General Information of Drug Transporter (DT)
DT ID DTD0165 Transporter Info
Gene Name SLC24A4
Transporter Name Sodium/potassium/calcium exchanger 4
Gene ID
123041
UniProt ID
Q8NFF2
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in bladder cancer [ 1 ]

Location

TSS1500 (cg07031872)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.10E-05; Z-score:-4.91E+00

Methylation in Case

3.41E-01 (Median) Methylation in Control 5.21E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC24A4 in bladder cancer [ 1 ]

Location

TSS1500 (cg12159314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.80E+00 Statistic Test p-value:1.93E-05; Z-score:-3.99E+00

Methylation in Case

2.14E-01 (Median) Methylation in Control 3.84E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in breast cancer [ 2 ]

Location

TSS1500 (cg12159314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:7.40E-08; Z-score:-1.63E+00

Methylation in Case

4.36E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg24195486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.50E+00 Statistic Test p-value:2.90E-06; Z-score:2.87E+00

Methylation in Case

4.39E-01 (Median) Methylation in Control 2.93E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC24A4 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg07031872)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:8.83E-03; Z-score:1.04E+00

Methylation in Case

5.86E-01 (Median) Methylation in Control 5.34E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC24A4 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg12159314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.13E-02; Z-score:1.79E+00

Methylation in Case

4.41E-01 (Median) Methylation in Control 3.62E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in colon adenocarcinoma [ 4 ]

Location

TSS1500 (cg16729160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.67E+00 Statistic Test p-value:1.70E-03; Z-score:2.46E+00

Methylation in Case

1.46E-01 (Median) Methylation in Control 8.72E-02 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC24A4 in colon adenocarcinoma [ 4 ]

Location

TSS200 (cg26230285)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:2.86E-06; Z-score:1.29E+00

Methylation in Case

6.38E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC24A4 in colon adenocarcinoma [ 4 ]

Location

1stExon (cg24933645)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.84E+00 Statistic Test p-value:1.31E-03; Z-score:2.41E+00

Methylation in Case

3.77E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg07031872)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:3.33E-06; Z-score:-1.80E+00

Methylation in Case

3.79E-01 (Median) Methylation in Control 4.95E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC24A4 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg24195486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:2.66E-05; Z-score:-1.55E+00

Methylation in Case

3.31E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC24A4 in hepatocellular carcinoma [ 5 ]

Location

3'UTR (cg07046101)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.75E+00 Statistic Test p-value:6.57E-22; Z-score:-3.74E+00

Methylation in Case

2.68E-01 (Median) Methylation in Control 4.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in lung adenocarcinoma [ 6 ]

Location

TSS1500 (cg07031872)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:9.57E-04; Z-score:2.83E+00

Methylation in Case

6.74E-01 (Median) Methylation in Control 5.72E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC24A4 in lung adenocarcinoma [ 6 ]

Location

TSS1500 (cg24195486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.79E-03; Z-score:2.68E+00

Methylation in Case

5.55E-01 (Median) Methylation in Control 4.29E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg12159314)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:2.29E-03; Z-score:-1.34E+00

Methylation in Case

2.98E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC24A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

TSS200 (cg21609339)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.66E+00 Statistic Test p-value:2.67E-34; Z-score:5.97E+00

Methylation in Case

4.09E-01 (Median) Methylation in Control 2.46E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC24A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg06399135)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:4.68E-02; Z-score:-6.01E-01

Methylation in Case

3.24E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Posterior fossa ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC24A4 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.51E-31; Fold-change:-0.293272513; Z-score:-1.480604431
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Atypical teratoid rhabdoid tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC24A4 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.28E-11; Fold-change:0.369033663; Z-score:1.737754544
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Third ventricle chordoid glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC24A4 in third ventricle chordoid glioma than that in healthy individual

Studied Phenotype

Third ventricle chordoid glioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.002597994; Fold-change:0.499831732; Z-score:1.395004734
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Squamous cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC24A4 in squamous cell carcinoma than that in adjacent tissue

Studied Phenotype

Squamous cell carcinoma [ICD-11:2B60]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:0.000450496; Fold-change:-0.206546904; Z-score:-2.845257313
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

microRNA

  Unclear Phenotype

       103 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-10a directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-10b directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1247 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1270 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1270 miRNA Mature ID miR-1270

miRNA Sequence

CUGGAGAUAUGGAAGAGCUGUGU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon5

miR-1285 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1285 miRNA Mature ID miR-1285-3p

miRNA Sequence

UCUGGGCAACAAAGUGAGACCU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon6

miR-1292 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1292 miRNA Mature ID miR-1292-3p

miRNA Sequence

UCGCGCCCCGGCUCCCGUUC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon7

miR-1324 directly targets SLC24A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1324 miRNA Mature ID miR-1324

miRNA Sequence

CCAGACAGAAUUCUAUGCACUUUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-140 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-140 miRNA Mature ID miR-140-3p

miRNA Sequence

UACCACAGGGUAGAACCACGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-1827 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

UGAGGCAGUAGAUUGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-183 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-183 miRNA Mature ID miR-183-5p

miRNA Sequence

UAUGGCACUGGUAGAAUUCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-18b directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-18b miRNA Mature ID miR-18b-3p

miRNA Sequence

UGCCCUAAAUGCCCCUUCUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-196a directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-196a miRNA Mature ID miR-196a-3p

miRNA Sequence

CGGCAACAAGAAACUGCCUGAG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon13

miR-20b directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-3p

miRNA Sequence

ACUGUAGUAUGGGCACUUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-2114 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2114 miRNA Mature ID miR-2114-5p

miRNA Sequence

UAGUCCCUUCCUUGAAGCGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-2467 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2467 miRNA Mature ID miR-2467-5p

miRNA Sequence

UGAGGCUCUGUUAGCCUUGGCUC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon16

miR-27b directly targets SLC24A4 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-27b miRNA Mature ID miR-27b-5p

miRNA Sequence

AGAGCUUAGCUGAUUGGUGAAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-3166 directly targets SLC24A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3166 miRNA Mature ID miR-3166

miRNA Sequence

CGCAGACAAUGCCUACUGGCCUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-3187 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-5p

miRNA Sequence

CCUGGGCAGCGUGUGGCUGAAGG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon19

miR-3188 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3188 miRNA Mature ID miR-3188

miRNA Sequence

AGAGGCUUUGUGCGGAUACGGGG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon20

miR-339 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-3613 directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-3664 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3664 miRNA Mature ID miR-3664-3p

miRNA Sequence

UCUCAGGAGUAAAGACAGAGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-371a directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

ACUCAAACUGUGGGGGCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-371b directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-372 directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-373 directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-377 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-3914 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3914 miRNA Mature ID miR-3914

miRNA Sequence

AAGGAACCAGAAAAUGAGAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-3975 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3975 miRNA Mature ID miR-3975

miRNA Sequence

UGAGGCUAAUGCACUACUUCAC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon30

miR-4252 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

GGCCACUGAGUCAGCACCA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon31

miR-4302 directly targets SLC24A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4302 miRNA Mature ID miR-4302

miRNA Sequence

CCAGUGUGGCUCAGCGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon32

miR-4310 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4310 miRNA Mature ID miR-4310

miRNA Sequence

GCAGCAUUCAUGUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-4316 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4316 miRNA Mature ID miR-4316

miRNA Sequence

GGUGAGGCUAGCUGGUG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon34

miR-4421 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4421 miRNA Mature ID miR-4421

miRNA Sequence

ACCUGUCUGUGGAAAGGAGCUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-4426 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4426 miRNA Mature ID miR-4426

miRNA Sequence

GAAGAUGGACGUACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-4509 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4509 miRNA Mature ID miR-4509

miRNA Sequence

ACUAAAGGAUAUAGAAGGUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-455 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-4647 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4647 miRNA Mature ID miR-4647

miRNA Sequence

GAAGAUGGUGCUGUGCUGAGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-4649 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4649 miRNA Mature ID miR-4649-3p

miRNA Sequence

UCUGAGGCCUGCCUCUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-4662b directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4662b miRNA Mature ID miR-4662b

miRNA Sequence

AAAGAUGGACAAUUGGCUAAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-4668 directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4668 miRNA Mature ID miR-4668-5p

miRNA Sequence

AGGGAAAAAAAAAAGGAUUUGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-4683 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4683 miRNA Mature ID miR-4683

miRNA Sequence

UGGAGAUCCAGUGCUCGCCCGAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon43

miR-4695 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4695 miRNA Mature ID miR-4695-5p

miRNA Sequence

CAGGAGGCAGUGGGCGAGCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-4722 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-4733 directly targets SLC24A4 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4733 miRNA Mature ID miR-4733-5p

miRNA Sequence

AAUCCCAAUGCUAGACCCGGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon46

miR-4768 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-4793 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4793 miRNA Mature ID miR-4793-3p

miRNA Sequence

UCUGCACUGUGAGUUGGCUGGCU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon48

miR-4797 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4797 miRNA Mature ID miR-4797-5p

miRNA Sequence

GACAGAGUGCCACUUACUGAA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon49

miR-485 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon50

miR-5008 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5008 miRNA Mature ID miR-5008-5p

miRNA Sequence

UGAGGCCCUUGGGGCACAGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-508 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-508 miRNA Mature ID miR-508-5p

miRNA Sequence

UACUCCAGAGGGCGUCACUCAUG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon52

miR-510 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-510 miRNA Mature ID miR-510-3p

miRNA Sequence

AUUGAAACCUCUAAGAGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-510 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-510 miRNA Mature ID miR-510-5p

miRNA Sequence

UACUCAGGAGAGUGGCAAUCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-5189 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5189 miRNA Mature ID miR-5189-5p

miRNA Sequence

UCUGGGCACAGGCGGAUGGACAGG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon55

miR-5197 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-548aa directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-548ap directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548ap miRNA Mature ID miR-548ap-3p

miRNA Sequence

AAAAACCACAAUUACUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-548as directly targets SLC24A4 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548as miRNA Mature ID miR-548as-3p

