General Information of Drug Transporter (DT)
DT ID DTD0231 Transporter Info
Gene Name SLC26A3
Transporter Name Chloride anion exchanger
Gene ID
1811
UniProt ID
P40879
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

TSS1500 (cg22294577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.74E+00 Statistic Test p-value:1.42E-10; Z-score:-2.62E+01

Methylation in Case

4.16E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

TSS1500 (cg04996020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.85E+00 Statistic Test p-value:2.06E-09; Z-score:-2.48E+01

Methylation in Case

4.11E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

TSS1500 (cg16709217)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:5.08E-06; Z-score:-8.34E+00

Methylation in Case

6.64E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

Body (cg12651599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.68E-03; Z-score:-8.14E-01

Methylation in Case

7.97E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in colorectal cancer [ 2 ]

Location

TSS1500 (cg16709217)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.18E-07; Z-score:-2.04E+00

Methylation in Case

9.05E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC26A3 in colorectal cancer [ 2 ]

Location

TSS1500 (cg22294577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.69E-04; Z-score:-7.78E-01

Methylation in Case

8.86E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg26153234)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:1.59E-12; Z-score:-3.02E+00

Methylation in Case

6.79E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg22294577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.61E-09; Z-score:-3.80E+00

Methylation in Case

6.28E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg16709217)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.09E-08; Z-score:-3.30E+00

Methylation in Case

7.65E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg04996020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.00E-05; Z-score:-8.90E-01

Methylation in Case

7.53E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

Body (cg17778888)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:3.17E-13; Z-score:-4.02E+00

Methylation in Case

6.54E-01 (Median) Methylation in Control 9.59E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

Body (cg12651599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.69E-04; Z-score:-4.27E-01

Methylation in Case

8.39E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in lung adenocarcinoma [ 4 ]

Location

TSS1500 (cg22294577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.87E-02; Z-score:-2.60E+00

Methylation in Case

6.99E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC26A3 in lung adenocarcinoma [ 4 ]

Location

TSS1500 (cg16709217)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.27E-02; Z-score:-2.36E+00

Methylation in Case

7.72E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in panic disorder [ 5 ]

Location

TSS1500 (cg22294577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.64E-02; Z-score:3.83E-01

Methylation in Case

2.67E+00 (Median) Methylation in Control 2.47E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg04996020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:5.44E-06; Z-score:-1.10E+00

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC26A3 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg16709217)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.01E-02; Z-score:-3.72E-01

Methylation in Case

8.44E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC26A3 in papillary thyroid cancer [ 6 ]

Location

Body (cg12651599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:9.53E-03; Z-score:-2.78E-01

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in breast cancer [ 7 ]

Location

Body (cg12651599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:7.05E-24; Z-score:2.92E+00

Methylation in Case

8.51E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC26A3 in prostate cancer [ 8 ]

Location

Body (cg07587250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:2.62E-03; Z-score:8.10E+00

Methylation in Case

8.81E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets SLC26A3 [ 9 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-7 directly targets SLC26A3 [ 10 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
10 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.