General Information of Drug Transporter (DT)
DT ID DTD0349 Transporter Info
Gene Name SLC39A8
Transporter Name Zinc transporter ZIP8
Gene ID
64116
UniProt ID
Q9C0K1
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in bladder cancer [ 1 ]

Location

TSS1500 (cg04660577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.62E+00 Statistic Test p-value:2.28E-10; Z-score:-1.67E+01

Methylation in Case

4.47E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A8 in bladder cancer [ 1 ]

Location

Body (cg14579898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.81E+00 Statistic Test p-value:6.07E-10; Z-score:-1.34E+01

Methylation in Case

3.35E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg04660577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.50E-05; Z-score:-5.89E-01

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A8 in hepatocellular carcinoma [ 2 ]

Location

Body (cg14579898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:7.71E-08; Z-score:-2.25E+00

Methylation in Case

2.63E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in lung adenocarcinoma [ 3 ]

Location

TSS1500 (cg04660577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.38E-04; Z-score:1.84E+00

Methylation in Case

8.02E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg23474268)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:3.72E-02; Z-score:-2.71E-01

Methylation in Case

1.11E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A8 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg24924505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:2.74E-08; Z-score:-1.96E+00

Methylation in Case

4.11E-01 (Median) Methylation in Control 5.98E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in atypical teratoid rhabdoid tumor [ 5 ]

Location

Body (cg14579898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.79E-02; Z-score:-3.80E-01

Methylation in Case

7.11E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A8 in atypical teratoid rhabdoid tumor [ 5 ]

Location

3'UTR (cg26184765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.44E-09; Z-score:-2.17E+00

Methylation in Case

8.18E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in breast cancer [ 6 ]

Location

Body (cg14579898)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.32E-05; Z-score:-1.22E+00

Methylation in Case

4.93E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A8 in systemic lupus erythematosus [ 7 ]

Location

3'UTR (cg26184765)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:1.56E-02; Z-score:2.02E-03

Methylation in Case

9.19E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1260b directly targets SLC39A8 [ 8 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

AUCCCACCACUGCCACCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-192 directly targets SLC39A8 [ 9 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-215 directly targets SLC39A8 [ 9 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-30c-1 directly targets SLC39A8 [ 8 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-30c-1 miRNA Mature ID miR-30c-1-3p

miRNA Sequence

CUGGGAGAGGGUUGUUUACUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-331 directly targets SLC39A8 [ 8 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-331 miRNA Mature ID miR-331-3p

miRNA Sequence

GCCCCUGGGCCUAUCCUAGAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
6 Genome-wide Scan for Methylation Profiles in Breast Cancer
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
9 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.