General Information of Drug Transporter (DT)
DT ID DTD0344 Transporter Info
Gene Name SLC39A3
Transporter Name Zinc transporter ZIP3
Gene ID
29985
UniProt ID
Q9BRY0
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg10951120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.96E+00 Statistic Test p-value:9.96E-04; Z-score:3.44E+00

Methylation in Case

1.29E-01 (Median) Methylation in Control 6.57E-02 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A3 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg15014549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.47E+00 Statistic Test p-value:4.56E-03; Z-score:2.13E+00

Methylation in Case

1.75E-01 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg06262842)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.26E-03; Z-score:3.68E-01

Methylation in Case

7.74E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg08122172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:5.35E-03; Z-score:5.49E-01

Methylation in Case

8.85E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC39A3 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg07942762)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:2.85E-13; Z-score:-1.98E+00

Methylation in Case

5.91E-01 (Median) Methylation in Control 7.67E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg17827583)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:6.28E-03; Z-score:-4.07E-01

Methylation in Case

9.77E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC39A3 in clear cell renal cell carcinoma [ 3 ]

Location

Body (cg06262842)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.16E-02; Z-score:-3.07E-01

Methylation in Case

9.42E-01 (Median) Methylation in Control 9.45E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in colorectal cancer [ 4 ]

Location

Body (cg06262842)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.29E-02; Z-score:4.51E-01

Methylation in Case

9.45E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in HIV infection [ 5 ]

Location

Body (cg06262842)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.19E-02; Z-score:2.51E-01

Methylation in Case

8.87E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in panic disorder [ 6 ]

Location

Body (cg08122172)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.24E-03; Z-score:-4.12E-01

Methylation in Case

5.18E+00 (Median) Methylation in Control 5.30E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC39A3 in papillary thyroid cancer [ 7 ]

Location

Body (cg06262842)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.59E-04; Z-score:-6.49E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.33E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Uterine carcinosarcoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC39A3 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.011645668; Fold-change:-0.439033128; Z-score:-1.400052044
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1 directly targets SLC39A3 [ 8 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

miR-124 directly targets SLC39A3 [ 8 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.