miRNA Mature ID | miR-1976 | ||
|
miRNA Sequence |
CCUCCUGCCCUCCUUGCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-204 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-204 | miRNA Mature ID | miR-204-5p | ||
|
miRNA Sequence |
UUCCCUUUGUCAUCCUAUGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-211 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-211 | miRNA Mature ID | miR-211-5p | ||
|
miRNA Sequence |
UUCCCUUUGUCAUCCUUCGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-2276 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2276 | miRNA Mature ID | miR-2276-3p | ||
|
miRNA Sequence |
UCUGCAAGUGUCAGAGGCGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-3124 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3124 | miRNA Mature ID | miR-3124-3p | ||
|
miRNA Sequence |
ACUUUCCUCACUCCCGUGAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-3182 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3182 | miRNA Mature ID | miR-3182 | ||
|
miRNA Sequence |
GCUUCUGUAGUGUAGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-3199 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3199 | miRNA Mature ID | miR-3199 | ||
|
miRNA Sequence |
AGGGACUGCCUUAGGAGAAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-365a directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-365a | miRNA Mature ID | miR-365a-5p | ||
|
miRNA Sequence |
AGGGACUUUUGGGGGCAGAUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-365b directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-365b | miRNA Mature ID | miR-365b-5p | ||
|
miRNA Sequence |
AGGGACUUUCAGGGGCAGCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-3678 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3678 | miRNA Mature ID | miR-3678-3p | ||
|
miRNA Sequence |
CUGCAGAGUUUGUACGGACCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-3680 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3680 | miRNA Mature ID | miR-3680-3p | ||
|
miRNA Sequence |
UUUUGCAUGACCCUGGGAGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-377 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-377 | miRNA Mature ID | miR-377-3p | ||
|
miRNA Sequence |
AUCACACAAAGGCAACUUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon24 |
miR-4251 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4251 | miRNA Mature ID | miR-4251 | ||
|
miRNA Sequence |
CCUGAGAAAAGGGCCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-4257 directly targets SLC43A2 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4257 | miRNA Mature ID | miR-4257 | ||
|
miRNA Sequence |
CCAGAGGUGGGGACUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon26 |
miR-4258 directly targets SLC43A2 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4258 | miRNA Mature ID | miR-4258 | ||
|
miRNA Sequence |
CCCCGCCACCGCCUUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-4279 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4279 | miRNA Mature ID | miR-4279 | ||
|
miRNA Sequence |
CUCUCCUCCCGGCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon28 |
miR-4284 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4284 | miRNA Mature ID | miR-4284 | ||
|
miRNA Sequence |
GGGCUCACAUCACCCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon29 |
miR-4287 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4287 | miRNA Mature ID | miR-4287 | ||
|
miRNA Sequence |
UCUCCCUUGAGGGCACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon30 |
miR-4303 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4303 | miRNA Mature ID | miR-4303 | ||
|
miRNA Sequence |
UUCUGAGCUGAGGACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon31 |
miR-4329 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4329 | miRNA Mature ID | miR-4329 | ||
|
miRNA Sequence |
CCUGAGACCCUAGUUCCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon32 |
miR-4438 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4438 | miRNA Mature ID | miR-4438 | ||
|
miRNA Sequence |
CACAGGCUUAGAAAAGACAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon33 |
miR-4485 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4485 | miRNA Mature ID | miR-4485-5p | ||
|
miRNA Sequence |
ACCGCCUGCCCAGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon34 |
miR-450b directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-450b | miRNA Mature ID | miR-450b-5p | ||
|
miRNA Sequence |
UUUUGCAAUAUGUUCCUGAAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-4638 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4638 | miRNA Mature ID | miR-4638-5p | ||
|
miRNA Sequence |
ACUCGGCUGCGGUGGACAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon36 |
miR-4685 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4685 | miRNA Mature ID | miR-4685-3p | ||
|
miRNA Sequence |
UCUCCCUUCCUGCCCUGGCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon37 |
miR-4691 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4691 | miRNA Mature ID | miR-4691-5p | ||
|
miRNA Sequence |
GUCCUCCAGGCCAUGAGCUGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon38 |
miR-4722 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-3p | ||
|
miRNA Sequence |
ACCUGCCAGCACCUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon39 |
miR-493 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-493 | miRNA Mature ID | miR-493-3p | ||
|
miRNA Sequence |
UGAAGGUCUACUGUGUGCCAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon40 |
miR-5008 directly targets SLC43A2 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5008 | miRNA Mature ID | miR-5008-5p | ||
|
miRNA Sequence |
UGAGGCCCUUGGGGCACAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon41 |
miR-507 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-507 | miRNA Mature ID | miR-507 | ||
|
miRNA Sequence |
UUUUGCACCUUUUGGAGUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon42 |
miR-5091 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5091 | miRNA Mature ID | miR-5091 | ||
|
miRNA Sequence |
ACGGAGACGACAAGACUGUGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon43 |
miR-557 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-557 | miRNA Mature ID | miR-557 | ||
|
miRNA Sequence |
GUUUGCACGGGUGGGCCUUGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon44 |
miR-562 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-562 | miRNA Mature ID | miR-562 | ||
|
miRNA Sequence |
AAAGUAGCUGUACCAUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon45 |
miR-564 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-564 | miRNA Mature ID | miR-564 | ||
|
miRNA Sequence |
AGGCACGGUGUCAGCAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon46 |
miR-5697 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5697 | miRNA Mature ID | miR-5697 | ||
|
miRNA Sequence |
UCAAGUAGUUUCAUGAUAAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon47 |
miR-6516 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6516 | miRNA Mature ID | miR-6516-5p | ||
|
miRNA Sequence |
UUUGCAGUAACAGGUGUGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon48 |
miR-6727 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
|
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon49 |
miR-6741 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6741 | miRNA Mature ID | miR-6741-3p | ||
|
miRNA Sequence |
UCGGCUCUCUCCCUCACCCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon50 |
miR-6742 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6742 | miRNA Mature ID | miR-6742-3p | ||
|
miRNA Sequence |
ACCUGGGUUGUCCCCUCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon51 |
miR-6747 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
|
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon52 |
miR-6749 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6749 | miRNA Mature ID | miR-6749-3p | ||
|
miRNA Sequence |
CUCCUCCCCUGCCUGGCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon53 |
miR-6761 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6761 | miRNA Mature ID | miR-6761-5p | ||
|
miRNA Sequence |
UCUGAGAGAGCUCGAUGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon54 |
miR-6770 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6770 | miRNA Mature ID | miR-6770-5p | ||
|
miRNA Sequence |
UGAGAAGGCACAGCUUGCACGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon55 |
miR-6778 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
|
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon56 |
miR-6783 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6783 | miRNA Mature ID | miR-6783-3p | ||
|
miRNA Sequence |
UUCCUGGGCUUCUCCUCUGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon57 |
miR-6792 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6792 | miRNA Mature ID | miR-6792-3p | ||
|
miRNA Sequence |
CUCCUCCACAGCCCCUGCUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon58 |
miR-6814 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6814 | miRNA Mature ID | miR-6814-5p | ||
|
miRNA Sequence |
UCCCAAGGGUGAGAUGCUGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon59 |
miR-6832 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6832 | miRNA Mature ID | miR-6832-3p | ||
|
miRNA Sequence |
ACCCUUUUUCUCUUUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon60 |
miR-6845 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6845 | miRNA Mature ID | miR-6845-3p | ||
|
miRNA Sequence |
CCUCUCCUCCCUGUGCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon61 |
miR-6852 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6852 | miRNA Mature ID | miR-6852-5p | ||
|
miRNA Sequence |
CCCUGGGGUUCUGAGGACAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon62 |
miR-6890 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
|
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon63 |
miR-7110 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7110 | miRNA Mature ID | miR-7110-3p | ||
|
miRNA Sequence |
UCUCUCUCCCACUUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon64 |
miR-7151 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
|
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon65 |
miR-8052 directly targets SLC43A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8052 | miRNA Mature ID | miR-8052 | ||
|
miRNA Sequence |
CGGGACUGUAGAGGGCAUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon66 |
miR-877 directly targets SLC43A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
|
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon67 |
miR-939 directly targets SLC43A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-939 | miRNA Mature ID | miR-939-3p | ||
|
miRNA Sequence |
CCCUGGGCCUCUGCUCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.