Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0231 Transporter Info | ||||
Gene Name | SLC26A3 | ||||
Transporter Name | Chloride anion exchanger | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg22294577) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.74E+00 | Statistic Test | p-value:1.42E-10; Z-score:-2.62E+01 | ||
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC26A3 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg04996020) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.85E+00 | Statistic Test | p-value:2.06E-09; Z-score:-2.48E+01 | ||
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC26A3 in bladder cancer | [ 1 ] | |||
Location |
TSS1500 (cg16709217) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:5.08E-06; Z-score:-8.34E+00 | ||
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC26A3 in bladder cancer | [ 1 ] | |||
Location |
Body (cg12651599) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.68E-03; Z-score:-8.14E-01 | ||
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in colorectal cancer | [ 2 ] | |||
Location |
TSS1500 (cg16709217) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.18E-07; Z-score:-2.04E+00 | ||
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC26A3 in colorectal cancer | [ 2 ] | |||
Location |
TSS1500 (cg22294577) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.69E-04; Z-score:-7.78E-01 | ||
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg26153234) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:1.59E-12; Z-score:-3.02E+00 | ||
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC26A3 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg22294577) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:1.61E-09; Z-score:-3.80E+00 | ||
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 7.48E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC26A3 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg16709217) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:3.09E-08; Z-score:-3.30E+00 | ||
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC26A3 in hepatocellular carcinoma | [ 3 ] | |||
Location |
TSS1500 (cg04996020) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.00E-05; Z-score:-8.90E-01 | ||
Methylation in Case |
7.53E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC26A3 in hepatocellular carcinoma | [ 3 ] | |||
Location |
Body (cg17778888) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.47E+00 | Statistic Test | p-value:3.17E-13; Z-score:-4.02E+00 | ||
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC26A3 in hepatocellular carcinoma | [ 3 ] | |||
Location |
Body (cg12651599) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.69E-04; Z-score:-4.27E-01 | ||
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in lung adenocarcinoma | [ 4 ] | |||
Location |
TSS1500 (cg22294577) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.87E-02; Z-score:-2.60E+00 | ||
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC26A3 in lung adenocarcinoma | [ 4 ] | |||
Location |
TSS1500 (cg16709217) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.27E-02; Z-score:-2.36E+00 | ||
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in panic disorder | [ 5 ] | |||
Location |
TSS1500 (cg22294577) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.64E-02; Z-score:3.83E-01 | ||
Methylation in Case |
2.67E+00 (Median) | Methylation in Control | 2.47E+00 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg04996020) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:5.44E-06; Z-score:-1.10E+00 | ||
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC26A3 in papillary thyroid cancer | [ 6 ] | |||
Location |
TSS1500 (cg16709217) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.01E-02; Z-score:-3.72E-01 | ||
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC26A3 in papillary thyroid cancer | [ 6 ] | |||
Location |
Body (cg12651599) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.53E-03; Z-score:-2.78E-01 | ||
Methylation in Case |
9.13E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in breast cancer | [ 7 ] | |||
Location |
Body (cg12651599) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:7.05E-24; Z-score:2.92E+00 | ||
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC26A3 in prostate cancer | [ 8 ] | |||
Location |
Body (cg07587250) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:2.62E-03; Z-score:8.10E+00 | ||
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-335 directly targets SLC26A3 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-7 directly targets SLC26A3 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-7 | miRNA Mature ID | miR-7-5p | ||
miRNA Sequence |
UGGAAGACUAGUGAUUUUGUUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.