Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0344 Transporter Info | ||||
| Gene Name | SLC39A3 | ||||
| Transporter Name | Zinc transporter ZIP3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg10951120) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.96E+00 | Statistic Test | p-value:9.96E-04; Z-score:3.44E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 6.57E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:4.56E-03; Z-score:2.13E+00 | ||
|
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg06262842) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.26E-03; Z-score:3.68E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A3 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg08122172) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:5.35E-03; Z-score:5.49E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC39A3 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
3'UTR (cg07942762) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:2.85E-13; Z-score:-1.98E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 7.67E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg17827583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:6.28E-03; Z-score:-4.07E-01 | ||
|
Methylation in Case |
9.77E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC39A3 in clear cell renal cell carcinoma | [ 3 ] | |||
|
Location |
Body (cg06262842) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.16E-02; Z-score:-3.07E-01 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in colorectal cancer | [ 4 ] | |||
|
Location |
Body (cg06262842) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.29E-02; Z-score:4.51E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg06262842) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.19E-02; Z-score:2.51E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg08122172) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.24E-03; Z-score:-4.12E-01 | ||
|
Methylation in Case |
5.18E+00 (Median) | Methylation in Control | 5.30E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC39A3 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg06262842) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.59E-04; Z-score:-6.49E-01 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Uterine carcinosarcoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC39A3 in uterine carcinosarcoma than that in healthy individual | ||||
Studied Phenotype |
Uterine carcinosarcoma [ICD-11:2B5F] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.011645668; Fold-change:-0.439033128; Z-score:-1.400052044 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1 directly targets SLC39A3 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
|
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon2 |
miR-124 directly targets SLC39A3 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
|
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples