Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0269 Transporter Info
Gene Name SLC30A1
Transporter Name Zinc transporter 1
Gene ID
7779
UniProt ID
Q9Y6M5
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg22855020)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.21E+00 Statistic Test p-value:6.95E-07; Z-score:1.59E+00

Methylation in Case

 7.64E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg08900781)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:2.39E-03; Z-score:-1.45E+00

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in colon adenocarcinoma [ 1 ]

Location

 TSS1500 (cg15523238)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.50E+00 Statistic Test p-value:3.15E-05; Z-score:1.61E+00

Methylation in Case

 5.19E-01 (Median) Methylation in Control 3.45E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC30A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg07519873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.67E+00 Statistic Test p-value:3.26E-04; Z-score:2.51E+00

Methylation in Case

 3.87E-01 (Median) Methylation in Control 2.32E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC30A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg21212995)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.19E+00 Statistic Test p-value:1.55E-03; Z-score:1.81E+00

Methylation in Case

 3.46E-01 (Median) Methylation in Control 2.91E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC30A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg11760099)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.05E+00 Statistic Test p-value:2.20E-03; Z-score:5.20E-01

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

  Bladder cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg24598094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.32E+00 Statistic Test p-value:4.17E-04; Z-score:-2.79E+00

Methylation in Case

 4.38E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in bladder cancer [ 2 ]

Location

 TSS1500 (cg01575408)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.25E+00 Statistic Test p-value:1.24E-03; Z-score:-2.80E+00

Methylation in Case

 4.55E-02 (Median) Methylation in Control 5.68E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in bladder cancer [ 2 ]

Location

 1stExon (cg19652869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:4.27E-03; Z-score:-1.49E+00

Methylation in Case

 6.23E-02 (Median) Methylation in Control 6.97E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC30A1 in bladder cancer [ 2 ]

Location

 1stExon (cg24162367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.39E+00 Statistic Test p-value:2.88E-02; Z-score:-1.11E+00

Methylation in Case

 2.29E-02 (Median) Methylation in Control 3.19E-02 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC30A1 in bladder cancer [ 2 ]

Location

 Body (cg12405231)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:3.62E-05; Z-score:-4.61E+00

Methylation in Case

 8.17E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg19267867)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:1.86E-03; Z-score:-4.08E-01

Methylation in Case

 2.97E-02 (Median) Methylation in Control 3.17E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg25466974)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:9.96E-03; Z-score:-5.38E-01

Methylation in Case

 2.57E-02 (Median) Methylation in Control 2.80E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg05152717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:1.47E-02; Z-score:4.73E-01

Methylation in Case

 2.73E-02 (Median) Methylation in Control 2.49E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC30A1 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg01143423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.24E+00 Statistic Test p-value:2.85E-07; Z-score:1.42E+00

Methylation in Case

 2.20E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC30A1 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg03763950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.24E+00 Statistic Test p-value:1.03E-04; Z-score:7.39E-01

Methylation in Case

 2.11E-02 (Median) Methylation in Control 1.71E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC30A1 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg04976746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.06E+00 Statistic Test p-value:1.65E-02; Z-score:5.97E-01

Methylation in Case

 2.64E-02 (Median) Methylation in Control 2.49E-02 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg05152717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.14E+00 Statistic Test p-value:2.14E-02; Z-score:8.14E-01

Methylation in Case

 1.04E-01 (Median) Methylation in Control 9.17E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg13976045)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.10E+00 Statistic Test p-value:4.92E-02; Z-score:4.93E-01

Methylation in Case

 3.47E-02 (Median) Methylation in Control 3.15E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in colorectal cancer [ 4 ]

Location

 1stExon (cg24162367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.12E+00 Statistic Test p-value:1.95E-02; Z-score:-6.97E-01

Methylation in Case

 2.17E-02 (Median) Methylation in Control 2.43E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC30A1 in colorectal cancer [ 4 ]

Location

 Body (cg04976746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.25E+00 Statistic Test p-value:7.68E-03; Z-score:-7.99E-01

Methylation in Case

 2.47E-02 (Median) Methylation in Control 3.09E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC30A1 in colorectal cancer [ 4 ]

Location

 Body (cg01143423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.11E+00 Statistic Test p-value:3.29E-02; Z-score:5.74E-01

Methylation in Case

 9.60E-02 (Median) Methylation in Control 8.64E-02 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg24598094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.67E+00 Statistic Test p-value:2.85E-09; Z-score:-1.61E+00