miRNA Sequence

UAAAACCCACAAUUAUGUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon59

miR-548at directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548at miRNA Mature ID miR-548at-3p

miRNA Sequence

CAAAACCGCAGUAACUUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon60

miR-548ay directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548ay miRNA Mature ID miR-548ay-3p

miRNA Sequence

CAAAACCGCGAUUACUCUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-548t directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-556 directly targets SLC24A4 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-556 miRNA Mature ID miR-556-5p

miRNA Sequence

GAUGAGCUCAUUGUAAUAUGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon63

miR-5586 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5586 miRNA Mature ID miR-5586-3p

miRNA Sequence

CAGAGUGACAAGCUGGUUAAAG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon64

miR-5588 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5588 miRNA Mature ID miR-5588-3p

miRNA Sequence

AAGUCCCACUAAUGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon65

miR-561 directly targets SLC24A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-561 miRNA Mature ID miR-561-5p

miRNA Sequence

AUCAAGGAUCUUAAACUUUGCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon66

miR-5690 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5690 miRNA Mature ID miR-5690

miRNA Sequence

UCAGCUACUACCUCUAUUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon67

miR-5699 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5699 miRNA Mature ID miR-5699-3p

miRNA Sequence

UCCUGUCUUUCCUUGUUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-593 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-593 miRNA Mature ID miR-593-5p

miRNA Sequence

AGGCACCAGCCAGGCAUUGCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon69

miR-6086 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon70

miR-6089 directly targets SLC24A4 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6089 miRNA Mature ID miR-6089

miRNA Sequence

GGAGGCCGGGGUGGGGCGGGGCGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon71

miR-612 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-612 miRNA Mature ID miR-612

miRNA Sequence

GCUGGGCAGGGCUUCUGAGCUCCUU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon72

miR-616 directly targets SLC24A4 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon73

miR-620 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-620 miRNA Mature ID miR-620

miRNA Sequence

AUGGAGAUAGAUAUAGAAAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon74

miR-6499 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon75

miR-6512 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon76

miR-6516 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon77

miR-658 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-658 miRNA Mature ID miR-658

miRNA Sequence

GGCGGAGGGAAGUAGGUCCGUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon78

miR-661 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-661 miRNA Mature ID miR-661

miRNA Sequence

UGCCUGGGUCUCUGGCCUGCGCGU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon79

miR-665 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon80

miR-6720 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon81

miR-6720 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6720 miRNA Mature ID miR-6720-3p

miRNA Sequence

CGCGCCUGCAGGAACUGGUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon82

miR-6746 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6746 miRNA Mature ID miR-6746-5p

miRNA Sequence

CCGGGAGAAGGAGGUGGCCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon83

miR-6771 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6771 miRNA Mature ID miR-6771-5p

miRNA Sequence

CUCGGGAGGGCAUGGGCCAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon84

miR-6776 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6776 miRNA Mature ID miR-6776-3p

miRNA Sequence

CAACCACCACUGUCUCUCCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon85

miR-6801 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6801 miRNA Mature ID miR-6801-5p

miRNA Sequence

UGGUCAGAGGCAGCAGGAAAUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon86

miR-6807 directly targets SLC24A4 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon87

miR-6808 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon88

miR-6828 directly targets SLC24A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6828 miRNA Mature ID miR-6828-5p

miRNA Sequence

AGGAAGCAAGAGAACCCUGUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon89

miR-6830 directly targets SLC24A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6830 miRNA Mature ID miR-6830-5p

miRNA Sequence

CCAAGGAAGGAGGCUGGACAUC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon90

miR-6849 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon91

miR-6851 directly targets SLC24A4 [ 17 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-3p

miRNA Sequence

UGGCCCUUUGUACCCCUCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon92

miR-6860 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6860 miRNA Mature ID miR-6860

miRNA Sequence

ACUGGGCAGGGCUGUGGUGAGU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon93

miR-6884 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon94

miR-6893 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon95

miR-7157 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7157 miRNA Mature ID miR-7157-5p

miRNA Sequence

UCAGCAUUCAUUGGCACCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon96

miR-759 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-759 miRNA Mature ID miR-759

miRNA Sequence

GCAGAGUGCAAACAAUUUUGAC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon97

miR-766 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon98

miR-7703 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7703 miRNA Mature ID miR-7703

miRNA Sequence

UUGCACUCUGGCCUUCUCCCAGG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon99

miR-7977 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

UUCCCAGCCAACGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon100

miR-873 directly targets SLC24A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-873 miRNA Mature ID miR-873-5p

miRNA Sequence

GCAGGAACUUGUGAGUCUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon101

miR-939 directly targets SLC24A4 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-939 miRNA Mature ID miR-939-3p

miRNA Sequence

CCCUGGGCCUCUGCUCCCCAG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon102

miR-940 directly targets SLC24A4 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-940 miRNA Mature ID miR-940

miRNA Sequence

AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon103

miR-944 directly targets SLC24A4 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-944 miRNA Mature ID miR-944

miRNA Sequence

AAAUUAUUGUACAUCGGAUGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
10 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
11 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
12 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
13 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
14 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
15 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.