Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0237 Transporter Info | ||||
Gene Name | SLC26A9 | ||||
Transporter Name | Anion transporter/exchanger protein 9 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
44 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-1321 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1321 | miRNA Mature ID | miR-1321 | ||
miRNA Sequence |
CAGGGAGGUGAAUGUGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-185 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-5p | ||
miRNA Sequence |
UGGAGAGAAAGGCAGUUCCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-302b directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302b | miRNA Mature ID | miR-302b-5p | ||
miRNA Sequence |
ACUUUAACAUGGAAGUGCUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon4 |
miR-302d directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-302d | miRNA Mature ID | miR-302d-5p | ||
miRNA Sequence |
ACUUUAACAUGGAGGCACUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-3065 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3065 | miRNA Mature ID | miR-3065-3p | ||
miRNA Sequence |
UCAGCACCAGGAUAUUGUUGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-3125 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3125 | miRNA Mature ID | miR-3125 | ||
miRNA Sequence |
UAGAGGAAGCUGUGGAGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-3150b directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3150b | miRNA Mature ID | miR-3150b-3p | ||
miRNA Sequence |
UGAGGAGAUCGUCGAGGUUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-3175 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3175 | miRNA Mature ID | miR-3175 | ||
miRNA Sequence |
CGGGGAGAGAACGCAGUGACGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-3187 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-3p | ||
miRNA Sequence |
UUGGCCAUGGGGCUGCGCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon10 |
miR-3202 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3202 | miRNA Mature ID | miR-3202 | ||
miRNA Sequence |
UGGAAGGGAGAAGAGCUUUAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-3914 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3914 | miRNA Mature ID | miR-3914 | ||
miRNA Sequence |
AAGGAACCAGAAAAUGAGAAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon12 |
miR-3916 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3916 | miRNA Mature ID | miR-3916 | ||
miRNA Sequence |
AAGAGGAAGAAAUGGCUGGUUCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon13 |
miR-3928 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3928 | miRNA Mature ID | miR-3928-3p | ||
miRNA Sequence |
GGAGGAACCUUGGAGCUUCGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon14 |
miR-4306 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4306 | miRNA Mature ID | miR-4306 | ||
miRNA Sequence |
UGGAGAGAAAGGCAGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon15 |
miR-4435 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4435 | miRNA Mature ID | miR-4435 | ||
miRNA Sequence |
AUGGCCAGAGCUCACACAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon16 |
miR-4476 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4476 | miRNA Mature ID | miR-4476 | ||
miRNA Sequence |
CAGGAAGGAUUUAGGGACAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon17 |
miR-4640 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4640 | miRNA Mature ID | miR-4640-3p | ||
miRNA Sequence |
CACCCCCUGUUUCCUGGCCCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon18 |
miR-4644 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4644 | miRNA Mature ID | miR-4644 | ||
miRNA Sequence |
UGGAGAGAGAAAAGAGACAGAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon19 |
miR-4667 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4667 | miRNA Mature ID | miR-4667-3p | ||
miRNA Sequence |
UCCCUCCUUCUGUCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon20 |
miR-4701 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon21 |
miR-4716 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4716 | miRNA Mature ID | miR-4716-3p | ||
miRNA Sequence |
AAGGGGGAAGGAAACAUGGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon22 |
miR-4723 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon23 |
miR-4739 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon24 |
miR-4756 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4756 | miRNA Mature ID | miR-4756-5p | ||
miRNA Sequence |
CAGGGAGGCGCUCACUCUCUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon25 |
miR-4764 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4764 | miRNA Mature ID | miR-4764-3p | ||
miRNA Sequence |
UUAACUCCUUUCACACCCAUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon26 |
miR-4784 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4784 | miRNA Mature ID | miR-4784 | ||
miRNA Sequence |
UGAGGAGAUGCUGGGACUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon27 |
miR-548s directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon28 |
miR-5698 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon29 |
miR-588 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-588 | miRNA Mature ID | miR-588 | ||
miRNA Sequence |
UUGGCCACAAUGGGUUAGAAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon30 |
miR-618 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-618 | miRNA Mature ID | miR-618 | ||
miRNA Sequence |
AAACUCUACUUGUCCUUCUGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon31 |
miR-6731 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6731 | miRNA Mature ID | miR-6731-5p | ||
miRNA Sequence |
UGGGAGAGCAGGGUAUUGUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon32 |
miR-6758 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6758 | miRNA Mature ID | miR-6758-5p | ||
miRNA Sequence |
UAGAGAGGGGAAGGAUGUGAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon33 |
miR-6794 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6794 | miRNA Mature ID | miR-6794-5p | ||
miRNA Sequence |
CAGGGGGACUGGGGGUGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon34 |
miR-6856 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-5p | ||
miRNA Sequence |
AAGAGAGGAGCAGUGGUGCUGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon35 |
