Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0109 Transporter Info
Gene Name	SLC16A5
Transporter Name	Monocarboxylate transporter 6
Gene ID	9121
UniProt ID	O15375

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg03732506)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.97E-08; Z-score:-1.32E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04305621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.49E+00	Statistic Test	p-value:2.89E-08; Z-score:1.69E+00
Methylation in Case	7.02E-01 (Median)	Methylation in Control	4.72E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:3.44E-08; Z-score:1.27E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	6.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg08434692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:1.34E-07; Z-score:1.38E+00
Methylation in Case	7.29E-01 (Median)	Methylation in Control	5.40E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg09300114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:1.76E-07; Z-score:-1.05E+00
Methylation in Case	4.00E-01 (Median)	Methylation in Control	5.45E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg10829727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.37E-07; Z-score:-1.08E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg17058616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.12E-10; Z-score:-1.79E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in bladder cancer			[ 2 ]
Location	5'UTR (cg03732506)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:2.05E-08; Z-score:-8.55E+00
Methylation in Case	4.55E-01 (Median)	Methylation in Control	6.60E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in bladder cancer			[ 2 ]
Location	5'UTR (cg08434692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.37E+00	Statistic Test	p-value:1.07E-07; Z-score:-1.49E+01
Methylation in Case	6.29E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in bladder cancer			[ 2 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:2.46E-03; Z-score:-7.76E+00
Methylation in Case	2.23E-01 (Median)	Methylation in Control	3.54E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in bladder cancer			[ 2 ]
Location	Body (cg17749454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.88E+00	Statistic Test	p-value:1.28E-03; Z-score:-2.80E+00
Methylation in Case	1.95E-01 (Median)	Methylation in Control	3.65E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in bladder cancer			[ 2 ]
Location	Body (cg15190451)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:4.22E-03; Z-score:-5.12E+00
Methylation in Case	6.13E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in bladder cancer			[ 2 ]
Location	3'UTR (cg17058616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.63E-02; Z-score:-1.41E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	5.44E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	5'UTR (cg08434692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.73E-11; Z-score:-2.39E+00
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	5'UTR (cg10829727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:1.07E-02; Z-score:-2.01E-01
Methylation in Case	1.53E-01 (Median)	Methylation in Control	1.63E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.08E-02; Z-score:9.14E-01
Methylation in Case	4.00E-01 (Median)	Methylation in Control	3.46E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	5'UTR (cg09300114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.95E-02; Z-score:-9.59E-02
Methylation in Case	2.38E-01 (Median)	Methylation in Control	2.46E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg02701825)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:2.60E-07; Z-score:1.72E+00
Methylation in Case	2.73E-01 (Median)	Methylation in Control	1.96E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg06594281)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.31E-06; Z-score:5.11E-01
Methylation in Case	1.06E-01 (Median)	Methylation in Control	9.09E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	TSS1500 (cg13424870)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:1.40E-05; Z-score:1.20E-01
Methylation in Case	5.65E-02 (Median)	Methylation in Control	5.42E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	TSS200 (cg17733616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:3.94E-06; Z-score:1.79E-01
Methylation in Case	2.14E-02 (Median)	Methylation in Control	1.55E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	TSS200 (cg21306329)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.97E-06; Z-score:2.57E-02
Methylation in Case	5.06E-02 (Median)	Methylation in Control	4.92E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	TSS200 (cg27619475)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:1.44E-05; Z-score:2.83E-01
Methylation in Case	1.01E-01 (Median)	Methylation in Control	8.62E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	Body (cg17749454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:3.98E-06; Z-score:-1.87E+00
Methylation in Case	5.04E-01 (Median)	Methylation in Control	5.95E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	Body (cg15190451)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:8.93E-06; Z-score:1.38E+00
