General Information of Drug Transporter (DT)
DT ID DTD0195 Transporter Info
Gene Name SLC25A33
Transporter Name Bone marrow stromal cell mitochondrial carrier protein
Gene ID
84275
UniProt ID
Q9BSK2
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg03835296)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:4.41E-03; Z-score:-1.43E+00

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg18329052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.33E-04; Z-score:-1.40E+00

Methylation in Case

5.63E-01 (Median) Methylation in Control 6.95E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg24751648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:5.95E-04; Z-score:-1.32E+00

Methylation in Case

1.56E-01 (Median) Methylation in Control 2.40E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg00881552)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.13E+00 Statistic Test p-value:7.79E-04; Z-score:5.42E+00

Methylation in Case

2.30E-01 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in colon adenocarcinoma [ 1 ]

Location

Body (cg11789820)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:4.77E-07; Z-score:-3.19E+00

Methylation in Case

5.65E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in colon adenocarcinoma [ 1 ]

Location

Body (cg06121808)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.37E-05; Z-score:-2.64E+00

Methylation in Case

4.17E-01 (Median) Methylation in Control 5.41E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Bladder cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS1500 (cg18783781)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:9.15E-08; Z-score:-7.13E+00

Methylation in Case

4.73E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.93E-05; Z-score:-3.08E+00

Methylation in Case

5.04E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS1500 (cg25369015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.32E+00 Statistic Test p-value:2.38E-04; Z-score:-4.72E+00

Methylation in Case

2.22E-02 (Median) Methylation in Control 9.60E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS1500 (cg19896639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:1.31E-03; Z-score:-3.11E+00

Methylation in Case

5.54E-02 (Median) Methylation in Control 8.71E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS1500 (cg13557160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.77E-03; Z-score:-2.01E+00

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS200 (cg10009930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.62E-02; Z-score:-1.09E+00

Methylation in Case

1.44E-01 (Median) Methylation in Control 1.56E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

TSS200 (cg04621676)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:4.70E-02; Z-score:8.81E-01

Methylation in Case

4.79E-02 (Median) Methylation in Control 3.96E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

Body (cg13688474)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.89E+00 Statistic Test p-value:5.13E-12; Z-score:-1.21E+01

Methylation in Case

1.26E-01 (Median) Methylation in Control 2.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

Body (cg26607031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.29E+00 Statistic Test p-value:1.65E-06; Z-score:7.37E+00

Methylation in Case

7.59E-01 (Median) Methylation in Control 2.31E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

Body (cg23824902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.85E-04; Z-score:-3.78E+00

Methylation in Case

6.96E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

Body (cg06927343)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.20E-04; Z-score:-2.26E+00

Methylation in Case

8.57E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC25A33 in bladder cancer [ 2 ]

Location

Body (cg09058554)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.45E-03; Z-score:-1.93E+00

Methylation in Case

6.48E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

TSS1500 (cg25369015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-6.66E+00 Statistic Test p-value:1.12E-14; Z-score:-1.96E+00

Methylation in Case

3.33E-02 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

TSS1500 (cg19896639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.28E+00 Statistic Test p-value:7.07E-14; Z-score:-1.91E+00

Methylation in Case

5.74E-02 (Median) Methylation in Control 2.46E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

TSS1500 (cg18783781)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:7.53E-09; Z-score:-1.80E+00

Methylation in Case

6.65E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:9.39E-05; Z-score:-1.08E+00

Methylation in Case

5.21E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

TSS1500 (cg13557160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:1.14E-03; Z-score:-9.97E-01

Methylation in Case

6.95E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

TSS200 (cg10009930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.51E-02; Z-score:-3.01E-01

Methylation in Case

1.44E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

Body (cg13688474)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.17E+00 Statistic Test p-value:1.02E-27; Z-score:-3.52E+00

Methylation in Case

1.41E-01 (Median) Methylation in Control 3.05E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

Body (cg26607031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.71E+00 Statistic Test p-value:7.67E-24; Z-score:5.18E+00