miR-6859 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6859 | miRNA Mature ID | miR-6859-5p | ||
miRNA Sequence |
GAGAGGAACAUGGGCUCAGGACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon36 |
miR-6870 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon37 |
miR-6871 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6871 | miRNA Mature ID | miR-6871-3p | ||
miRNA Sequence |
CAGCACCCUGUGGCUCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon38 |
miR-6876 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6876 | miRNA Mature ID | miR-6876-5p | ||
miRNA Sequence |
CAGGAAGGAGACAGGCAGUUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon39 |
miR-6887 directly targets SLC26A9 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6887 | miRNA Mature ID | miR-6887-3p | ||
miRNA Sequence |
UCCCCUCCACUUUCCUCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon40 |
miR-7106 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon41 |
miR-7111 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon42 |
miR-7515 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7515 | miRNA Mature ID | miR-7515 | ||
miRNA Sequence |
AGAAGGGAAGAUGGUGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon43 |
miR-765 directly targets SLC26A9 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-765 | miRNA Mature ID | miR-765 | ||
miRNA Sequence |
UGGAGGAGAAGGAAGGUGAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon44 |
miR-8085 directly targets SLC26A9 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8085 | miRNA Mature ID | miR-8085 | ||
miRNA Sequence |
UGGGAGAGAGGACUGUGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant/significant hypermethylation of SLC26A9 in liver cancer than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:4.93E-11; Fold-change:-0.371479338; Z-score:-2.185370184 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:1.13E-17; Fold-change:-0.396091941; Z-score:-7.649001796 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
![]() |
![]() | ||||
Peripheral neuroectodermal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypermethylation of SLC26A9 in peripheral neuroectodermal tumour than that in healthy individual | ||||
Studied Phenotype |
Peripheral neuroectodermal tumour [ICD-11:2B52] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.011551441; Fold-change:0.282891522; Z-score:0.836031628 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Pulmonary hypertension |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypermethylation of SLC26A9 in pulmonary hypertension than that in healthy individual | ||||
Studied Phenotype |
Pulmonary hypertension [ICD-11:BB01] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.016234259; Fold-change:0.246981524; Z-score:2.425512893 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC26A9 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000221784; Fold-change:-0.23702148; Z-score:-11.5345965 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC26A9 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:4.88E-07; Fold-change:-0.236241857; Z-score:-3.08540699 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Ovarian cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC26A9 in ovarian cancer than that in healthy individual | ||||
Studied Phenotype |
Ovarian cancer [ICD-11:2C73] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.014071479; Fold-change:-0.253133791; Z-score:-1.127840331 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Arterial aneurysm |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC26A9 in arterial aneurysm than that in healthy individual | ||||
Studied Phenotype |
Arterial aneurysm [ICD-11:BD51] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000267469; Fold-change:0.706624502; Z-score:1.899896576 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC26A9 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:1.39E-07; Fold-change:0.436197209; Z-score:1.28832318 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC26A9 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.000361349; Fold-change:0.453903588; Z-score:4.627337545 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC26A9 in prostate cancer than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer [ICD-11:2C82] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.95E-07; Fold-change:0.461784475; Z-score:3.266756661 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC26A9 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.29E-10; Fold-change:-0.408997771; Z-score:-1.163699696 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Brain neuroepithelial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC26A9 in brain neuroepithelial tumour than that in healthy individual | ||||
Studied Phenotype |
Brain neuroepithelial tumour [ICD-11:2A00.2Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:9.86E-11; Fold-change:-0.491677721; Z-score:-1.612321906 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC26A9 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:4.22E-48; Fold-change:-0.483042883; Z-score:-1.86178338 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
RELA YAP fusion ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC26A9 in rela yap fusion ependymoma than that in healthy individual | ||||
Studied Phenotype |
RELA YAP fusion ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.55E-13; Fold-change:-0.35999925; Z-score:-1.299436665 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() | ||||
Vestibular melanotic schwannoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC26A9 in vestibular melanotic schwannoma than that in healthy individual | ||||
Studied Phenotype |
Vestibular melanotic schwannoma [ICD-11:2A02.3] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:2.17E-05; Fold-change:-0.307898545; Z-score:-4.497786905 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
Renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC26A9 in renal cell carcinoma than that in adjacent tissue | ||||
Studied Phenotype |
Renal cell carcinoma [ICD-11:2C90] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:0.000599789; Fold-change:-0.236917322; Z-score:-1.485921732 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.