Methylation in Case	7.46E-01 (Median)	Methylation in Control	5.79E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC16A5 in breast cancer			[ 3 ]
Location	3'UTR (cg17058616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:9.33E-09; Z-score:-2.35E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	6.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in celiac disease			[ 4 ]
Location	5'UTR (cg04305621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.22E+00	Statistic Test	p-value:1.75E-02; Z-score:1.12E+00
Methylation in Case	1.38E-01 (Median)	Methylation in Control	6.20E-02 (Median)
Studied Phenotype	Celiac disease[ ICD-11:DA95]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg10829727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.39E+00	Statistic Test	p-value:1.74E-04; Z-score:1.31E+00
Methylation in Case	1.85E-01 (Median)	Methylation in Control	1.33E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:4.90E-03; Z-score:1.61E+00
Methylation in Case	5.78E-01 (Median)	Methylation in Control	4.72E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg04305621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:1.57E-02; Z-score:1.58E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	3.12E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg27619475)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-3.44E+00	Statistic Test	p-value:2.50E-02; Z-score:-2.18E+00
Methylation in Case	9.22E-02 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in colorectal cancer			[ 6 ]
Location	5'UTR (cg08434692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:9.10E-04; Z-score:-5.99E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in colorectal cancer			[ 6 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:9.39E-03; Z-score:-5.15E-01
Methylation in Case	3.73E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg02701825)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:4.82E-02; Z-score:-7.07E-01
Methylation in Case	1.19E-01 (Median)	Methylation in Control	1.52E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in colorectal cancer			[ 6 ]
Location	3'UTR (cg17058616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:3.93E-02; Z-score:6.06E-01
Methylation in Case	7.04E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
HIV infection	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:5.63E-08; Z-score:2.43E+00
Methylation in Case	4.23E-01 (Median)	Methylation in Control	2.97E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	5'UTR (cg09300114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.59E+00	Statistic Test	p-value:4.77E-06; Z-score:2.34E+00
Methylation in Case	2.53E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	5'UTR (cg04305621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.97E+00	Statistic Test	p-value:5.64E-06; Z-score:2.40E+00
Methylation in Case	1.60E-01 (Median)	Methylation in Control	8.08E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	5'UTR (cg10829727)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:2.13E-04; Z-score:1.62E+00
Methylation in Case	1.51E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	5'UTR (cg08434692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.28E-02; Z-score:-9.89E-01
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	TSS1500 (cg02701825)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.51E+00	Statistic Test	p-value:1.07E-07; Z-score:2.93E+00
Methylation in Case	2.79E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	TSS200 (cg21306329)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:2.32E-03; Z-score:1.07E+00
Methylation in Case	4.44E-02 (Median)	Methylation in Control	3.25E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	TSS200 (cg27619475)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:2.33E-03; Z-score:1.25E+00
Methylation in Case	8.82E-02 (Median)	Methylation in Control	6.99E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	TSS200 (cg17733616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.62E+00	Statistic Test	p-value:1.87E-02; Z-score:1.15E+00
Methylation in Case	1.67E-02 (Median)	Methylation in Control	1.03E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	Body (cg17749454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:5.43E-03; Z-score:5.44E-01
Methylation in Case	8.93E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC16A5 in HIV infection			[ 7 ]
Location	Body (cg24328816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.04E-02; Z-score:-6.88E-01
Methylation in Case	8.67E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg03732506)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:1.29E-02; Z-score:1.38E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	7.03E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:3.55E-02; Z-score:1.06E+00
Methylation in Case	4.85E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg06594281)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.25E-02; Z-score:2.27E+00
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg17733616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.92E+00	Statistic Test	p-value:9.40E-03; Z-score:5.03E+00
Methylation in Case	3.86E-02 (Median)	Methylation in Control	2.01E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg27619475)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:1.28E-02; Z-score:2.62E+00
Methylation in Case	1.45E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg21306329)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:1.57E-02; Z-score:3.31E+00
Methylation in Case	7.20E-02 (Median)	Methylation in Control	5.11E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	Body (cg15190451)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:7.92E-04; Z-score:1.63E+00
Methylation in Case	8.93E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC16A5 in lung adenocarcinoma			[ 8 ]
Location	Body (cg17749454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:5.19E-03; Z-score:3.46E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	5.01E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg22123464)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.77E+00	Statistic Test	p-value:1.03E-10; Z-score:1.95E+00
Methylation in Case	5.40E-01 (Median)	Methylation in Control	3.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg18703983)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:5.58E-09; Z-score:-1.89E+00
Methylation in Case	6.08E-01 (Median)	Methylation in Control	7.66E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg05348973)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:6.42E-09; Z-score:-2.01E+00
Methylation in Case	2.11E-01 (Median)	Methylation in Control	3.36E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg13598409)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.63E+00	Statistic Test	p-value:1.08E-10; Z-score:-2.21E+00
Methylation in Case	1.53E-01 (Median)	Methylation in Control	2.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg00858400)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.39E+00	Statistic Test	p-value:2.54E-10; Z-score:-2.02E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	7.22E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg02481956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:4.36E-02; Z-score:8.80E-01
Methylation in Case	6.66E-01 (Median)	Methylation in Control	6.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg13609667)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.43E-13; Z-score:8.21E-01
Methylation in Case	5.73E-02 (Median)	Methylation in Control	4.97E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg09321400)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.80E+00	Statistic Test	p-value:1.28E-09; Z-score:2.05E+00
Methylation in Case	4.71E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg04867634)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:2.31E-03; Z-score:1.16E+00
Methylation in Case	9.07E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg25098478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:5.09E-19; Z-score:-3.44E+00
Methylation in Case	4.90E-01 (Median)	Methylation in Control	6.18E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg24948829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.24E-03; Z-score:9.32E-01
Methylation in Case	7.94E-01 (Median)	Methylation in Control	7.72E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC16A5 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg11595270)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:6.08E-03; Z-score:-6.70E-01
Methylation in Case	6.77E-01 (Median)	Methylation in Control	7.09E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in panic disorder			[ 10 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.15E-01	Statistic Test	p-value:2.90E-04; Z-score:-5.48E-01
Methylation in Case	-2.01E+00 (Median)	Methylation in Control	-1.84E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in panic disorder			[ 10 ]
Location	Body (cg24328816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:3.90E-03; Z-score:7.31E-01
Methylation in Case	2.84E+00 (Median)	Methylation in Control	2.50E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in panic disorder			[ 10 ]
Location	3'UTR (cg17058616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.24E-02; Z-score:-2.93E-01
Methylation in Case	2.38E+00 (Median)	Methylation in Control	2.48E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg04529938)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:2.69E-03; Z-score:7.55E-01
Methylation in Case	3.39E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg08434692)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.12E-02; Z-score:-3.27E-01
Methylation in Case	9.37E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg04305621)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.12E+00	Statistic Test	p-value:4.05E-02; Z-score:4.65E-01
Methylation in Case	2.12E-01 (Median)	Methylation in Control	1.89E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg17733616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.98E-02; Z-score:2.47E-01
Methylation in Case	4.00E-02 (Median)	Methylation in Control	3.75E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg21306329)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.90E-02; Z-score:1.64E-01
Methylation in Case	6.79E-02 (Median)	Methylation in Control	6.52E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	Body (cg15190451)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:3.21E-03; Z-score:9.09E-01
Methylation in Case	6.78E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in papillary thyroid cancer			[ 11 ]
Location	3'UTR (cg17058616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:5.93E-11; Z-score:-1.99E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg05914069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:7.76E-04; Z-score:-1.49E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg24615189)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:2.29E-03; Z-score:1.35E+00
Methylation in Case	5.86E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in colon adenocarcinoma			[ 12 ]
Location	Body (cg16660661)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.42E+00	Statistic Test	p-value:4.99E-05; Z-score:7.34E+00
Methylation in Case	3.58E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in colon adenocarcinoma			[ 12 ]
Location	Body (cg17559156)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.54E-03; Z-score:-1.91E+00
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	TSS1500 (cg23677272)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.38E+00	Statistic Test	p-value:1.87E-14; Z-score:-2.84E+00
Methylation in Case	3.57E-01 (Median)	Methylation in Control	4.93E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	TSS200 (cg19247841)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.70E+00	Statistic Test	p-value:1.53E-17; Z-score:8.63E+00
Methylation in Case	4.21E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:1.95E-14; Z-score:2.27E+00
Methylation in Case	7.32E-01 (Median)	Methylation in Control	6.12E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg26169668)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:2.07E-15; Z-score:-4.63E+00
Methylation in Case	4.23E-01 (Median)	Methylation in Control	6.71E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg06883373)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.51E+00	Statistic Test	p-value:1.99E-14; Z-score:-1.32E+01
Methylation in Case	5.46E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg08038231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:1.04E-13; Z-score:-9.07E+00
Methylation in Case	6.43E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg04460816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:6.55E-11; Z-score:2.03E+00
Methylation in Case	5.72E-01 (Median)	Methylation in Control	4.91E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg17749454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.52E+00	Statistic Test	p-value:1.03E-08; Z-score:-1.25E+00
Methylation in Case	3.07E-01 (Median)	Methylation in Control	4.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg15190451)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.09E-03; Z-score:1.59E+00
Methylation in Case	9.51E-01 (Median)	Methylation in Control	8.71E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg24328816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.64E-03; Z-score:-1.29E-01
Methylation in Case	8.40E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC16A5 in hepatocellular carcinoma			[ 13 ]
Location	Body (cg21853806)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:3.27E-03; Z-score:-1.68E-01
Methylation in Case	8.11E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in systemic lupus erythematosus			[ 14 ]
Location	TSS200 (cg27619475)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:8.09E-04; Z-score:-7.54E-02
Methylation in Case	8.79E-02 (Median)	Methylation in Control	9.02E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in systemic lupus erythematosus			[ 14 ]
Location	TSS200 (cg21306329)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:8.61E-03; Z-score:-8.12E-02
Methylation in Case	2.79E-02 (Median)	Methylation in Control	2.92E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC16A5 in systemic lupus erythematosus			[ 14 ]
Location	TSS200 (cg17733616)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.26E-02; Z-score:-4.40E-02
Methylation in Case	1.34E-02 (Median)	Methylation in Control	1.38E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC16A5 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg15190451)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:5.00E-02; Z-score:-1.12E-01
Methylation in Case	9.63E-01 (Median)	Methylation in Control	9.64E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC16A5 in prostate cancer			[ 15 ]
Location	Body (cg11712506)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.58E+00	Statistic Test	p-value:1.88E-02; Z-score:-1.74E+00
Methylation in Case	1.31E-01 (Median)	Methylation in Control	2.06E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC16A5 in prostate cancer			[ 15 ]
Location	Body (cg14008399)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.99E-02; Z-score:1.52E+00
Methylation in Case	9.53E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Neuroblastoma of adrenal gland	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC16A5 in neuroblastoma of adrenal gland (compare with the control adrenal medullas)			[ 16 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Studied Phenotype	Neuroblastoma of adrenal gland[ ICD-11:2D11.2]
Frequency	19 (73%) out of the 26 studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	The patients with Hypomethylation of SLC16A5 and Hypermethylation of ZNF206 had a significantly prolonged eventfree survival compared with other patients.
