General Information of Drug Transporter (DT)
DT ID DTD0251 Transporter Info
Gene Name SLC2A1
Transporter Name Glucose transporter type 1, erythrocyte/brain
Gene ID
6513
UniProt ID
P11166
Epigenetic Regulations of This DT (EGR)

Methylation

  Depression

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC2A1 in depressive disorder [ 1 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

Down regulation ofSLC2A1 Experiment Method RT-qPCR

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

Additional Notes

The methylation level of the GLUT1 significantly increased in depressed inpatients compared to healthy comparison subjects.

  Epigenetic Phenomenon2

Methylation of SLC2A1 in depression [ 13 ]

Location

Body (cg03128534)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.38E-02; Z-score:-2.72E-01

Methylation in Case

3.45E-02 (Median) Methylation in Control 3.67E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Colon cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

5'UTR (cg05663573)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.12E+00 Statistic Test p-value:3.57E-08; Z-score:3.98E+00

Methylation in Case

5.40E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

5'UTR (cg11964564)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.75E+00 Statistic Test p-value:3.76E-03; Z-score:1.85E+00

Methylation in Case

3.34E-01 (Median) Methylation in Control 1.91E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

TSS1500 (cg00095976)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.51E+00 Statistic Test p-value:6.47E-06; Z-score:8.00E+00

Methylation in Case

3.95E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

TSS1500 (cg11455040)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.73E-03; Z-score:-1.03E+00

Methylation in Case

1.17E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

TSS200 (cg09410234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.17E+00 Statistic Test p-value:2.13E-09; Z-score:2.91E+00

Methylation in Case

5.49E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

TSS200 (cg09408768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:1.28E-03; Z-score:2.79E+00

Methylation in Case

2.81E-01 (Median) Methylation in Control 1.93E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

Body (cg23491790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.84E-09; Z-score:2.32E+00

Methylation in Case

9.09E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

Body (cg01372572)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:1.38E-06; Z-score:-3.43E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

Body (cg13915754)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.66E+00 Statistic Test p-value:2.07E-06; Z-score:3.86E+00

Methylation in Case

4.56E-01 (Median) Methylation in Control 1.71E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in colon adenocarcinoma [ 2 ]

Location

Body (cg11015241)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.36E-05; Z-score:-3.98E+00

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         23 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

5'UTR (cg03256780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:1.65E-12; Z-score:-1.52E+00

Methylation in Case

1.52E-01 (Median) Methylation in Control 2.35E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg19779211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.23E+00 Statistic Test p-value:1.93E-19; Z-score:7.00E+00

Methylation in Case

5.41E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg21575465)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:3.44E-10; Z-score:-2.61E+00

Methylation in Case

6.09E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg09824328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.17E-03; Z-score:5.13E-01

Methylation in Case

1.47E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

TSS200 (cg02772823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:4.81E-12; Z-score:-2.15E+00

Methylation in Case

3.01E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

TSS200 (cg01907688)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.07E-02; Z-score:1.70E-02

Methylation in Case

3.77E-02 (Median) Methylation in Control 3.74E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

TSS200 (cg26681016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.78E-02; Z-score:2.43E-01

Methylation in Case

6.51E-02 (Median) Methylation in Control 6.05E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg23221540)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.80E-21; Z-score:2.24E+00

Methylation in Case

8.40E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg22198397)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:1.40E-20; Z-score:-4.21E+00

Methylation in Case

4.18E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg13492826)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:2.44E-18; Z-score:-3.38E+00

Methylation in Case

4.59E-01 (Median) Methylation in Control 6.58E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg20698037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:6.23E-18; Z-score:-1.27E+01

Methylation in Case

5.79E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg06228648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:3.67E-12; Z-score:-2.83E+00

Methylation in Case

5.91E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg04287330)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.98E+00 Statistic Test p-value:8.25E-06; Z-score:1.65E+00

Methylation in Case

2.14E-01 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg20294984)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.82E-05; Z-score:-7.92E-01

Methylation in Case

8.76E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg22025263)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:5.19E-05; Z-score:-2.18E+00

Methylation in Case

8.27E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.81E-04; Z-score:-8.87E-01

Methylation in Case

6.88E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg21474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.31E-04; Z-score:-6.92E-01