Methylation in Case

4.98E-01 (Median) Methylation in Control 1.84E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

Body (cg13631913)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.46E+00 Statistic Test p-value:7.50E-16; Z-score:-2.11E+00

Methylation in Case

5.44E-02 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

Body (cg03901886)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+01 Statistic Test p-value:2.03E-12; Z-score:-1.67E+00

Methylation in Case

1.55E-02 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

Body (cg09058554)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:2.64E-07; Z-score:-1.28E+00

Methylation in Case

5.87E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC25A33 in breast cancer [ 3 ]

Location

Body (cg23824902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:9.30E-06; Z-score:-1.31E+00

Methylation in Case

8.11E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg25369015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.52E+00 Statistic Test p-value:5.96E-04; Z-score:3.71E+00

Methylation in Case

3.51E-02 (Median) Methylation in Control 2.32E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg19896639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:3.65E-03; Z-score:1.39E+00

Methylation in Case

3.44E-02 (Median) Methylation in Control 2.68E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg09058554)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.10E-07; Z-score:3.25E+00

Methylation in Case

9.17E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg13688474)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:2.57E-05; Z-score:2.04E+00

Methylation in Case

2.54E-01 (Median) Methylation in Control 1.92E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg13631913)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.95E-03; Z-score:3.01E-01

Methylation in Case

2.74E-02 (Median) Methylation in Control 2.54E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg03901886)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:3.01E-02; Z-score:1.22E+00

Methylation in Case

3.16E-02 (Median) Methylation in Control 2.67E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

TSS1500 (cg13557160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:9.17E-10; Z-score:-2.62E+00

Methylation in Case

7.86E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.19E-03; Z-score:-7.84E-01

Methylation in Case

7.52E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

TSS1500 (cg02360478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.33E-02; Z-score:-4.47E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

TSS1500 (cg25369015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:3.01E-02; Z-score:-2.96E-01

Methylation in Case

2.08E-02 (Median) Methylation in Control 2.76E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

TSS200 (cg10009930)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.50E-05; Z-score:1.20E+00

Methylation in Case

1.56E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

Body (cg26607031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:3.93E-06; Z-score:1.25E+00

Methylation in Case

5.39E-01 (Median) Methylation in Control 4.07E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A33 in colorectal cancer [ 5 ]

Location

Body (cg09058554)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.34E-03; Z-score:-5.13E-01

Methylation in Case

7.41E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg13557160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:4.42E-08; Z-score:-1.74E+00

Methylation in Case

7.30E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg18783781)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:5.94E-08; Z-score:-1.80E+00

Methylation in Case

5.63E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg25369015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:1.86E-03; Z-score:-5.03E-01

Methylation in Case

2.56E-02 (Median) Methylation in Control 3.15E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg02360478)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.65E-02; Z-score:-4.86E-01

Methylation in Case

8.31E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

Body (cg25370753)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.29E+00 Statistic Test p-value:3.74E-22; Z-score:-1.50E+01

Methylation in Case

3.93E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

Body (cg13631913)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:4.62E-06; Z-score:-6.64E-01

Methylation in Case

6.58E-02 (Median) Methylation in Control 7.96E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

Body (cg26607031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:1.64E-03; Z-score:-7.91E-01

Methylation in Case

2.33E-01 (Median) Methylation in Control 3.21E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC25A33 in hepatocellular carcinoma [ 6 ]

Location

Body (cg23824902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.06E-02; Z-score:1.96E-02

Methylation in Case

8.11E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS1500 (cg25507121)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.57E-09; Z-score:-1.63E+00

Methylation in Case

4.79E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg17653824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.98E+00 Statistic Test p-value:6.30E-19; Z-score:3.15E+00

Methylation in Case

3.57E-01 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in pancretic ductal adenocarcinoma [ 7 ]

Location

TSS200 (cg24697682)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.22E-03; Z-score:-7.03E-01

