Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0255 Transporter Info
Gene Name	SLC2A13
Transporter Name	Proton myo-inositol cotransporter
Gene ID	114134
UniProt ID	Q96QE2

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg02634414)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:4.82E-04; Z-score:6.97E-01
Methylation in Case	3.93E-01 (Median)	Methylation in Control	3.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg15141217)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.52E-02; Z-score:7.41E-01
Methylation in Case	7.10E-01 (Median)	Methylation in Control	6.84E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg27320127)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:7.05E-12; Z-score:1.97E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	2.61E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg19698309)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:3.62E-02; Z-score:-6.73E-01
Methylation in Case	6.59E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg07788437)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:1.84E-05; Z-score:1.34E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	6.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg24333621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.24E-03; Z-score:-6.68E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg24850535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.41E-03; Z-score:-1.05E+00
Methylation in Case	3.35E-01 (Median)	Methylation in Control	4.07E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg03479705)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.62E-03; Z-score:-3.73E-01
Methylation in Case	4.02E-01 (Median)	Methylation in Control	4.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC2A13 in pancretic ductal adenocarcinoma			[ 1 ]
Location	3'UTR (cg20558112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.71E-04; Z-score:1.29E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	6.03E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	TSS1500 (cg05581394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.72E+00	Statistic Test	p-value:4.48E-09; Z-score:-7.53E+00
Methylation in Case	4.22E-01 (Median)	Methylation in Control	7.27E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	TSS1500 (cg01603095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.70E+00	Statistic Test	p-value:6.33E-03; Z-score:-3.46E+00
Methylation in Case	1.51E-01 (Median)	Methylation in Control	2.56E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	TSS1500 (cg16219968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:4.06E-02; Z-score:-6.07E-01
Methylation in Case	4.54E-02 (Median)	Methylation in Control	4.80E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg05770947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:3.39E-08; Z-score:-1.30E+01
Methylation in Case	6.86E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg21803141)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:4.09E-08; Z-score:-6.47E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	5.86E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:5.90E-08; Z-score:-1.11E+01
Methylation in Case	7.34E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg14678680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:2.18E-06; Z-score:-1.12E+01
Methylation in Case	6.95E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg02641941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.20E+00	Statistic Test	p-value:2.63E-06; Z-score:-5.74E+00
Methylation in Case	2.79E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg16190510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.41E+00	Statistic Test	p-value:1.53E-05; Z-score:-5.09E+00
Methylation in Case	2.12E-01 (Median)	Methylation in Control	5.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg23680411)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.22E-03; Z-score:-2.33E+00
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg07287345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:5.19E-03; Z-score:-1.48E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC2A13 in bladder cancer			[ 2 ]
Location	Body (cg04626413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.10E-02; Z-score:-2.30E+00
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	TSS1500 (cg01603095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.52E+00	Statistic Test	p-value:1.71E-09; Z-score:2.62E+00
Methylation in Case	3.13E-01 (Median)	Methylation in Control	2.06E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	TSS1500 (cg05581394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:8.21E-03; Z-score:1.51E+00
Methylation in Case	6.55E-01 (Median)	Methylation in Control	5.74E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:9.05E-12; Z-score:-2.14E+00
Methylation in Case	8.05E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg14678680)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.46E-06; Z-score:1.52E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	7.15E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg21803141)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:5.47E-04; Z-score:-8.99E-01
Methylation in Case	5.88E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg05770947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.45E-03; Z-score:-4.33E-01
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg07287345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.42E-03; Z-score:-6.78E-01
Methylation in Case	8.84E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg02641941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:6.63E-03; Z-score:4.40E-01
Methylation in Case	7.61E-01 (Median)	Methylation in Control	7.32E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC2A13 in breast cancer			[ 3 ]
Location	Body (cg00790847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:7.40E-03; Z-score:-6.31E-01
Methylation in Case	8.84E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg05581394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.79E-03; Z-score:-1.56E+00
Methylation in Case	9.08E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg01603095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.38E-02; Z-score:9.37E-01
Methylation in Case	3.23E-01 (Median)	Methylation in Control	2.76E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg16219968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:4.26E-02; Z-score:-2.53E-01
Methylation in Case	1.59E-02 (Median)	Methylation in Control	1.68E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg05581394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:7.65E-10; Z-score:-2.35E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	1stExon (cg04575343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:4.06E-02; Z-score:3.97E-01
Methylation in Case	8.21E-02 (Median)	Methylation in Control	7.79E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	Body (cg05770947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.38E-06; Z-score:-1.23E+00
Methylation in Case	8.33E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	Body (cg00790847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:2.20E-05; Z-score:1.42E+00
Methylation in Case	9.30E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	Body (cg21803141)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.90E-05; Z-score:-1.42E+00
Methylation in Case	6.80E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	Body (cg02641941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:1.92E-02; Z-score:9.64E-01
Methylation in Case	6.40E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	Body (cg18785532)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:3.01E-02; Z-score:6.23E-01
Methylation in Case	9.18E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC2A13 in colorectal cancer			[ 5 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.57E-02; Z-score:-5.80E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg02371464)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.86E+00	Statistic Test	p-value:1.10E-12; Z-score:4.74E+00