Methylation in Case

8.14E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.06E-03; Z-score:5.48E-01

Methylation in Case

5.07E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg16738646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.63E-03; Z-score:1.11E+00

Methylation in Case

6.43E-01 (Median) Methylation in Control 5.80E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg26188818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:7.37E-03; Z-score:3.41E-01

Methylation in Case

1.37E-01 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.26E-02; Z-score:2.29E-01

Methylation in Case

7.88E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

Body (cg21877974)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.70E-02; Z-score:1.09E-01

Methylation in Case

2.19E-02 (Median) Methylation in Control 2.07E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC2A1 in hepatocellular carcinoma [ 3 ]

Location

3'UTR (cg26185836)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:5.89E-07; Z-score:-2.69E+00

Methylation in Case

8.11E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

5'UTR (cg14686012)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.87E+00 Statistic Test p-value:2.08E-32; Z-score:9.96E+00

Methylation in Case

2.64E-01 (Median) Methylation in Control 9.19E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg03929977)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.05E+00 Statistic Test p-value:3.00E-30; Z-score:4.94E+00

Methylation in Case

3.77E-01 (Median) Methylation in Control 9.32E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg19065831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.23E+00 Statistic Test p-value:1.50E-23; Z-score:4.24E+00

Methylation in Case

3.58E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg26001902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.52E+00 Statistic Test p-value:4.84E-03; Z-score:5.31E-01

Methylation in Case

1.75E-01 (Median) Methylation in Control 1.15E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg25725890)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.94E-02; Z-score:-5.49E-02

Methylation in Case

9.36E-02 (Median) Methylation in Control 9.45E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

1stExon (cg17793621)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.83E+00 Statistic Test p-value:1.80E-08; Z-score:2.13E+00

Methylation in Case

3.75E-01 (Median) Methylation in Control 2.05E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg10017105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.07E-03; Z-score:9.22E-01

Methylation in Case

7.35E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg23048399)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.11E-02; Z-score:-1.28E+00

Methylation in Case

1.96E-01 (Median) Methylation in Control 2.50E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg00757413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:1.54E-02; Z-score:-4.58E-01

Methylation in Case

9.04E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg10246871)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.11E-02; Z-score:7.70E-01

Methylation in Case

8.29E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg14463790)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.50E-02; Z-score:7.17E-01

Methylation in Case

7.15E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in pancretic ductal adenocarcinoma [ 4 ]

Location

3'UTR (cg02367856)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.76E-02; Z-score:1.08E+00

Methylation in Case

7.57E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

5'UTR (cg04682775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:1.33E-03; Z-score:-4.77E+00

Methylation in Case

3.92E-01 (Median) Methylation in Control 5.61E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

5'UTR (cg17723122)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.75E+00 Statistic Test p-value:3.90E-03; Z-score:-3.33E+00

Methylation in Case

2.61E-01 (Median) Methylation in Control 4.59E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

TSS1500 (cg13980799)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.56E+00 Statistic Test p-value:1.04E-02; Z-score:2.54E+00

Methylation in Case

8.19E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

Body (cg10246871)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.21E-03; Z-score:2.83E+00

Methylation in Case

9.25E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

Body (cg04486885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:4.46E-03; Z-score:2.55E+00

Methylation in Case

7.89E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.19E-02; Z-score:2.60E+00

Methylation in Case

9.15E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

Body (cg17409393)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:1.63E-02; Z-score:2.45E+00

Methylation in Case

8.65E-02 (Median) Methylation in Control 5.95E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

Body (cg15572436)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.55E+00 Statistic Test p-value:2.52E-02; Z-score:4.06E+00

Methylation in Case

6.22E-01 (Median) Methylation in Control 4.02E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in prostate cancer [ 5 ]

Location

Body (cg03861217)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.31E-02; Z-score:1.28E+00

Methylation in Case

8.81E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

TSS1500 (cg12101479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.38E-06; Z-score:-1.50E+01

Methylation in Case

7.74E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.13E+00 Statistic Test p-value:1.33E-11; Z-score:-1.08E+01

Methylation in Case

2.27E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.96E+00 Statistic Test p-value:8.42E-10; Z-score:-1.20E+01