Methylation in Case

7.77E-02 (Median) Methylation in Control 8.80E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in pancretic ductal adenocarcinoma [ 7 ]

Location

1stExon (cg00364611)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:7.51E-05; Z-score:-2.17E-01

Methylation in Case

8.48E-02 (Median) Methylation in Control 8.91E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg22334665)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.49E+00 Statistic Test p-value:6.74E-07; Z-score:1.31E+00

Methylation in Case

2.98E-01 (Median) Methylation in Control 2.00E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in pancretic ductal adenocarcinoma [ 7 ]

Location

Body (cg01440070)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.39E-02; Z-score:6.17E-01

Methylation in Case

6.91E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in panic disorder [ 8 ]

Location

TSS1500 (cg18783781)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.28E-02; Z-score:2.20E-01

Methylation in Case

2.65E+00 (Median) Methylation in Control 2.56E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg19896639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.49E+00 Statistic Test p-value:4.05E-10; Z-score:2.07E+00

Methylation in Case

2.13E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg13557160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.68E-09; Z-score:1.47E+00

Methylation in Case

8.11E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg25369015)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:1.71E-07; Z-score:1.33E+00

Methylation in Case

1.80E-01 (Median) Methylation in Control 1.31E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:9.57E-04; Z-score:7.28E-01

Methylation in Case

5.25E-01 (Median) Methylation in Control 5.00E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

Body (cg26607031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:1.09E-07; Z-score:1.43E+00

Methylation in Case

3.49E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

Body (cg13688474)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:1.22E-05; Z-score:1.02E+00

Methylation in Case

2.07E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

Body (cg09058554)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.68E-03; Z-score:8.08E-01

Methylation in Case

8.30E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

Body (cg13631913)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.42E-02; Z-score:-7.19E-02

Methylation in Case

7.68E-02 (Median) Methylation in Control 7.79E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC25A33 in papillary thyroid cancer [ 9 ]

Location

Body (cg23824902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.90E-02; Z-score:3.57E-01

Methylation in Case

9.05E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

TSS1500 (cg20677436)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:1.06E-02; Z-score:-2.07E+00

Methylation in Case

4.14E-01 (Median) Methylation in Control 5.62E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

TSS1500 (cg03483626)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.50E-02; Z-score:1.61E+00

Methylation in Case

7.65E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

TSS200 (cg04963424)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.99E+00 Statistic Test p-value:7.86E-03; Z-score:-2.56E+00

Methylation in Case

2.40E-01 (Median) Methylation in Control 4.78E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

TSS200 (cg16829998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:9.13E-03; Z-score:-2.84E+00

Methylation in Case

1.13E-01 (Median) Methylation in Control 1.72E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

Body (cg20241270)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.15E-03; Z-score:5.14E+00

Methylation in Case

9.48E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

Body (cg13767768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:2.63E-03; Z-score:5.02E+00

Methylation in Case

8.96E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC25A33 in prostate cancer [ 10 ]

Location

Body (cg20730619)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.87E-02; Z-score:1.63E+00

Methylation in Case

9.30E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A33 in lung adenocarcinoma [ 11 ]

Location

Body (cg26607031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:2.74E-04; Z-score:5.96E+00

Methylation in Case

6.18E-01 (Median) Methylation in Control 3.75E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A33 in lung adenocarcinoma [ 11 ]

Location

Body (cg23824902)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.72E-03; Z-score:1.81E+00

