General Information of Drug Transporter (DT)
DT ID DTD0188 Transporter Info
Gene Name SLC25A27
Transporter Name Mitochondrial uncoupling protein 4
Gene ID
9481
UniProt ID
O95847
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg14918082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.00E-10; Z-score:1.65E+00

Methylation in Case

7.72E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A27 in hepatocellular carcinoma [ 1 ]

Location

3'UTR (cg07020832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.85E-04; Z-score:-7.07E-01

Methylation in Case

8.49E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in prostate cancer [ 2 ]

Location

TSS1500 (cg10761097)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.69E-02; Z-score:-2.10E+00

Methylation in Case

8.44E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A27 in prostate cancer [ 2 ]

Location

Body (cg11367539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.74E-02; Z-score:1.41E+00

Methylation in Case

9.51E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in bladder cancer [ 3 ]

Location

Body (cg19101566)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.58E+00 Statistic Test p-value:8.48E-10; Z-score:-1.23E+01

Methylation in Case

5.23E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A27 in bladder cancer [ 3 ]

Location

3'UTR (cg07020832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.47E-04; Z-score:-7.23E+00

Methylation in Case

8.28E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in breast cancer [ 4 ]

Location

Body (cg19101566)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:4.47E-10; Z-score:-2.57E+00

Methylation in Case

6.70E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A27 in breast cancer [ 4 ]

Location

3'UTR (cg07020832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.73E-10; Z-score:-2.94E+00

Methylation in Case

8.64E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in colorectal cancer [ 5 ]

Location

Body (cg19101566)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.18E-03; Z-score:-6.17E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in panic disorder [ 6 ]

Location

Body (cg19101566)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:1.06E-02; Z-score:-5.37E-01

Methylation in Case

1.54E+00 (Median) Methylation in Control 1.73E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in papillary thyroid cancer [ 7 ]

Location

Body (cg19101566)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:5.51E-06; Z-score:1.02E+00

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A27 in papillary thyroid cancer [ 7 ]

Location

3'UTR (cg07020832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:9.69E-04; Z-score:-7.19E-01

Methylation in Case

9.38E-01 (Median) Methylation in Control 9.49E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A27 in lung adenocarcinoma [ 8 ]

Location

3'UTR (cg07020832)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.98E-02; Z-score:-1.81E+00

Methylation in Case

8.72E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1277 directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-190a directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-369 directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-369 miRNA Mature ID miR-369-3p

miRNA Sequence

AAUAAUACAUGGUUGAUCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-374a directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-374a miRNA Mature ID miR-374a-5p

miRNA Sequence

UUAUAAUACAACCUGAUAAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-374b directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-374b miRNA Mature ID miR-374b-5p

miRNA Sequence

AUAUAAUACAACCUGCUAAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-410 directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-410 miRNA Mature ID miR-410-3p

miRNA Sequence

AAUAUAACACAGAUGGCCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-4503 directly targets SLC25A27 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4503 miRNA Mature ID miR-4503

miRNA Sequence

UUUAAGCAGGAAAUAGAAUUUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-5011 directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

UAUAUAUACAGCCAUGCACUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-5692b directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5692b miRNA Mature ID miR-5692b

miRNA Sequence

AAUAAUAUCACAGUAGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-5692c directly targets SLC25A27 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5692c miRNA Mature ID miR-5692c

miRNA Sequence

AAUAAUAUCACAGUAGGUGUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-6792 directly targets SLC25A27 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6792 miRNA Mature ID miR-6792-5p

miRNA Sequence

GUAAGCAGGGGCUCUGGGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
10 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.