Methylation in Case

3.88E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg16738646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.01E+00 Statistic Test p-value:1.31E-08; Z-score:-7.77E+00

Methylation in Case

1.87E-01 (Median) Methylation in Control 5.64E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.84E+00 Statistic Test p-value:7.54E-08; Z-score:-7.61E+00

Methylation in Case

1.93E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.28E+00 Statistic Test p-value:1.16E-07; Z-score:-7.49E+00

Methylation in Case

1.98E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg15089806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:5.83E-07; Z-score:-5.52E+00

Methylation in Case

4.20E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg09502149)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.49E+00 Statistic Test p-value:1.40E-06; Z-score:-6.14E+00

Methylation in Case

1.76E-01 (Median) Methylation in Control 4.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:1.72E-05; Z-score:-4.66E+00

Methylation in Case

2.68E-01 (Median) Methylation in Control 4.16E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg22025263)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.57E-03; Z-score:-2.43E+00

Methylation in Case

6.72E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg21474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.67E-03; Z-score:-2.10E+00

Methylation in Case

7.39E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:4.39E-03; Z-score:-2.34E+00

Methylation in Case

3.72E-01 (Median) Methylation in Control 4.61E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:5.08E-03; Z-score:-1.87E+00

Methylation in Case

7.59E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

Body (cg26188818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.18E-02; Z-score:-1.21E+00

Methylation in Case

7.68E-02 (Median) Methylation in Control 8.69E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC2A1 in bladder cancer [ 6 ]

Location

3'UTR (cg26185836)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.51E-03; Z-score:-2.90E+00

Methylation in Case

7.26E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         19 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

TSS1500 (cg12656391)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:9.24E-08; Z-score:1.87E+00

Methylation in Case

9.54E-02 (Median) Methylation in Control 6.54E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

TSS1500 (cg12101479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.32E-07; Z-score:-1.46E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

TSS1500 (cg09824328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.79E+00 Statistic Test p-value:5.98E-03; Z-score:6.01E-01

Methylation in Case

8.83E-02 (Median) Methylation in Control 4.93E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

TSS1500 (cg00102166)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:4.96E-02; Z-score:3.59E-01

Methylation in Case

1.55E-01 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:3.67E-20; Z-score:-2.55E+00

Methylation in Case

3.86E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:1.36E-19; Z-score:-3.48E+00

Methylation in Case

5.81E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:3.53E-19; Z-score:-2.87E+00

Methylation in Case

4.00E-01 (Median) Methylation in Control 6.38E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg16738646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:5.53E-14; Z-score:-1.86E+00

Methylation in Case

3.82E-01 (Median) Methylation in Control 5.07E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:2.34E-13; Z-score:-2.06E+00

Methylation in Case

4.54E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:5.02E-12; Z-score:-2.82E+00

Methylation in Case

5.33E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg15089806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.06E-10; Z-score:-1.74E+00

Methylation in Case

5.56E-01 (Median) Methylation in Control 6.60E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:2.00E-08; Z-score:-2.40E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg21474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.92E-08; Z-score:-1.48E+00

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.03E-05; Z-score:-1.29E+00

Methylation in Case

4.76E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg04287330)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.65E-02; Z-score:-3.45E-01

Methylation in Case

4.04E-02 (Median) Methylation in Control 4.49E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg26188818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.81E-02; Z-score:-3.53E-01

Methylation in Case

6.61E-02 (Median) Methylation in Control 7.31E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg07499643)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:3.63E-02; Z-score:7.08E-01

Methylation in Case

1.71E-02 (Median) Methylation in Control 1.28E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg03128534)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.18E-02; Z-score:2.44E-01

Methylation in Case

1.16E-02 (Median) Methylation in Control 1.04E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC2A1 in breast cancer [ 7 ]

Location

Body (cg22025263)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.42E-02; Z-score:8.69E-02

Methylation in Case

7.45E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

TSS1500 (cg12101479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.86E-06; Z-score:-3.15E+00

Methylation in Case

8.81E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

TSS1500 (cg12656391)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.74E+00 Statistic Test p-value:8.52E-06; Z-score:1.82E+00

Methylation in Case

4.81E-02 (Median) Methylation in Control 2.76E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

TSS1500 (cg09824328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:6.05E-05; Z-score:1.60E+00