Methylation in Case

8.39E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

       100 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-101 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-101 miRNA Mature ID miR-101-3p

miRNA Sequence

UACAGUACUGUGAUAACUGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-106a directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-106b directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-122 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-1234 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1234 miRNA Mature ID miR-1234-3p

miRNA Sequence

UCGGCCUGACCACCCACCCCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1268a directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1268a miRNA Mature ID miR-1268a

miRNA Sequence

CGGGCGUGGUGGUGGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-1268b directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1268b miRNA Mature ID miR-1268b

miRNA Sequence

CGGGCGUGGUGGUGGGGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-1289 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1289 miRNA Mature ID miR-1289

miRNA Sequence

UGGAGUCCAGGAAUCUGCAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-129 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-1304 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-1304 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-5p

miRNA Sequence

UUUGAGGCUACAGUGAGAUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-134 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-134 miRNA Mature ID miR-134-3p

miRNA Sequence

CCUGUGGGCCACCUAGUCACCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-143 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-3p

miRNA Sequence

UGAGAUGAAGCACUGUAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-143 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-5p

miRNA Sequence

GGUGCAGUGCUGCAUCUCUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-17 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-186 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-193b directly targets SLC25A33 [ 15 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-1976 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-20a directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-20b directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-2116 directly targets SLC25A33 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2116 miRNA Mature ID miR-2116-5p

miRNA Sequence

GGUUCUUAGCAUAGGAGGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-22 directly targets SLC25A33 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-22 miRNA Mature ID miR-22-5p

miRNA Sequence

AGUUCUUCAGUGGCAAGCUUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-2276 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2276 miRNA Mature ID miR-2276-3p

miRNA Sequence

UCUGCAAGUGUCAGAGGCGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-26b directly targets SLC25A33 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-3p

miRNA Sequence

CCUGUUCUCCAUUACUUGGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-302a directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-302b directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-302c directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-302d directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-302e directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302e miRNA Mature ID miR-302e

miRNA Sequence

UAAGUGCUUCCAUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-3115 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3115 miRNA Mature ID miR-3115

miRNA Sequence

AUAUGGGUUUACUAGUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-3135b directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-3136 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3136 miRNA Mature ID miR-3136-3p

miRNA Sequence

UGGCCCAACCUAUUCAGUUAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-3198 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3198 miRNA Mature ID miR-3198

miRNA Sequence

GUGGAGUCCUGGGGAAUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-3199 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3199 miRNA Mature ID miR-3199

miRNA Sequence

AGGGACUGCCUUAGGAGAAAGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-3652 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

CGGCUGGAGGUGUGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-365a directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-365a miRNA Mature ID miR-365a-5p

miRNA Sequence

AGGGACUUUUGGGGGCAGAUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-365b directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-365b miRNA Mature ID miR-365b-5p

miRNA Sequence

AGGGACUUUCAGGGGCAGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-372 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-373 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-377 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-4279 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

CUCUCCUCCCGGCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-4294 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4294 miRNA Mature ID miR-4294

miRNA Sequence

GGGAGUCUACAGCAGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-4309 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4309 miRNA Mature ID miR-4309

miRNA Sequence

CUGGAGUCUAGGAUUCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-4430 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

AGGCUGGAGUGAGCGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-4433a directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4433a miRNA Mature ID miR-4433a-3p

miRNA Sequence

ACAGGAGUGGGGGUGGGACAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-4485 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4485 miRNA Mature ID miR-4485-5p

miRNA Sequence

ACCGCCUGCCCAGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-4534 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4534 miRNA Mature ID miR-4534

miRNA Sequence

GGAUGGAGGAGGGGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-4639 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4639 miRNA Mature ID miR-4639-3p

miRNA Sequence

UCACUCUCACCUUGCUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-4677 directly targets SLC25A33 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4677 miRNA Mature ID miR-4677-5p

miRNA Sequence

UUGUUCUUUGGUCUUUCAGCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-4708 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4708 miRNA Mature ID miR-4708-5p

miRNA Sequence

AGAGAUGCCGCCUUGCUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-4722 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-4731 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-4740 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4740 miRNA Mature ID miR-4740-3p

miRNA Sequence

GCCCGAGAGGAUCCGUCCCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-4770 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4770 miRNA Mature ID miR-4770

miRNA Sequence

UGAGAUGACACUGUAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-5001 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5001 miRNA Mature ID miR-5001-3p

miRNA Sequence

UUCUGCCUCUGUCCAGGUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-504 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-5089 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-512 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-512 miRNA Mature ID miR-512-3p

miRNA Sequence

AAGUGCUGUCAUAGCUGAGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-519d directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon60

miR-520a directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-520c directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-520d directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-520g directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-520h directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520h miRNA Mature ID miR-520h

