General Information of Drug Transporter (DT)
DT ID DTD0182 Transporter Info
Gene Name SLC25A21
Transporter Name Mitochondrial 2-oxodicarboxylate carrier
Gene ID
89874
UniProt ID
Q9BQT8
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-3148 directly targets SLC25A21 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3148 miRNA Mature ID miR-3148

miRNA Sequence

UGGAAAAAACUGGUGUGUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-335 directly targets SLC25A21 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-3p

miRNA Sequence

UUUUUCAUUAUUGCUCCUGACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-3611 directly targets SLC25A21 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3611 miRNA Mature ID miR-3611

miRNA Sequence

UUGUGAAGAAAGAAAUUCUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-4289 directly targets SLC25A21 [ 2 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4289 miRNA Mature ID miR-4289

miRNA Sequence

GCAUUGUGCAGGGCUAUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-4668 directly targets SLC25A21 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4668 miRNA Mature ID miR-4668-5p

miRNA Sequence

AGGGAAAAAAAAAAGGAUUUGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-625 directly targets SLC25A21 [ 1 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-625 miRNA Mature ID miR-625-5p

miRNA Sequence

AGGGGGAAAGUUCUAUAGUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

Methylation

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC25A21 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.28E-07; Fold-change:-0.22155531; Z-score:-3.729426385
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  RELA YAP fusion ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC25A21 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.31E-15; Fold-change:-0.242602784; Z-score:-3.303753451
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC25A21 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.97E-11; Fold-change:-0.410934998; Z-score:-7.664613761
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
2 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.