microRNA
Unclear Phenotype	34 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-122 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-1236 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1236	miRNA Mature ID	miR-1236-3p
miRNA Sequence	CCUCUUCCCCUUGUCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-143 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-5p
miRNA Sequence	GGUGCAGUGCUGCAUCUCUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-145 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-145	miRNA Mature ID	miR-145-5p
miRNA Sequence	GUCCAGUUUUCCCAGGAAUCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-197 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-197	miRNA Mature ID	miR-197-3p
miRNA Sequence	UUCACCACCUUCUCCACCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon6	miR-204 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-204	miRNA Mature ID	miR-204-5p
miRNA Sequence	UUCCCUUUGUCAUCCUAUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon7	miR-211 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-211	miRNA Mature ID	miR-211-5p
miRNA Sequence	UUCCCUUUGUCAUCCUUCGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon8	miR-215 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-215	miRNA Mature ID	miR-215-3p
miRNA Sequence	UCUGUCAUUUCUUUAGGCCAAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-3119 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3119	miRNA Mature ID	miR-3119
miRNA Sequence	UGGCUUUUAACUUUGAUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-3124 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3124	miRNA Mature ID	miR-3124-3p
miRNA Sequence	ACUUUCCUCACUCCCGUGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon11	miR-3135b directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3135b	miRNA Mature ID	miR-3135b
miRNA Sequence	GGCUGGAGCGAGUGCAGUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-3183 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3183	miRNA Mature ID	miR-3183
miRNA Sequence	GCCUCUCUCGGAGUCGCUCGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon13	miR-3614 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3614	miRNA Mature ID	miR-3614-5p
miRNA Sequence	CCACUUGGAUCUGAAGGCUGCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-3650 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3650	miRNA Mature ID	miR-3650
miRNA Sequence	AGGUGUGUCUGUAGAGUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon15	miR-3652 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3652	miRNA Mature ID	miR-3652
miRNA Sequence	CGGCUGGAGGUGUGAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-3925 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3925	miRNA Mature ID	miR-3925-3p
miRNA Sequence	ACUCCAGUUUUAGUUCUCUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon17	miR-4430 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4430	miRNA Mature ID	miR-4430
miRNA Sequence	AGGCUGGAGUGAGCGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-4446 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4446	miRNA Mature ID	miR-4446-5p
miRNA Sequence	AUUUCCCUGCCAUUCCCUUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-4723 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4723	miRNA Mature ID	miR-4723-3p
miRNA Sequence	CCCUCUCUGGCUCCUCCCCAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon20	miR-5006 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5006	miRNA Mature ID	miR-5006-3p
miRNA Sequence	UUUCCCUUUCCAUCCUGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon21	miR-504 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-504	miRNA Mature ID	miR-504-3p
miRNA Sequence	GGGAGUGCAGGGCAGGGUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-5195 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5195	miRNA Mature ID	miR-5195-3p
miRNA Sequence	AUCCAGUUCUCUGAGGGGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-5698 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-593 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-593	miRNA Mature ID	miR-593-3p
miRNA Sequence	UGUCUCUGCUGGGGUUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-623 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-623	miRNA Mature ID	miR-623
miRNA Sequence	AUCCCUUGCAGGGGCUGUUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon26	miR-624 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-624	miRNA Mature ID	miR-624-3p
miRNA Sequence	CACAAGGUAUUGGUAUUACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon27	miR-6499 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon28	miR-6773 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6773	miRNA Mature ID	miR-6773-3p
miRNA Sequence	ACUGUCACUUCUCUGCCCAUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-6832 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-3p
miRNA Sequence	ACCCUUUUUCUCUUUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-6879 directly targets SLC16A5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6879	miRNA Mature ID	miR-6879-3p
miRNA Sequence	UGUCACCCGCUCCUUGCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-6881 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6881	miRNA Mature ID	miR-6881-3p
miRNA Sequence	AUCCUCUUUCGUCCUUCCCACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-7111 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-3p
miRNA Sequence	AUCCUCUCUUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-766 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-3p
miRNA Sequence	ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-877 directly targets SLC16A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-877	miRNA Mature ID	miR-877-3p
miRNA Sequence	UCCUCUUCUCCCUCCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	Identification of aberrant methylation regions in neuroblastoma by screening of tissue-specific differentially methylated regions. Pediatr Blood Cancer. 2013 Mar;60(3):383-9.
17	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
18	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence