Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0117 Transporter Info
Gene Name	SLC17A4
Transporter Name	Probable small intestine urate exporter
Gene ID	10050
UniProt ID	Q9Y2C5

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.94E-07; Z-score:-9.41E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	9.26E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg13261725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:5.58E-07; Z-score:-1.03E+00
Methylation in Case	7.44E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg27613749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.90E+00	Statistic Test	p-value:1.40E-05; Z-score:-1.09E+00
Methylation in Case	1.49E-01 (Median)	Methylation in Control	2.83E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg06996739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.17E-03; Z-score:6.61E-01
Methylation in Case	8.40E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg08794539)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.88E+00	Statistic Test	p-value:7.96E-03; Z-score:-6.56E-01
Methylation in Case	4.91E-02 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC17A4 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg22865713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.44E+00	Statistic Test	p-value:6.49E-10; Z-score:-1.63E+00
Methylation in Case	4.61E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	5'UTR (cg13261725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:3.40E-04; Z-score:-4.14E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	5'UTR (cg27613749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:5.23E-04; Z-score:-5.94E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:3.82E-03; Z-score:-1.82E+00
Methylation in Case	6.55E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	TSS1500 (cg04083466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.77E+00	Statistic Test	p-value:2.96E-14; Z-score:-1.96E+01
Methylation in Case	4.74E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	TSS1500 (cg15916061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.63E+00	Statistic Test	p-value:5.22E-09; Z-score:-6.51E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	TSS1500 (cg21627181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:1.04E-04; Z-score:-3.33E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	Body (cg16156617)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.01E+00	Statistic Test	p-value:3.80E-09; Z-score:-8.13E+00
Methylation in Case	2.93E-01 (Median)	Methylation in Control	5.91E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	Body (cg27087243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.64E+00	Statistic Test	p-value:1.13E-06; Z-score:-1.92E+01
Methylation in Case	4.25E-01 (Median)	Methylation in Control	6.95E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	Body (cg06996739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:9.36E-04; Z-score:-4.90E+00
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	Body (cg08794539)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:6.91E-03; Z-score:-1.83E+00
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC17A4 in bladder cancer			[ 2 ]
Location	3'UTR (cg22865713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.96E+00	Statistic Test	p-value:6.65E-05; Z-score:-3.99E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	3.09E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	5'UTR (cg13261725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:5.68E-08; Z-score:-1.74E+00
Methylation in Case	7.90E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:1.12E-07; Z-score:-1.31E+00
Methylation in Case	6.41E-01 (Median)	Methylation in Control	7.14E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	5'UTR (cg27613749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.28E-06; Z-score:-1.30E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg04083466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:6.29E-13; Z-score:-3.87E+00
Methylation in Case	7.48E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg15916061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:5.37E-08; Z-score:-2.44E+00
Methylation in Case	6.14E-01 (Median)	Methylation in Control	6.88E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	TSS1500 (cg21627181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:5.08E-06; Z-score:-1.21E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	Body (cg16156617)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.63E-04; Z-score:-1.36E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	Body (cg27087243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:2.70E-04; Z-score:-1.10E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC17A4 in breast cancer			[ 3 ]
Location	3'UTR (cg22865713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.08E-03; Z-score:1.18E+00
Methylation in Case	4.58E-01 (Median)	Methylation in Control	3.95E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in colorectal cancer			[ 4 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.87E-04; Z-score:-9.76E-01
Methylation in Case	8.39E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg21627181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.72E-02; Z-score:9.11E-01
Methylation in Case	7.33E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in colorectal cancer			[ 4 ]
Location	Body (cg27087243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.65E-05; Z-score:-1.19E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in colorectal cancer			[ 4 ]
Location	Body (cg16156617)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.55E-03; Z-score:-4.78E-01
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in colorectal cancer			[ 4 ]
Location	3'UTR (cg22865713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:2.11E-02; Z-score:-8.02E-01
Methylation in Case	6.73E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	5'UTR (cg27613749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:5.85E-08; Z-score:-1.58E+00
Methylation in Case	4.63E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg21627181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:9.77E-09; Z-score:-1.32E+00
Methylation in Case	4.87E-01 (Median)	Methylation in Control	5.71E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg15916061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.55E-04; Z-score:-1.26E+00
Methylation in Case	4.30E-01 (Median)	Methylation in Control	4.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg04083466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.65E-03; Z-score:-3.54E-01
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	1stExon (cg02192965)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.33E+00	Statistic Test	p-value:6.97E-12; Z-score:-2.91E+00
Methylation in Case	5.45E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg24756227)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.42E+00	Statistic Test	p-value:2.36E-14; Z-score:-2.80E+00
Methylation in Case	1.97E-01 (Median)	Methylation in Control	2.79E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg19204189)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:2.03E-12; Z-score:-6.56E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg00161124)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.53E+00	Statistic Test	p-value:2.89E-10; Z-score:-2.56E+00
Methylation in Case	3.17E-01 (Median)	Methylation in Control	4.86E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC17A4 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg27087243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:2.33E-06; Z-score:-1.73E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in HIV infection			[ 6 ]
Location	5'UTR (cg13261725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.88E-05; Z-score:-7.85E-01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in HIV infection			[ 6 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:5.73E-05; Z-score:-1.35E+00
Methylation in Case	7.24E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in HIV infection			[ 6 ]
Location	TSS1500 (cg15916061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.87E-03; Z-score:-1.24E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	8.00E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in HIV infection			[ 6 ]
Location	Body (cg16156617)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.18E-04; Z-score:-1.50E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in HIV infection			[ 6 ]
Location	Body (cg27087243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:8.02E-04; Z-score:-1.46E+00
Methylation in Case	7.62E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC17A4 in HIV infection			[ 6 ]
Location	3'UTR (cg22865713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:7.60E-04; Z-score:-1.21E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in lung adenocarcinoma			[ 7 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.30E-02; Z-score:-1.47E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	7.54E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in lung adenocarcinoma			[ 7 ]
Location	5'UTR (cg13261725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.14E-02; Z-score:-2.37E+00
Methylation in Case	8.32E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg04083466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.74E-02; Z-score:-2.57E+00
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in lung adenocarcinoma			[ 7 ]
Location	3'UTR (cg22865713)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.39E-02; Z-score:1.18E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	4.97E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in pancretic ductal adenocarcinoma			[ 8 ]
Location	5'UTR (cg10806146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:1.89E-06; Z-score:1.24E+00
Methylation in Case	5.12E-01 (Median)	Methylation in Control	3.61E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg23995605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:2.10E-04; Z-score:7.00E-01
Methylation in Case	9.09E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg13323701)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.39E+00	Statistic Test	p-value:3.31E-26; Z-score:7.44E+00
Methylation in Case	1.90E-01 (Median)	Methylation in Control	7.94E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg00961640)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:3.01E-10; Z-score:-2.06E+00
Methylation in Case	5.34E-01 (Median)	Methylation in Control	7.13E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS200 (cg21590311)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:5.85E-06; Z-score:1.15E+00
Methylation in Case	7.71E-02 (Median)	Methylation in Control	6.70E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC17A4 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg01040624)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:3.45E-11; Z-score:-2.29E+00
Methylation in Case	7.61E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg13261725)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:9.96E-05; Z-score:-5.46E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg09750510)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.72E-02; Z-score:-3.58E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in papillary thyroid cancer			[ 9 ]
Location	5'UTR (cg27613749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.30E-02; Z-score:-5.30E-01
Methylation in Case	9.30E-01 (Median)	Methylation in Control	9.39E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC17A4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg08794539)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.99E-02; Z-score:-3.16E-01
Methylation in Case	9.26E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC17A4 in papillary thyroid cancer			[ 9 ]
Location	Body (cg06996739)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.81E-02; Z-score:-5.09E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in celiac disease			[ 10 ]
Location	TSS1500 (cg04083466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:3.53E-03; Z-score:8.67E-01
Methylation in Case	8.13E-01 (Median)	Methylation in Control	6.45E-01 (Median)
Studied Phenotype	Celiac disease[ ICD-11:DA95]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in depression			[ 11 ]
Location	TSS1500 (cg21627181)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.30E-02; Z-score:-3.31E-01
Methylation in Case	7.89E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in panic disorder			[ 12 ]
Location	Body (cg27087243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:6.12E-03; Z-score:3.74E-01
Methylation in Case	2.02E+00 (Median)	Methylation in Control	1.90E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in prostate cancer			[ 13 ]
Location	Body (cg16812174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.55E+00	Statistic Test	p-value:1.32E-02; Z-score:-2.87E+00
Methylation in Case	5.51E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC17A4 in prostate cancer			[ 13 ]
Location	Body (cg03216475)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:4.98E-02; Z-score:1.75E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	7.52E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC17A4 in prostate cancer			[ 13 ]
Location	Body (cg13939166)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.00E-02; Z-score:1.44E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC17A4 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg16156617)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.67E-02; Z-score:-1.27E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-128 directly targets SLC17A4			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-128	miRNA Mature ID	miR-128-3p
miRNA Sequence	UCACAGUGAACCGGUCUCUUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
11	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence