General Information of Drug Transporter (DT)
DT ID DTD0237 Transporter Info
Gene Name SLC26A9
Transporter Name Anion transporter/exchanger protein 9
Gene ID
115019
UniProt ID
Q7LBE3
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

         44 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1321 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1321 miRNA Mature ID miR-1321

miRNA Sequence

CAGGGAGGUGAAUGUGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-185 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-185 miRNA Mature ID miR-185-5p

miRNA Sequence

UGGAGAGAAAGGCAGUUCCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-302b directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302b miRNA Mature ID miR-302b-5p

miRNA Sequence

ACUUUAACAUGGAAGUGCUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-302d directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302d miRNA Mature ID miR-302d-5p

miRNA Sequence

ACUUUAACAUGGAGGCACUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-3065 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3065 miRNA Mature ID miR-3065-3p

miRNA Sequence

UCAGCACCAGGAUAUUGUUGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-3125 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3125 miRNA Mature ID miR-3125

miRNA Sequence

UAGAGGAAGCUGUGGAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-3150b directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3175 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3175 miRNA Mature ID miR-3175

miRNA Sequence

CGGGGAGAGAACGCAGUGACGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-3187 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-3p

miRNA Sequence

UUGGCCAUGGGGCUGCGCGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-3202 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3202 miRNA Mature ID miR-3202

miRNA Sequence

UGGAAGGGAGAAGAGCUUUAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-3914 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3914 miRNA Mature ID miR-3914

miRNA Sequence

AAGGAACCAGAAAAUGAGAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-3916 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3916 miRNA Mature ID miR-3916

miRNA Sequence

AAGAGGAAGAAAUGGCUGGUUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-3928 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3928 miRNA Mature ID miR-3928-3p

miRNA Sequence

GGAGGAACCUUGGAGCUUCGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4306 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4306 miRNA Mature ID miR-4306

miRNA Sequence

UGGAGAGAAAGGCAGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4435 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4435 miRNA Mature ID miR-4435

miRNA Sequence

AUGGCCAGAGCUCACACAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-4476 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4476 miRNA Mature ID miR-4476

miRNA Sequence

CAGGAAGGAUUUAGGGACAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-4640 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4640 miRNA Mature ID miR-4640-3p

miRNA Sequence

CACCCCCUGUUUCCUGGCCCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-4644 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4644 miRNA Mature ID miR-4644

miRNA Sequence

UGGAGAGAGAAAAGAGACAGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4667 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4667 miRNA Mature ID miR-4667-3p

miRNA Sequence

UCCCUCCUUCUGUCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4701 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4701 miRNA Mature ID miR-4701-5p

miRNA Sequence

UUGGCCACCACACCUACCCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-4716 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4716 miRNA Mature ID miR-4716-3p

miRNA Sequence

AAGGGGGAAGGAAACAUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-4723 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-4739 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4739 miRNA Mature ID miR-4739

miRNA Sequence

AAGGGAGGAGGAGCGGAGGGGCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-4756 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4756 miRNA Mature ID miR-4756-5p

miRNA Sequence

CAGGGAGGCGCUCACUCUCUGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-4764 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4764 miRNA Mature ID miR-4764-3p

miRNA Sequence

UUAACUCCUUUCACACCCAUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-4784 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

UGAGGAGAUGCUGGGACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-548s directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548s miRNA Mature ID miR-548s

miRNA Sequence

AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-5698 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-588 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-588 miRNA Mature ID miR-588

miRNA Sequence

UUGGCCACAAUGGGUUAGAAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-618 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-618 miRNA Mature ID miR-618

miRNA Sequence

AAACUCUACUUGUCCUUCUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-6731 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6731 miRNA Mature ID miR-6731-5p

miRNA Sequence

UGGGAGAGCAGGGUAUUGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-6758 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-6794 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6794 miRNA Mature ID miR-6794-5p

miRNA Sequence

CAGGGGGACUGGGGGUGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-6856 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-6859 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6859 miRNA Mature ID miR-6859-5p

miRNA Sequence

GAGAGGAACAUGGGCUCAGGACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6870 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

UGGGGGAGAUGGGGGUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6871 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6871 miRNA Mature ID miR-6871-3p

miRNA Sequence

CAGCACCCUGUGGCUCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6876 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6876 miRNA Mature ID miR-6876-5p

miRNA Sequence

CAGGAAGGAGACAGGCAGUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6887 directly targets SLC26A9 [ 3 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-7106 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-7111 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-7515 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7515 miRNA Mature ID miR-7515

miRNA Sequence

AGAAGGGAAGAUGGUGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-765 directly targets SLC26A9 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-765 miRNA Mature ID miR-765

miRNA Sequence

UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-8085 directly targets SLC26A9 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8085 miRNA Mature ID miR-8085

miRNA Sequence

UGGGAGAGAGGACUGUGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Liver cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant/significant hypermethylation of SLC26A9 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.93E-11; Fold-change:-0.371479338; Z-score:-2.185370184

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:1.13E-17; Fold-change:-0.396091941; Z-score:-7.649001796
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Peripheral neuroectodermal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC26A9 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.011551441; Fold-change:0.282891522; Z-score:0.836031628
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Pulmonary hypertension

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC26A9 in pulmonary hypertension than that in healthy individual

Studied Phenotype

Pulmonary hypertension [ICD-11:BB01]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.016234259; Fold-change:0.246981524; Z-score:2.425512893
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC26A9 in melanoma than that in healthy individual

Studied Phenotype

Melanoma [ICD-11:2C30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000221784; Fold-change:-0.23702148; Z-score:-11.5345965
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Obesity

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC26A9 in obesity than that in healthy individual

Studied Phenotype

Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.88E-07; Fold-change:-0.236241857; Z-score:-3.08540699
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Ovarian cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC26A9 in ovarian cancer than that in healthy individual

Studied Phenotype

Ovarian cancer [ICD-11:2C73]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.014071479; Fold-change:-0.253133791; Z-score:-1.127840331
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Arterial aneurysm

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC26A9 in arterial aneurysm than that in healthy individual

Studied Phenotype

Arterial aneurysm [ICD-11:BD51]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000267469; Fold-change:0.706624502; Z-score:1.899896576
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Atypical teratoid rhabdoid tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC26A9 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.39E-07; Fold-change:0.436197209; Z-score:1.28832318
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC26A9 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000361349; Fold-change:0.453903588; Z-score:4.627337545
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC26A9 in prostate cancer than that in healthy individual

Studied Phenotype

Prostate cancer [ICD-11:2C82]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.95E-07; Fold-change:0.461784475; Z-score:3.266756661
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC26A9 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.29E-10; Fold-change:-0.408997771; Z-score:-1.163699696
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroepithelial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC26A9 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.86E-11; Fold-change:-0.491677721; Z-score:-1.612321906
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Posterior fossa ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC26A9 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.22E-48; Fold-change:-0.483042883; Z-score:-1.86178338
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  RELA YAP fusion ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC26A9 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.55E-13; Fold-change:-0.35999925; Z-score:-1.299436665
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Vestibular melanotic schwannoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC26A9 in vestibular melanotic schwannoma than that in healthy individual

Studied Phenotype

Vestibular melanotic schwannoma [ICD-11:2A02.3]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.17E-05; Fold-change:-0.307898545; Z-score:-4.497786905
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC26A9 in renal cell carcinoma than that in adjacent tissue

Studied Phenotype

Renal cell carcinoma [ICD-11:2C90]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:0.000599789; Fold-change:-0.236917322; Z-score:-1.485921732
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
References
1 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
2 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
3 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.