Methylation in Case	3.82E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg01603095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:3.41E-04; Z-score:-7.89E-01
Methylation in Case	2.82E-01 (Median)	Methylation in Control	3.26E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg05581394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.42E-04; Z-score:-3.86E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.96E-07; Z-score:-1.02E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg02641941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.66E-05; Z-score:1.01E+00
Methylation in Case	7.76E-01 (Median)	Methylation in Control	7.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg05770947)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.06E-04; Z-score:-8.95E-01
Methylation in Case	6.82E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC2A13 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg16190510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.98E-02; Z-score:-4.72E-01
Methylation in Case	6.47E-01 (Median)	Methylation in Control	6.85E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg01603095)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:3.71E-04; Z-score:2.53E+00
Methylation in Case	4.51E-01 (Median)	Methylation in Control	3.57E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in lung adenocarcinoma			[ 7 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.37E-04; Z-score:-2.65E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in lung adenocarcinoma			[ 7 ]
Location	Body (cg16190510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:2.15E-02; Z-score:1.79E+00
Methylation in Case	7.63E-01 (Median)	Methylation in Control	6.96E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in panic disorder			[ 8 ]
Location	TSS1500 (cg05581394)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:7.09E-03; Z-score:5.11E-01
Methylation in Case	2.79E+00 (Median)	Methylation in Control	2.67E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in panic disorder			[ 8 ]
Location	Body (cg04626413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.34E+00	Statistic Test	p-value:1.15E-08; Z-score:-1.16E+00
Methylation in Case	3.78E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in panic disorder			[ 8 ]
Location	Body (cg00790847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:9.68E-03; Z-score:6.35E-01
Methylation in Case	2.83E+00 (Median)	Methylation in Control	2.68E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg16219968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.41E+00	Statistic Test	p-value:4.77E-04; Z-score:-1.43E+00
Methylation in Case	5.60E-02 (Median)	Methylation in Control	7.91E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg25307593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:1.89E-05; Z-score:-5.48E-01
Methylation in Case	4.24E-02 (Median)	Methylation in Control	5.15E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in papillary thyroid cancer			[ 9 ]
Location	Body (cg14061497)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.70E-07; Z-score:-8.82E-01
Methylation in Case	9.35E-01 (Median)	Methylation in Control	9.46E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC2A13 in papillary thyroid cancer			[ 9 ]
Location	Body (cg04626413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:8.72E-03; Z-score:-3.95E-01
Methylation in Case	9.38E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC2A13 in papillary thyroid cancer			[ 9 ]
Location	Body (cg02641941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.08E-02; Z-score:-4.10E-01
Methylation in Case	7.64E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in colon adenocarcinoma			[ 10 ]
Location	Body (cg04804543)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:3.16E-04; Z-score:-3.52E+00
Methylation in Case	6.44E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in colon adenocarcinoma			[ 10 ]
Location	Body (cg21491340)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.10E-03; Z-score:-4.44E+00
Methylation in Case	9.21E-01 (Median)	Methylation in Control	9.65E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Prostate cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC2A13 in prostate cancer			[ 11 ]
Location	Body (cg15999077)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:1.74E-02; Z-score:-2.25E+00
Methylation in Case	6.48E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC2A13 in prostate cancer			[ 11 ]
Location	Body (cg15089806)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:3.16E-02; Z-score:1.58E+00
Methylation in Case	8.52E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC2A13 in prostate cancer			[ 11 ]
Location	3'UTR (cg17442852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:9.19E-04; Z-score:3.95E+00
Methylation in Case	8.32E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1207 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1207	miRNA Mature ID	miR-1207-5p
miRNA Sequence	UGGCAGGGAGGCUGGGAGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-1910 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1910	miRNA Mature ID	miR-1910-3p
miRNA Sequence	GAGGCAGAAGCAGGAUGACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-2682 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2682	miRNA Mature ID	miR-2682-5p
miRNA Sequence	CAGGCAGUGACUGUUCAGACGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-335 directly targets SLC2A13			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-34b directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-34b	miRNA Mature ID	miR-34b-5p
miRNA Sequence	UAGGCAGUGUCAUUAGCUGAUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-381 directly targets SLC2A13			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-381	miRNA Mature ID	miR-381-3p
miRNA Sequence	UAUACAAGGGCAAGCUCUCUGU
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	miR-4270 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4270	miRNA Mature ID	miR-4270
miRNA Sequence	UCAGGGAGUCAGGGGAGGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-4441 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4441	miRNA Mature ID	miR-4441
miRNA Sequence	ACAGGGAGGAGAUUGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-449c directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-449c	miRNA Mature ID	miR-449c-5p
miRNA Sequence	UAGGCAGUGUAUUGCUAGCGGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-4705 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4705	miRNA Mature ID	miR-4705
miRNA Sequence	UCAAUCACUUGGUAAUUGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-4763 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4763	miRNA Mature ID	miR-4763-3p
miRNA Sequence	AGGCAGGGGCUGGUGCUGGGCGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-6511a directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6511a	miRNA Mature ID	miR-6511a-5p
miRNA Sequence	CAGGCAGAAGUGGGGCUGACAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-6754 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6754	miRNA Mature ID	miR-6754-5p
miRNA Sequence	CCAGGGAGGCUGGUUUGGAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-6808 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6808	miRNA Mature ID	miR-6808-5p
miRNA Sequence	CAGGCAGGGAGGUGGGACCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-6826 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6826	miRNA Mature ID	miR-6826-5p
miRNA Sequence	UCAAUAGGAAAGAGGUGGGACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-6893 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6893	miRNA Mature ID	miR-6893-5p
miRNA Sequence	CAGGCAGGUGUAGGGUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-940 directly targets SLC2A13			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-940	miRNA Mature ID	miR-940
miRNA Sequence	AAGGCAGGGCCCCCGCUCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
13	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
14	Epigenetic regulation of the DLK1-MEG3 microRNA cluster in human type 2 diabetic islets. Cell Metab. 2014 Jan 7;19(1):135-45.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence