General Information of Drug Transporter (DT)
DT ID DTD0277 Transporter Info
Gene Name SLC30A9
Transporter Name Zinc transporter 9
Gene ID
10463
UniProt ID
Q6PML9
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg00178984)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:6.27E-05; Z-score:-2.78E+00

Methylation in Case

5.79E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg25099065)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.45E-04; Z-score:8.39E-01

Methylation in Case

7.65E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in colon adenocarcinoma [ 1 ]

Location

Body (cg15164708)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:1.21E-05; Z-score:3.07E+00

Methylation in Case

5.57E-01 (Median) Methylation in Control 4.11E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC30A9 in colon adenocarcinoma [ 1 ]

Location

Body (cg06116236)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.20E-04; Z-score:1.41E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 5.38E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC30A9 in colon adenocarcinoma [ 1 ]

Location

Body (cg08783639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:3.99E-04; Z-score:-2.24E+00

Methylation in Case

6.60E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in prostate cancer [ 2 ]

Location

5'UTR (cg15759056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.60E+00 Statistic Test p-value:8.11E-04; Z-score:4.97E+00

Methylation in Case

3.73E-01 (Median) Methylation in Control 8.11E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in bladder cancer [ 3 ]

Location

TSS1500 (cg07260532)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.57E-03; Z-score:-1.73E+00

Methylation in Case

1.50E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in bladder cancer [ 3 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.91E+00 Statistic Test p-value:8.21E-04; Z-score:-3.03E+00

Methylation in Case

1.37E-01 (Median) Methylation in Control 2.62E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in bladder cancer [ 3 ]

Location

Body (cg26877604)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.93E-02; Z-score:-1.43E+00

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

TSS1500 (cg10106268)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.58E-02; Z-score:5.07E-01

Methylation in Case

1.48E-01 (Median) Methylation in Control 1.33E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

TSS1500 (cg07260532)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.77E-02; Z-score:8.03E-01

Methylation in Case

1.74E-01 (Median) Methylation in Control 1.49E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

TSS1500 (cg09852079)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.49E+00 Statistic Test p-value:1.85E-02; Z-score:7.38E-01

Methylation in Case

3.36E-02 (Median) Methylation in Control 2.25E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

TSS1500 (cg13237657)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:2.80E-02; Z-score:5.03E-01

Methylation in Case

9.32E-02 (Median) Methylation in Control 7.74E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

TSS200 (cg20780337)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.12E-02; Z-score:-4.28E-01

Methylation in Case

5.25E-02 (Median) Methylation in Control 5.82E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

TSS200 (cg10652277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:3.12E-02; Z-score:-4.02E-01

Methylation in Case

3.68E-02 (Median) Methylation in Control 4.20E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:1.06E-04; Z-score:1.07E+00

Methylation in Case

1.90E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC30A9 in breast cancer [ 4 ]

Location

Body (cg09414773)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:3.48E-03; Z-score:-6.23E-01

Methylation in Case

6.93E-02 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg07260532)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.77E+00 Statistic Test p-value:2.06E-05; Z-score:1.47E+00

Methylation in Case

1.41E-01 (Median) Methylation in Control 7.98E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg09852079)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:2.34E-04; Z-score:1.07E+00

Methylation in Case

2.79E-02 (Median) Methylation in Control 2.40E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg13237657)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.15E-02; Z-score:4.14E-01

Methylation in Case

2.84E-02 (Median) Methylation in Control 2.64E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC30A9 in clear cell renal cell carcinoma [ 5 ]

Location

TSS200 (cg14536921)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.19E-03; Z-score:5.99E-01

Methylation in Case

1.85E-02 (Median) Methylation in Control 1.75E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC30A9 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg03574651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.31E-03; Z-score:7.57E-01

Methylation in Case

3.20E-02 (Median) Methylation in Control 2.82E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC30A9 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.52E+00 Statistic Test p-value:2.75E-03; Z-score:1.26E+00

Methylation in Case

1.88E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in HIV infection [ 6 ]

Location

TSS1500 (cg07260532)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.05E-03; Z-score:1.13E+00

Methylation in Case

3.27E-01 (Median) Methylation in Control 2.68E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in HIV infection [ 6 ]

Location

TSS1500 (cg09852079)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:7.76E-03; Z-score:5.75E-01

Methylation in Case

7.11E-02 (Median) Methylation in Control 5.29E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in HIV infection [ 6 ]

Location

TSS200 (cg24875840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.63E-02; Z-score:5.12E-01

Methylation in Case

2.59E-02 (Median) Methylation in Control 2.28E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg21565802)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:5.24E-04; Z-score:9.32E-01

Methylation in Case

6.13E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg09078517)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.52E-03; Z-score:-4.03E-01

