General Information of Drug Transporter (DT)
DT ID DTD0175 Transporter Info
Gene Name SLC25A16
Transporter Name Graves disease carrier protein
Gene ID
8034
UniProt ID
P16260
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg22639011)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:7.33E-10; Z-score:1.61E+00

Methylation in Case

4.26E-01 (Median) Methylation in Control 3.08E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg20491914)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.46E-05; Z-score:4.88E-01

Methylation in Case

3.28E-01 (Median) Methylation in Control 2.99E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in bladder cancer [ 2 ]

Location

TSS1500 (cg08620470)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.76E-02; Z-score:-9.70E-01

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in bladder cancer [ 2 ]

Location

TSS1500 (cg25565000)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:2.09E-02; Z-score:-2.25E+00

Methylation in Case

6.74E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A16 in bladder cancer [ 2 ]

Location

Body (cg10590909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:9.93E-03; Z-score:-1.09E+00

Methylation in Case

1.15E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A16 in bladder cancer [ 2 ]

Location

Body (cg01284033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:4.21E-02; Z-score:-1.31E+00

Methylation in Case

7.02E-02 (Median) Methylation in Control 9.79E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in breast cancer [ 3 ]

Location

TSS1500 (cg25565000)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:6.14E-13; Z-score:1.99E+00

Methylation in Case

7.82E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in breast cancer [ 3 ]

Location

Body (cg16214034)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:7.22E-06; Z-score:1.22E+00

Methylation in Case

6.46E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A16 in breast cancer [ 3 ]

Location

Body (cg01284033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:6.14E-04; Z-score:9.06E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 8.68E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg26546862)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.86E-04; Z-score:-1.20E+00

Methylation in Case

8.79E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg25565000)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.33E-02; Z-score:1.32E+00

Methylation in Case

9.62E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A16 in clear cell renal cell carcinoma [ 4 ]

Location

1stExon (cg17823321)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.77E-04; Z-score:5.47E-01

Methylation in Case

2.82E-02 (Median) Methylation in Control 2.65E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A16 in clear cell renal cell carcinoma [ 4 ]

Location

Body (cg01284033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:4.28E-04; Z-score:6.89E-01

Methylation in Case

5.73E-02 (Median) Methylation in Control 3.91E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in colon adenocarcinoma [ 5 ]

Location

TSS1500 (cg24420041)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.83E+00 Statistic Test p-value:1.13E-04; Z-score:3.21E+00

Methylation in Case

3.30E-01 (Median) Methylation in Control 1.80E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in colon adenocarcinoma [ 5 ]

Location

Body (cg04860674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:7.29E-05; Z-score:-2.19E+00

Methylation in Case

7.37E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A16 in colon adenocarcinoma [ 5 ]

Location

Body (cg11351837)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.01E-04; Z-score:2.85E+00

Methylation in Case

7.03E-01 (Median) Methylation in Control 6.02E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in colorectal cancer [ 6 ]

Location

TSS1500 (cg08620470)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.22E-03; Z-score:-5.53E-01

Methylation in Case

9.36E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in colorectal cancer [ 6 ]

Location

TSS1500 (cg25565000)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.01E-02; Z-score:-3.75E-01

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg08620470)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.95E-02; Z-score:5.98E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in atypical teratoid rhabdoid tumor [ 8 ]

Location

1stExon (cg17823321)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.56E+00 Statistic Test p-value:9.36E-18; Z-score:-2.60E+00

Methylation in Case

4.24E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg01284033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.86E+00 Statistic Test p-value:5.92E-05; Z-score:-1.32E+00

Methylation in Case

2.55E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A16 in atypical teratoid rhabdoid tumor [ 8 ]

Location

Body (cg10590909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.58E-02; Z-score:-2.30E-01

Methylation in Case

4.88E-01 (Median) Methylation in Control 5.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A16 in atypical teratoid rhabdoid tumor [ 8 ]

Location

3'UTR (cg07526816)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.51E+00 Statistic Test p-value:2.08E-13; Z-score:-2.30E+00

Methylation in Case

4.94E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in hepatocellular carcinoma [ 9 ]

Location

Body (cg08956724)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.08E+00 Statistic Test p-value:2.04E-20; Z-score:4.80E+00