Methylation in Case

4.84E-02 (Median) Methylation in Control 3.75E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

TSS1500 (cg00102166)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.62E-02; Z-score:4.60E-01

Methylation in Case

9.74E-02 (Median) Methylation in Control 7.96E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

TSS200 (cg06792911)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:8.52E-03; Z-score:4.06E-01

Methylation in Case

1.08E-02 (Median) Methylation in Control 9.86E-03 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:4.10E-14; Z-score:-7.83E+00

Methylation in Case

5.97E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:3.61E-13; Z-score:-6.35E+00

Methylation in Case

4.92E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.12E-10; Z-score:-4.05E+00

Methylation in Case

5.84E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg04287330)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.46E+00 Statistic Test p-value:1.13E-06; Z-score:-9.92E-01

Methylation in Case

1.37E-02 (Median) Methylation in Control 2.00E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg07499643)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.88E-02; Z-score:3.99E-01

Methylation in Case

1.57E-02 (Median) Methylation in Control 1.50E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in clear cell renal cell carcinoma [ 8 ]

Location

Body (cg21877974)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.52E-02; Z-score:1.62E-01

Methylation in Case

1.52E-02 (Median) Methylation in Control 1.50E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

TSS1500 (cg00102166)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:8.84E-04; Z-score:4.79E-01

Methylation in Case

2.80E-01 (Median) Methylation in Control 2.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

TSS1500 (cg09824328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.73E-03; Z-score:1.95E-01

Methylation in Case

1.12E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

TSS1500 (cg12656391)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.81E-02; Z-score:5.17E-01

Methylation in Case

1.63E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

TSS1500 (cg12101479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.87E-02; Z-score:3.04E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

TSS200 (cg26681016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.84E-03; Z-score:9.23E-01

Methylation in Case

6.73E-02 (Median) Methylation in Control 6.14E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg09502149)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:1.22E-09; Z-score:-2.15E+00

Methylation in Case

4.93E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:5.32E-09; Z-score:-2.30E+00

Methylation in Case

8.28E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:4.31E-07; Z-score:-2.29E+00

Methylation in Case

7.81E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.08E-05; Z-score:-1.18E+00

Methylation in Case

5.69E-01 (Median) Methylation in Control 6.72E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.48E-04; Z-score:-6.75E-01

Methylation in Case

6.14E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.77E-04; Z-score:-7.29E-01

Methylation in Case

5.49E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg20294984)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.62E-03; Z-score:-4.85E-01

Methylation in Case

9.44E-01 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg21474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:7.42E-03; Z-score:-7.66E-01

Methylation in Case

9.03E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg05345039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.26E-02; Z-score:-7.05E-01

Methylation in Case

9.31E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

Body (cg03128534)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:4.27E-02; Z-score:-3.65E-01

Methylation in Case

2.75E-02 (Median) Methylation in Control 3.23E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC2A1 in colorectal cancer [ 9 ]

Location

3'UTR (cg26185836)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.33E-02; Z-score:-6.29E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Hypomethylation of SLC2A1 in colorectal cancer [ 23 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Reduced representation bisulfite sequencing

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

Additional Notes

Lower level methylation of SLC2A1 in colorectal cancer.

  HIV infection

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

TSS1500 (cg12656391)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:7.14E-06; Z-score:1.33E+00

Methylation in Case

2.27E-01 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

TSS1500 (cg09824328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.62E+00 Statistic Test p-value:4.75E-04; Z-score:1.36E+00

Methylation in Case

3.14E-01 (Median) Methylation in Control 1.93E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

TSS1500 (cg00102166)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:8.60E-04; Z-score:9.06E-01

Methylation in Case

3.09E-01 (Median) Methylation in Control 2.31E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

TSS200 (cg06792911)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:5.40E-04; Z-score:1.31E+00

Methylation in Case

5.67E-02 (Median) Methylation in Control 4.32E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:3.62E-13; Z-score:-2.26E+00

Methylation in Case

1.31E-01 (Median) Methylation in Control 1.91E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg15089806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:3.69E-09; Z-score:-3.10E+00

Methylation in Case

5.20E-01 (Median) Methylation in Control 6.58E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:5.92E-07; Z-score:-2.79E+00