Methylation in Case

 3.18E-01 (Median) Methylation in Control 5.30E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg03763950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.13E+00 Statistic Test p-value:1.42E-04; Z-score:-5.82E-01

Methylation in Case

 5.91E-02 (Median) Methylation in Control 6.70E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in HIV infection [ 6 ]

Location

 TSS1500 (cg13976045)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:4.80E-02; Z-score:4.71E-01

Methylation in Case

 4.55E-02 (Median) Methylation in Control 4.07E-02 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in HIV infection [ 6 ]

Location

 Body (cg03763950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.17E+00 Statistic Test p-value:4.11E-03; Z-score:-5.90E-01

Methylation in Case

 8.72E-02 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in HIV infection [ 6 ]

Location

 Body (cg12405231)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:4.34E-03; Z-score:-6.57E-01

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg13976045)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.03E+00 Statistic Test p-value:1.76E-02; Z-score:2.44E-01

Methylation in Case

 9.53E-02 (Median) Methylation in Control 9.22E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg24598094)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.16E+00 Statistic Test p-value:4.93E-02; Z-score:-6.37E-01

Methylation in Case

 3.36E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in papillary thyroid cancer [ 7 ]

Location

 Body (cg03763950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:3.83E-02; Z-score:-2.24E-01

Methylation in Case

 6.82E-02 (Median) Methylation in Control 7.05E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in systemic lupus erythematosus [ 8 ]

Location

 TSS1500 (cg05152717)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:2.32E-02; Z-score:-4.67E-02

Methylation in Case

 9.35E-02 (Median) Methylation in Control 9.45E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 1stExon (cg19652869)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.60E+00 Statistic Test p-value:1.64E-17; Z-score:-2.23E+00

Methylation in Case

 4.51E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 1stExon (cg24162367)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.73E+00 Statistic Test p-value:1.24E-16; Z-score:-2.33E+00

Methylation in Case

 3.34E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon3

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg01143423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.09E+00 Statistic Test p-value:4.77E-05; Z-score:7.61E-01

Methylation in Case

 9.14E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon4

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg03763950)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.08E+00 Statistic Test p-value:4.28E-04; Z-score:9.73E-01

Methylation in Case

 8.81E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon5

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg04976746)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.09E+00 Statistic Test p-value:1.09E-03; Z-score:-6.63E-01

Methylation in Case

 7.33E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon6

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg08629942)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.10E+00 Statistic Test p-value:7.68E-03; Z-score:-6.50E-01

Methylation in Case

 6.59E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon7

 Methylation of SLC30A1 in atypical teratoid rhabdoid tumor [ 9 ]

Location

 Body (cg12405231)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.29E+00 Statistic Test p-value:2.73E-02; Z-score:-3.13E-01

Methylation in Case

 1.69E-01 (Median) Methylation in Control 2.19E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in breast cancer [ 10 ]

Location

 Body (cg12405231)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:4.31E-02; Z-score:-4.51E-02

Methylation in Case

 8.89E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in pancretic ductal adenocarcinoma [ 11 ]

Location

 Body (cg11273176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.06E+00 Statistic Test p-value:2.00E-02; Z-score:-4.60E-01

Methylation in Case

 5.71E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC30A1 in panic disorder [ 12 ]

Location

 Body (cg08629942)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:9.21E-01 Statistic Test p-value:9.56E-06; Z-score:8.58E-01

Methylation in Case

 -2.89E+00 (Median) Methylation in Control -3.14E+00 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon2

 Methylation of SLC30A1 in panic disorder [ 12 ]

Location

 Body (cg12405231)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-2.74E+00 Statistic Test p-value:1.55E-02; Z-score:-5.35E-01

Methylation in Case

 1.34E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

 Panic disorder[ ICD-11:6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          46 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 let-7b directly targets SLC30A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon2

 miR-106a directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

 AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

 miR-106b directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

 miR-1277 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

 AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

 miR-155 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

 UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

 miR-16 directly targets SLC30A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon7

 miR-17 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

 miR-186 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

 CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

 miR-187 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-187 miRNA Mature ID miR-187-5p

miRNA Sequence

 GGCUACAACACAGGACCCGGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

 miR-193b directly targets SLC30A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon11

 miR-20a directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon12

 miR-20b directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

 CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon13

 miR-3133 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3133 miRNA Mature ID miR-3133