Methylation in Case

4.96E-01 (Median) Methylation in Control 8.16E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in hepatocellular carcinoma [ 9 ]

Location

Body (cg01284033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:9.43E-05; Z-score:-1.06E+00

Methylation in Case

9.64E-02 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC25A16 in hepatocellular carcinoma [ 9 ]

Location

Body (cg16214034)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.31E-02; Z-score:4.25E-01

Methylation in Case

7.14E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC25A16 in hepatocellular carcinoma [ 9 ]

Location

3'UTR (cg07526816)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.74E-02; Z-score:-3.17E-01

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in lung adenocarcinoma [ 10 ]

Location

Body (cg16214034)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:2.24E-03; Z-score:1.83E+00

Methylation in Case

6.98E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in prostate cancer [ 11 ]

Location

Body (cg18031850)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.18E+00 Statistic Test p-value:1.02E-03; Z-score:2.07E+01

Methylation in Case

4.41E-01 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC25A16 in prostate cancer [ 11 ]

Location

Body (cg27067158)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.31E-02; Z-score:2.23E+00

Methylation in Case

9.32E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC25A16 in systemic lupus erythematosus [ 12 ]

Location

Body (cg01284033)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:9.36E-03; Z-score:-2.40E-01

Methylation in Case

3.26E-01 (Median) Methylation in Control 3.42E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         68 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1228 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1228 miRNA Mature ID miR-1228-3p

miRNA Sequence

UCACACCUGCCUCGCCCCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-124 directly targets SLC25A16 [ 14 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon3

miR-1285 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1285 miRNA Mature ID miR-1285-3p

miRNA Sequence

UCUGGGCAACAAAGUGAGACCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1289 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1289 miRNA Mature ID miR-1289

miRNA Sequence

UGGAGUCCAGGAAUCUGCAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-129 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1304 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-143 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-3p

miRNA Sequence

UGAGAUGAAGCACUGUAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-29a directly targets SLC25A16 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29a miRNA Mature ID miR-29a-5p

miRNA Sequence

ACUGAUUUCUUUUGGUGUUCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-3149 directly targets SLC25A16 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3149 miRNA Mature ID miR-3149

miRNA Sequence

UUUGUAUGGAUAUGUGUGUGUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon10

miR-3187 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-5p

miRNA Sequence

CCUGGGCAGCGUGUGGCUGAAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-3194 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3194 miRNA Mature ID miR-3194-3p

miRNA Sequence

AGCUCUGCUGCUCACUGGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-3198 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3198 miRNA Mature ID miR-3198

miRNA Sequence

GUGGAGUCCUGGGGAAUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-32 directly targets SLC25A16 [ 18 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-32 miRNA Mature ID miR-32-5p

miRNA Sequence

UAUUGCACAUUACUAAGUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-3663 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3663 miRNA Mature ID miR-3663-5p

miRNA Sequence

GCUGGUCUGCGUGGUGCUCGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon15

miR-3689d directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-377 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-411 directly targets SLC25A16 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-411 miRNA Mature ID miR-411-5p

miRNA Sequence

UAGUAGACCGUAUAGCGUACG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-4258 directly targets SLC25A16 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4258 miRNA Mature ID miR-4258

miRNA Sequence

CCCCGCCACCGCCUUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon19

miR-4294 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4294 miRNA Mature ID miR-4294

miRNA Sequence

GGGAGUCUACAGCAGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4309 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4309 miRNA Mature ID miR-4309

miRNA Sequence

CUGGAGUCUAGGAUUCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-431 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-431 miRNA Mature ID miR-431-5p

miRNA Sequence

UGUCUUGCAGGCCGUCAUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-4423 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon23

miR-4524a directly targets SLC25A16 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4524a miRNA Mature ID miR-4524a-3p

miRNA Sequence

UGAGACAGGCUUAUGCUGCUAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon24

miR-4534 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4534 miRNA Mature ID miR-4534

miRNA Sequence

GGAUGGAGGAGGGGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-455 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-4707 directly targets SLC25A16 [ 20 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4707 miRNA Mature ID miR-4707-3p

miRNA Sequence

AGCCCGCCCCAGCCGAGGUUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-4708 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4708 miRNA Mature ID miR-4708-5p