Methylation in Case

6.89E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg16738646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.58E+00 Statistic Test p-value:6.17E-07; Z-score:1.99E+00

Methylation in Case

3.97E-01 (Median) Methylation in Control 2.51E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:7.71E-07; Z-score:-2.95E+00

Methylation in Case

6.62E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.45E-06; Z-score:-2.77E+00

Methylation in Case

7.23E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:4.45E-05; Z-score:-1.21E+00

Methylation in Case

5.40E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.71E-04; Z-score:-1.19E+00

Methylation in Case

1.74E-01 (Median) Methylation in Control 2.13E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg21474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.69E-04; Z-score:-1.13E+00

Methylation in Case

8.97E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg09502149)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.71E-03; Z-score:-9.37E-01

Methylation in Case

4.89E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:8.03E-03; Z-score:-8.41E-01

Methylation in Case

6.54E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC2A1 in HIV infection [ 10 ]

Location

Body (cg05345039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.59E-02; Z-score:4.97E-01

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in systemic lupus erythematosus [ 11 ]

Location

TSS1500 (cg09824328)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:6.10E-03; Z-score:2.89E-01

Methylation in Case

2.12E-01 (Median) Methylation in Control 1.84E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg04287330)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.37E-03; Z-score:-1.65E-01

Methylation in Case

5.33E-02 (Median) Methylation in Control 5.52E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.60E-03; Z-score:-2.21E-01

Methylation in Case

7.65E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.13E-02; Z-score:-1.10E-01

Methylation in Case

2.66E-01 (Median) Methylation in Control 2.75E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in systemic lupus erythematosus [ 11 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.57E-02; Z-score:-1.21E-01

Methylation in Case

5.62E-01 (Median) Methylation in Control 5.75E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.66E-05; Z-score:1.27E+00

Methylation in Case

8.16E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:1.04E-04; Z-score:1.24E+00

Methylation in Case

3.74E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg03128534)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:2.53E-04; Z-score:-9.70E-01

Methylation in Case

6.80E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04287330)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:6.58E-04; Z-score:-9.07E-01

Methylation in Case

4.83E-01 (Median) Methylation in Control 6.16E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.18E-03; Z-score:5.54E-01

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05345039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.38E-03; Z-score:-8.15E-01

Methylation in Case

3.29E-01 (Median) Methylation in Control 4.36E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:1.66E-03; Z-score:-1.07E+00

Methylation in Case

2.94E-01 (Median) Methylation in Control 3.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:1.94E-03; Z-score:6.20E-01

Methylation in Case

7.57E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.88E+00 Statistic Test p-value:2.23E-03; Z-score:-5.24E-01

Methylation in Case

6.97E-02 (Median) Methylation in Control 1.31E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07499643)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:4.03E-03; Z-score:1.04E+00

Methylation in Case

6.72E-01 (Median) Methylation in Control 5.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07803811)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.51E+00 Statistic Test p-value:4.97E-03; Z-score:-7.21E-01

Methylation in Case

1.21E-01 (Median) Methylation in Control 1.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg09502149)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.08E-02; Z-score:7.48E-01

Methylation in Case

7.78E-01 (Median) Methylation in Control 6.88E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg26185836)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:2.61E-09; Z-score:1.42E+00

Methylation in Case

2.81E-01 (Median) Methylation in Control 2.11E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg15089806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:4.60E-04; Z-score:-2.29E+00

Methylation in Case

6.48E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg04287330)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.68E+00 Statistic Test p-value:1.84E-03; Z-score:-1.82E+00

Methylation in Case

8.63E-02 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.15E-03; Z-score:-1.60E+00

Methylation in Case

4.21E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg26188818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.76E-03; Z-score:-1.60E+00

Methylation in Case

1.18E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg05034603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:3.91E-03; Z-score:-3.10E+00

Methylation in Case

4.55E-01 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:4.52E-03; Z-score:-1.80E+00

Methylation in Case

6.80E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.28E-02; Z-score:-8.67E-01

Methylation in Case

7.55E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:2.54E-02; Z-score:-1.49E+00

Methylation in Case

6.28E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:2.65E-02; Z-score:-9.67E-01

Methylation in Case

7.27E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in lung adenocarcinoma [ 14 ]

Location

Body (cg16738646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:4.24E-02; Z-score:-1.08E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 5.56E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in panic disorder [ 15 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.81E-04; Z-score:5.70E-01

Methylation in Case

2.41E+00 (Median) Methylation in Control 2.18E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in panic disorder [ 15 ]

Location

Body (cg22025263)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:8.15E-03; Z-score:3.51E-01

Methylation in Case

3.34E+00 (Median) Methylation in Control 3.23E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in panic disorder [ 15 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:8.71E-03; Z-score:4.30E-01

Methylation in Case

2.29E+00 (Median) Methylation in Control 2.10E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in panic disorder [ 15 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:1.17E-02; Z-score:3.76E-01

Methylation in Case

8.04E-01 (Median) Methylation in Control 6.52E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in panic disorder [ 15 ]

Location

Body (cg15089806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.09E-02; Z-score:1.54E-01

Methylation in Case

7.17E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg06094523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:3.06E-18; Z-score:-2.13E+00

Methylation in Case

3.88E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg09502149)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.83E+00 Statistic Test p-value:1.62E-16; Z-score:-2.36E+00

Methylation in Case

2.19E-01 (Median) Methylation in Control 4.01E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg15089806)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:7.70E-12; Z-score:-2.12E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 5.06E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg01924561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.07E-10; Z-score:-1.74E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg05942022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:8.37E-10; Z-score:-1.74E+00

Methylation in Case

7.67E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg05345039)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.22E-07; Z-score:1.16E+00

Methylation in Case

9.54E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg20282814)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.58E-07; Z-score:-1.50E+00

Methylation in Case

8.67E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg20294984)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:8.31E-06; Z-score:8.52E-01

Methylation in Case

9.19E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg05802386)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:4.21E-05; Z-score:-8.49E-01

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg16738646)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:4.65E-04; Z-score:-1.08E+00

Methylation in Case

2.52E-01 (Median) Methylation in Control 3.18E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg00737593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.55E-02; Z-score:-3.46E-01

Methylation in Case

9.11E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC2A1 in papillary thyroid cancer [ 16 ]

Location

Body (cg22025263)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.68E-02; Z-score:5.57E-01

Methylation in Case

8.30E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

Histone acetylation

  Mice brain

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hyperacetylation of SLC2A1 in fasted mice brain (compare with normal counterpart cells) [ 17 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation ofSLC2A1 Experiment Method RT-qPCR

Studied Phenotype

Mice brain

Experimental Material

Model organism in vivo (mouse)

Additional Notes

Fasting-induced production of the ketone body -hydroxybutyrate (-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification.

  Rat brain astrocyte

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypoacetylation of SLC2A1 in rat brain astrocytes (compare with valproic acid treatment counterpart cells) [ 18 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Down regulation ofSLC2A1 Experiment Method RT-qPCR

Studied Phenotype

Rat brain astrocyte

Experimental Material

Model organism in vivo (mouse)

Additional Notes

Valproic acid could increase SLC2A1 gene expression by increasing histone acetylation at the SLC2A1 promotor.

Histone trimethylation

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower level of histone trimethylation of SLC2A1 in colon cancer (compare with counterpart JMJD2B knockdown cells) [ 19 ]

Location

Promoter

Epigenetic Type

Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Down regulation ofSLC2A1 Experiment Method RT-qPCR

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Multiple cell lines of human

Additional Notes

Knockdown of JMJD2B after glucose deprivation caused decreased level of GLUT1 through increasing H3K9 tri-methylation levels on its promoter.

microRNA

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-1291 in renal cell carcinoma (compare with adjacent normal tissue) [ 20 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC2A1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-1291 miRNA Mature ID miR-1291

miRNA Sequence

UGGCCCUGACUGAAGACCAGCAGU

miRNA Target Type

Direct

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

Additional Notes

miR-1291 was down-regulated in renal cell carcinoma and regulated SLC2A1 expression via binding to the SLC2A1 mRNA.

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-132 in prostate cancer (compare with adjacent normal tissue) [ 21 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC2A1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-132 miRNA Mature ID miR-132-3p

miRNA Sequence

UAACAGUCUACAGCCAUGGUCG

miRNA Target Type

Direct

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Multiple cell lines of human

Additional Notes

miR-132 was down-regulated in prostate cancer and regulated SLC2A1 expression via binding to the SLC2A1 mRNA.

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-148b in gastric cancer (compare with adjacent normal tissue) [ 22 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC2A1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-148b miRNA Mature ID Unclear

miRNA Target Type

Direct

Studied Phenotype

Gastric cancer[ ICD-11:2B72]

Experimental Material

Patient tissue samples

Additional Notes

miR-148b was down-regulated in gastric cancer and regulated SLC2A1 expression via binding to the SLC2A1 mRNA.

  Unclear Phenotype

         46 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1200 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1200 miRNA Mature ID miR-1200

miRNA Sequence

CUCCUGAGCCAUUCUGAGCCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1225 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1225 miRNA Mature ID miR-1225-3p

miRNA Sequence

UGAGCCCCUGUGCCGCCCCCAG

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon3

miR-1262 directly targets SLC2A1 [ 26 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-1262 miRNA Mature ID miR-1262

miRNA Sequence

AUGGGUGAAUUUGUAGAAGGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-1291 directly targets SLC2A1 [ 20 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

miR-1291 miRNA Mature ID miR-1291

miRNA Sequence

UGGCCCUGACUGAAGACCAGCAGU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

miR-1296 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1296 miRNA Mature ID miR-1296-5p

miRNA Sequence

UUAGGGCCCUGGCUCCAUCUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-132 directly targets SLC2A1 [ 21 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

miR-132 miRNA Mature ID miR-132-3p

miRNA Sequence

UAACAGUCUACAGCCAUGGUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-148b directly targets SLC2A1 [ 22 ]

Epigenetic Type

microRNA Experiment Method Immunohistochemistry//In situ hybridization//Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

miR-149 directly targets SLC2A1 [ 26 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-149 miRNA Mature ID miR-149-5p

miRNA Sequence

UCUGGCUCCGUGUCUUCACUCCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-1538 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1538 miRNA Mature ID miR-1538

miRNA Sequence

CGGCCCGGGCUGCUGCUGUUCCU

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon10

miR-1914 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1914 miRNA Mature ID miR-1914-5p

miRNA Sequence

CCCUGUGCCCGGCCCACUUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-214 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-214 miRNA Mature ID miR-214-5p

miRNA Sequence

UGCCUGUCUACACUUGCUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-2909 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2909 miRNA Mature ID miR-2909

miRNA Sequence

GUUAGGGCCAACAUCUCUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-3064 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3064 miRNA Mature ID miR-3064-5p

miRNA Sequence

UCUGGCUGUUGUGGUGUGCAA

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon14

miR-3135b directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon15

miR-3184 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3184 miRNA Mature ID miR-3184-3p

miRNA Sequence

AAAGUCUCGCUCUCUGCCCCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-324 directly targets SLC2A1 [ 26 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-324 miRNA Mature ID miR-324-3p

miRNA Sequence

CCCACUGCCCCAGGUGCUGCUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-3652 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

CGGCUGGAGGUGUGAGGA

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon18

miR-4267 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4267 miRNA Mature ID miR-4267

miRNA Sequence

UCCAGCUCGGUGGCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4268 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4268 miRNA Mature ID miR-4268

miRNA Sequence

GGCUCCUCCUCUCAGGAUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4323 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4323 miRNA Mature ID miR-4323

miRNA Sequence

CAGCCCCACAGCCUCAGA

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon21

miR-4324 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4324 miRNA Mature ID miR-4324

miRNA Sequence

CCCUGAGACCCUAACCUUAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-4430 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

AGGCUGGAGUGAGCGGAG

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon23

miR-4434 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4434 miRNA Mature ID miR-4434

miRNA Sequence

AGGAGAAGUAAAGUAGAA

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon24

miR-4448 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4448 miRNA Mature ID miR-4448

miRNA Sequence

GGCUCCUUGGUCUAGGGGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-4505 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4505 miRNA Mature ID miR-4505

miRNA Sequence

AGGCUGGGCUGGGACGGA

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon26

miR-4516 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4516 miRNA Mature ID miR-4516

miRNA Sequence

GGGAGAAGGGUCGGGGC

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon27

miR-4531 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4531 miRNA Mature ID miR-4531