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon65

miR-526b directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-5589 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon67

miR-5693 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5693 miRNA Mature ID miR-5693

miRNA Sequence

GCAGUGGCUCUGAAAUGAACUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-5698 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon69

miR-582 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-582 miRNA Mature ID miR-582-5p

miRNA Sequence

UUACAGUUGUUCAACCAGUUACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon70

miR-6086 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon71

miR-6088 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6088 miRNA Mature ID miR-6088

miRNA Sequence

AGAGAUGAAGCGGGGGGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon72

miR-610 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-610 miRNA Mature ID miR-610

miRNA Sequence

UGAGCUAAAUGUGUGCUGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon73

miR-619 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon74

miR-6499 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon75

miR-6506 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon76

miR-6514 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6514 miRNA Mature ID miR-6514-5p

miRNA Sequence

UAUGGAGUGGACUUUCAGCUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon77

miR-655 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-655 miRNA Mature ID miR-655-5p

miRNA Sequence

AGAGGUUAUCCGUGUUAUGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon78

miR-663b directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-663b miRNA Mature ID miR-663b

miRNA Sequence

GGUGGCCCGGCCGUGCCUGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon79

miR-665 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon80

miR-6716 directly targets SLC25A33 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6716 miRNA Mature ID miR-6716-5p

miRNA Sequence

UGGGAAUGGGGGUAAGGGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon81

miR-6727 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon82

miR-6736 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6736 miRNA Mature ID miR-6736-3p

miRNA Sequence

UCAGCUCCUCUCUACCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon83

miR-6741 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6741 miRNA Mature ID miR-6741-5p

miRNA Sequence

GUGGGUGCUGGUGGGAGCCGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon84

miR-6747 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon85

miR-6778 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

UGCCUCCCUGACAUUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon86

miR-6787 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6787 miRNA Mature ID miR-6787-3p

miRNA Sequence

UCUCAGCUGCUGCCCUCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon87

miR-6789 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6789 miRNA Mature ID miR-6789-3p

miRNA Sequence

CGGCGCCCGUGUCUCCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon88

miR-6794 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6794 miRNA Mature ID miR-6794-3p

miRNA Sequence

CUCACUCUCAGUCCCUCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon89

miR-6840 directly targets SLC25A33 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon90

miR-6890 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

CCACUGCCUAUGCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon91

miR-7107 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7107 miRNA Mature ID miR-7107-5p

miRNA Sequence

UCGGCCUGGGGAGGAGGAAGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon92

miR-7108 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7108 miRNA Mature ID miR-7108-5p

miRNA Sequence

GUGUGGCCGGCAGGCGGGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon93

miR-7114 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7114 miRNA Mature ID miR-7114-5p

miRNA Sequence

UCUGUGGAGUGGGGUGCCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon94

miR-7155 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7155 miRNA Mature ID miR-7155-3p

miRNA Sequence

UGGCCCAAGACCUCAGACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon95

miR-8052 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8052 miRNA Mature ID miR-8052

miRNA Sequence

CGGGACUGUAGAGGGCAUGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon96

miR-8055 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8055 miRNA Mature ID miR-8055

miRNA Sequence

CUUUGAGCACAUGAGCAGACGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon97

miR-8082 directly targets SLC25A33 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8082 miRNA Mature ID miR-8082

miRNA Sequence

UGAUGGAGCUGGGAAUACUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon98

miR-92a directly targets SLC25A33 [ 15 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon99

miR-93 directly targets SLC25A33 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon100

miR-943 directly targets SLC25A33 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-943 miRNA Mature ID miR-943

miRNA Sequence

CUGACUGUUGCCGUCCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
13 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
15 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.