Methylation in Case

1.72E-01 (Median) Methylation in Control 1.95E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg03419058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:8.04E+00 Statistic Test p-value:8.47E-07; Z-score:1.95E+00

Methylation in Case

4.43E-01 (Median) Methylation in Control 5.51E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg08706670)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.10E-02; Z-score:-1.84E-01

Methylation in Case

9.45E-02 (Median) Methylation in Control 9.77E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg25388971)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:5.25E-03; Z-score:9.04E-01

Methylation in Case

8.64E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg14065382)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.54E-03; Z-score:-4.69E-01

Methylation in Case

9.03E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg09767076)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:6.87E-03; Z-score:-8.08E-01

Methylation in Case

4.81E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC30A9 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg18167759)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.31E-02; Z-score:8.12E-01

Methylation in Case

8.62E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in panic disorder [ 8 ]

Location

TSS1500 (cg07260532)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:8.85E-01 Statistic Test p-value:4.55E-02; Z-score:4.52E-01

Methylation in Case

-1.68E+00 (Median) Methylation in Control -1.90E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in panic disorder [ 8 ]

Location

TSS200 (cg24875840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.85E-01 Statistic Test p-value:6.71E-03; Z-score:3.72E-01

Methylation in Case

-5.54E+00 (Median) Methylation in Control -5.62E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in panic disorder [ 8 ]

Location

TSS200 (cg10652277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.63E-01 Statistic Test p-value:1.45E-02; Z-score:4.82E-01

Methylation in Case

-4.62E+00 (Median) Methylation in Control -4.80E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC30A9 in panic disorder [ 8 ]

Location

3'UTR (cg06568401)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.08E-02; Z-score:-4.31E-01

Methylation in Case

6.56E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in systemic lupus erythematosus [ 9 ]

Location

TSS1500 (cg19303434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.46E-02; Z-score:-3.62E-02

Methylation in Case

6.19E-02 (Median) Methylation in Control 6.25E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in systemic lupus erythematosus [ 9 ]

Location

TSS200 (cg10652277)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.17E-02; Z-score:-9.63E-02

Methylation in Case

5.82E-02 (Median) Methylation in Control 5.95E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in colorectal cancer [ 10 ]

Location

TSS200 (cg20780337)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:4.50E-02; Z-score:-2.79E-01

Methylation in Case

2.67E-02 (Median) Methylation in Control 2.88E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in colorectal cancer [ 10 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.60E-03; Z-score:-1.09E+00

Methylation in Case

3.00E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg03574651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:3.75E-04; Z-score:-9.57E-01

Methylation in Case

6.42E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg09414773)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.05E-02; Z-score:-4.27E-01

Methylation in Case

8.14E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC30A9 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.03E-02; Z-score:-4.38E-01

Methylation in Case

6.09E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC30A9 in atypical teratoid rhabdoid tumor [ 11 ]

Location

3'UTR (cg06568401)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.34E-13; Z-score:-2.52E+00

Methylation in Case

7.81E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in hepatocellular carcinoma [ 12 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:9.82E-06; Z-score:-1.19E+00

Methylation in Case

1.83E-01 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC30A9 in hepatocellular carcinoma [ 12 ]

Location

Body (cg26877604)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.39E-03; Z-score:-4.19E-01

Methylation in Case

7.53E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in papillary thyroid cancer [ 13 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.68E-02; Z-score:2.36E-01

Methylation in Case

2.04E-01 (Median) Methylation in Control 1.93E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC30A9 in depression [ 14 ]

Location

3'UTR (cg06568401)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.70E-02; Z-score:4.61E-01

Methylation in Case

8.24E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1298 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1298 miRNA Mature ID miR-1298-5p

miRNA Sequence

UUCAUUCGGCUGUCCAGAUGUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-143 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-3p

miRNA Sequence

UGAGAUGAAGCACUGUAGCUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-222 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-222 miRNA Mature ID miR-222-5p

miRNA Sequence

CUCAGUAGCCAGUGUAGAUCCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-342 directly targets SLC30A9 [ 16 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-342 miRNA Mature ID miR-342-3p

miRNA Sequence

UCUCACACAGAAAUCGCACCCGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-4708 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4708 miRNA Mature ID miR-4708-5p

miRNA Sequence

AGAGAUGCCGCCUUGCUCCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-4770 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4770 miRNA Mature ID miR-4770

miRNA Sequence

UGAGAUGACACUGUAGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-545 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-545 miRNA Mature ID miR-545-5p

miRNA Sequence

UCAGUAAAUGUUUAUUAGAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-6088 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6088 miRNA Mature ID miR-6088

miRNA Sequence

AGAGAUGAAGCGGGGGGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-6740 directly targets SLC30A9 [ 15 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6740 miRNA Mature ID miR-6740-3p

miRNA Sequence

UGUCUUCUCUCCUCCCAAACAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
13 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
15 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
16 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.