miRNA Sequence

AGAGAUGCCGCCUUGCUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-4770 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4770 miRNA Mature ID miR-4770

miRNA Sequence

UGAGAUGACACUGUAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-4781 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4781 miRNA Mature ID miR-4781-3p

miRNA Sequence

AAUGUUGGAAUCCUCGCUAGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon30

miR-4793 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4793 miRNA Mature ID miR-4793-3p

miRNA Sequence

UCUGCACUGUGAGUUGGCUGGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-488 directly targets SLC25A16 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-488 miRNA Mature ID miR-488-3p

miRNA Sequence

UUGAAAGGCUAUUUCUUGGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-508 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-508 miRNA Mature ID miR-508-5p

miRNA Sequence

UACUCCAGAGGGCGUCACUCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-510 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-510 miRNA Mature ID miR-510-3p

miRNA Sequence

AUUGAAACCUCUAAGAGUGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

miR-5189 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5189 miRNA Mature ID miR-5189-5p

miRNA Sequence

UCUGGGCACAGGCGGAUGGACAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-5691 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5691 miRNA Mature ID miR-5691

miRNA Sequence

UUGCUCUGAGCUCCGAGAAAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6086 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6088 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6088 miRNA Mature ID miR-6088

miRNA Sequence

AGAGAUGAAGCGGGGGGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-612 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-612 miRNA Mature ID miR-612

miRNA Sequence

GCUGGGCAGGGCUUCUGAGCUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6131 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6131 miRNA Mature ID miR-6131

miRNA Sequence

GGCUGGUCAGAUGGGAGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon40

miR-6134 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

UGAGGUGGUAGGAUGUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-6499 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-6501 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon43

miR-6512 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-6514 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6514 miRNA Mature ID miR-6514-5p

miRNA Sequence

UAUGGAGUGGACUUUCAGCUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-6516 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-661 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-661 miRNA Mature ID miR-661

miRNA Sequence

UGCCUGGGUCUCUGGCCUGCGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-665 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-6720 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-6805 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6805 miRNA Mature ID miR-6805-3p

miRNA Sequence

UUGCUCUGCUCCCCCGCCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-6832 directly targets SLC25A16 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6832 miRNA Mature ID miR-6832-5p

miRNA Sequence

AGUAGAGAGGAAAAGUUAGGGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon51

miR-6840 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-6843 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6843 miRNA Mature ID miR-6843-3p

miRNA Sequence

AUGGUCUCCUGUUCUCUGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon53

miR-6848 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6848 miRNA Mature ID miR-6848-3p

miRNA Sequence

GUGGUCUCUUGGCCCCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon54

miR-6849 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-6851 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-6860 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6860 miRNA Mature ID miR-6860

miRNA Sequence

ACUGGGCAGGGCUGUGGUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-6872 directly targets SLC25A16 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6872 miRNA Mature ID miR-6872-3p

miRNA Sequence

CCCAUGCCUCCUGCCGCGGUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon58

miR-6880 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-744 directly targets SLC25A16 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

CUGUUGCCACUAACCUCAACCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon60

miR-766 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-7703 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7703 miRNA Mature ID miR-7703

miRNA Sequence

UUGCACUCUGGCCUUCUCCCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-7847 directly targets SLC25A16 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-8055 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8055 miRNA Mature ID miR-8055

miRNA Sequence

CUUUGAGCACAUGAGCAGACGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-8082 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8082 miRNA Mature ID miR-8082

miRNA Sequence

UGAUGGAGCUGGGAAUACUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon65

miR-924 directly targets SLC25A16 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-924 miRNA Mature ID miR-924

miRNA Sequence

AGAGUCUUGUGAUGUCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-92a directly targets SLC25A16 [ 18 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon67

miR-92b directly targets SLC25A16 [ 18 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-939 directly targets SLC25A16 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-939 miRNA Mature ID miR-939-3p

miRNA Sequence

CCCUGGGCCUCUGCUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
14 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
15 Ago HITS-CLIP expands understanding of Kaposi's sarcoma-associated herpesvirus miRNA function in primary effusion lymphomas. PLoS Pathog. 2012;8(8):e1002884.
16 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
17 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
18 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
19 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
20 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
21 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.