Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0287 Transporter Info | ||||
Gene Name | SLC35A1 | ||||
Transporter Name | CMP-sialic acid transporter | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-1301 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1301 | miRNA Mature ID | miR-1301-5p | ||
miRNA Sequence |
CGCUCUAGGCACCGCAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-155 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-15a directly targets SLC35A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-16 directly targets SLC35A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-224 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-224 | miRNA Mature ID | miR-224-3p | ||
miRNA Sequence |
AAAAUGGUGCCCUAGUGACUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-299 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-299 | miRNA Mature ID | miR-299-5p | ||
miRNA Sequence |
UGGUUUACCGUCCCACAUACAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-302a directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-5p | ||
miRNA Sequence |
ACUUAAACGUGGAUGUACUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-4474 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4474 | miRNA Mature ID | miR-4474-5p | ||
miRNA Sequence |
UUAGUCUCAUGAUCAGACACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-522 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-522 | miRNA Mature ID | miR-522-3p | ||
miRNA Sequence |
AAAAUGGUUCCCUUUAGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon10 |
miR-5700 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5700 | miRNA Mature ID | miR-5700 | ||
miRNA Sequence |
UAAUGCAUUAAAUUAUUGAAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-6502 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6502 | miRNA Mature ID | miR-6502-5p | ||
miRNA Sequence |
AGCUCUAGAAAGAUUGUUGACC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-6822 directly targets SLC35A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6822 | miRNA Mature ID | miR-6822-3p | ||
miRNA Sequence |
AGGCUCUAACUGGCUUUCCCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.