miRNA Sequence

AUGGAGAAGGCUUCUGA

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon28

miR-4638 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4638 miRNA Mature ID miR-4638-5p

miRNA Sequence

ACUCGGCUGCGGUGGACAAGU

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon29

miR-4745 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4745 miRNA Mature ID miR-4745-3p

miRNA Sequence

UGGCCCGGCGACGUCUCACGGUC

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon30

miR-4747 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4747 miRNA Mature ID miR-4747-3p

miRNA Sequence

AAGGCCCGGGCUUUCCUCCCAG

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon31

miR-484 directly targets SLC2A1 [ 26 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-484 miRNA Mature ID miR-484

miRNA Sequence

UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-5008 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5008 miRNA Mature ID miR-5008-3p

miRNA Sequence

CCUGUGCUCCCAGGGCCUCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-544b directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-544b miRNA Mature ID miR-544b

miRNA Sequence

ACCUGAGGUUGUGCAUUUCUAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-5586 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5586 miRNA Mature ID miR-5586-5p

miRNA Sequence

UAUCCAGCUUGUUACUAUAUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-5703 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5703 miRNA Mature ID miR-5703

miRNA Sequence

AGGAGAAGUCGGGAAGGU

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon36

miR-5787 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5787 miRNA Mature ID miR-5787

miRNA Sequence

GGGCUGGGGCGCGGGGAGGU

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon37

miR-6504 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6504 miRNA Mature ID miR-6504-5p

miRNA Sequence

UCUGGCUGUGCUGUAAUGCAG

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon38

miR-6514 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6514 miRNA Mature ID miR-6514-3p

miRNA Sequence

CUGCCUGUUCUUCCACUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6737 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6737 miRNA Mature ID miR-6737-3p

miRNA Sequence

UCUGUGCUUCACCCCUACCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-6761 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6761 miRNA Mature ID miR-6761-5p

miRNA Sequence

UCUGAGAGAGCUCGAUGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-6772 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6772 miRNA Mature ID miR-6772-3p

miRNA Sequence

UUGCUCCUGACUCUGUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-6811 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6811 miRNA Mature ID miR-6811-3p

miRNA Sequence

AGCCUGUGCUUGUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-6842 directly targets SLC2A1 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6842 miRNA Mature ID miR-6842-3p

miRNA Sequence

UUGGCUGGUCUCUGCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon44

miR-6870 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6870 miRNA Mature ID miR-6870-3p

miRNA Sequence

GCUCAUCCCCAUCUCCUUUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-6882 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6882 miRNA Mature ID miR-6882-3p

miRNA Sequence

UGCUGCCUCUCCUCUUGCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-7157 directly targets SLC2A1 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7157 miRNA Mature ID miR-7157-3p

miRNA Sequence

UCUGUGCUACUGGAUGAAGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Altered DNA methylation of glucose transporter 1 and glucose transporter 4 in patients with major depressive disorder. J Psychiatr Res. 2016 May;76:66-73.
2 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
6 DNA Methylation Dynamics in Urological Tumors.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
17 Epigenetic regulation of the glucose transporter gene Slc2a1 by beta-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice. Genes Cells. 2017 Jan;22(1):71-83.
18 Valproic acid enhances glucose transport in the cultured brain astrocytes of glucose transporter 1 heterozygous mice. J Child Neurol. 2013 Jan;28(1):70-6.
19 Role of JMJD2B in colon cancer cell survival under glucose-deprived conditions and the underlying mechanisms. Oncogene. 2018 Jan 18;37(3):389-402.
20 Tumor-suppressive microRNA-1291 directly regulates glucose transporter 1 in renal cell carcinoma. Cancer Sci. 2013 Nov;104(11):1411-9.
21 miR-132 mediates a metabolic shift in prostate cancer cells by targeting Glut1. FEBS Open Bio. 2016 Jun 8;6(7):735-41.
22 miR-148b inhibits glycolysis in gastric cancer through targeting SLC2A1. Cancer Med. 2017 Jun;6(6):1301-1310.
23 Genome wide DNA differential methylation regions in colorectal cancer patients in relation to blood related family members, obese and non-obese controls - a preliminary report. Oncotarget. 2018 May 22;9(39):25557-25571.
24 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
25 Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
26 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.