miRNA Sequence

 UAAAGAACUCUUAAAACCCAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon14

 miR-3191 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3191 miRNA Mature ID miR-3191-5p

miRNA Sequence

 CUCUCUGGCCGUCUACCUUCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

 miR-33a directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-33a miRNA Mature ID miR-33a-5p

miRNA Sequence

 GUGCAUUGUAGUUGCAUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

 miR-33b directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-33b miRNA Mature ID miR-33b-5p

miRNA Sequence

 GUGCAUUGCUGUUGCAUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

 miR-3611 directly targets SLC30A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3611 miRNA Mature ID miR-3611

miRNA Sequence

 UUGUGAAGAAAGAAAUUCUUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

 miR-4501 directly targets SLC30A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4501 miRNA Mature ID miR-4501

miRNA Sequence

 UAUGUGACCUCGGAUGAAUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

 miR-4506 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4506 miRNA Mature ID miR-4506

miRNA Sequence

 AAAUGGGUGGUCUGAGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

 miR-4524b directly targets SLC30A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4524b miRNA Mature ID miR-4524b-3p

miRNA Sequence

 GAGACAGGUUCAUGCUGCUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

 miR-496 directly targets SLC30A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-496 miRNA Mature ID miR-496

miRNA Sequence

 UGAGUAUUACAUGGCCAAUCUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon22

 miR-497 directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-497 miRNA Mature ID miR-497-3p

miRNA Sequence

 CAAACCACACUGUGGUGUUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-511 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-511 miRNA Mature ID miR-511-5p

miRNA Sequence

 GUGUCUUUUGCUCUGCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

 miR-519a directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519a miRNA Mature ID miR-519a-3p

miRNA Sequence

 AAAGUGCAUCCUUUUAGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

 miR-519b directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519b miRNA Mature ID miR-519b-3p

miRNA Sequence

 AAAGUGCAUCCUUUUAGAGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

 miR-519c directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519c miRNA Mature ID miR-519c-3p

miRNA Sequence

 AAAGUGCAUCUUUUUAGAGGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

 miR-519d directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

 CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

 miR-526b directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

 GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon29

 miR-548aa directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon30

 miR-548ac directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ac miRNA Mature ID miR-548ac

miRNA Sequence

 CAAAAACCGGCAAUUACUUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-548ap directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ap miRNA Mature ID miR-548ap-3p

miRNA Sequence

 AAAAACCACAAUUACUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon32

 miR-548bb directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548bb miRNA Mature ID miR-548bb-3p

miRNA Sequence

 CAAAAACCAUAGUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon33

 miR-548d directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548d miRNA Mature ID miR-548d-3p

miRNA Sequence

 CAAAAACCACAGUUUCUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon34

 miR-548h directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548h miRNA Mature ID miR-548h-3p

miRNA Sequence

 CAAAAACCGCAAUUACUUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon35

 miR-548t directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon36

 miR-548z directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548z miRNA Mature ID miR-548z

miRNA Sequence

 CAAAAACCGCAAUUACUUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon37

 miR-5571 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5571 miRNA Mature ID miR-5571-5p

miRNA Sequence

 CAAUUCUCAAAGGAGCCUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon38

 miR-5692a directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5692a miRNA Mature ID miR-5692a

miRNA Sequence

 CAAAUAAUACCACAGUGGGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

 miR-615 directly targets SLC30A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

 miR-6728 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6728 miRNA Mature ID miR-6728-3p

miRNA Sequence

 UCUCUGCUCUGCUCUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

 miR-6744 directly targets SLC30A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6744 miRNA Mature ID miR-6744-5p

miRNA Sequence

 UGGAUGACAGUGGAGGCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

 miR-6776 directly targets SLC30A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6776 miRNA Mature ID miR-6776-3p

miRNA Sequence

 CAACCACCACUGUCUCUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon43

 miR-6830 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6830 miRNA Mature ID miR-6830-3p

miRNA Sequence

 UGUCUUUCUUCUCUCCCUUGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon44

 miR-7705 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7705 miRNA Mature ID miR-7705

miRNA Sequence

 AAUAGCUCAGAAUGUCAGUUCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

 miR-888 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-888 miRNA Mature ID miR-888-5p

miRNA Sequence

 UACUCAAAAAGCUGUCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

 miR-93 directly targets SLC30A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
10 Genome-wide Scan for Methylation Profiles in Breast Cancer
11 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
14 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.