Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0349 Transporter Info | ||||
| Gene Name | SLC39A8 | ||||
| Transporter Name | Zinc transporter ZIP8 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in bladder cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg04660577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.62E+00 | Statistic Test | p-value:2.28E-10; Z-score:-1.67E+01 | ||
|
Methylation in Case |
4.47E-01 (Median) | Methylation in Control | 7.25E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A8 in bladder cancer | [ 1 ] | |||
|
Location |
Body (cg14579898) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.81E+00 | Statistic Test | p-value:6.07E-10; Z-score:-1.34E+01 | ||
|
Methylation in Case |
3.35E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg04660577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.50E-05; Z-score:-5.89E-01 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A8 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14579898) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:7.71E-08; Z-score:-2.25E+00 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 3.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in lung adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg04660577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.38E-04; Z-score:1.84E+00 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg23474268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.72E-02; Z-score:-2.71E-01 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 1.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A8 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg24924505) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:2.74E-08; Z-score:-1.96E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in atypical teratoid rhabdoid tumor | [ 5 ] | |||
|
Location |
Body (cg14579898) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.79E-02; Z-score:-3.80E-01 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A8 in atypical teratoid rhabdoid tumor | [ 5 ] | |||
|
Location |
3'UTR (cg26184765) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.44E-09; Z-score:-2.17E+00 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14579898) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:2.32E-05; Z-score:-1.22E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A8 in systemic lupus erythematosus | [ 7 ] | |||
|
Location |
3'UTR (cg26184765) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.56E-02; Z-score:2.02E-03 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1260b directly targets SLC39A8 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
|
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-192 directly targets SLC39A8 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-192 | miRNA Mature ID | miR-192-5p | ||
|
miRNA Sequence |
CUGACCUAUGAAUUGACAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-215 directly targets SLC39A8 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-5p | ||
|
miRNA Sequence |
AUGACCUAUGAAUUGACAGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-30c-1 directly targets SLC39A8 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-30c-1 | miRNA Mature ID | miR-30c-1-3p | ||
|
miRNA Sequence |
CUGGGAGAGGGUUGUUUACUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon5 |
miR-331 directly targets SLC39A8 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-331 | miRNA Mature ID | miR-331-3p | ||
|
miRNA Sequence |
GCCCCUGGGCCUAUCCUAGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.