Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0107 Transporter Info
Gene Name SLC16A3
Transporter Name Monocarboxylate transporter 4
Gene ID
9123
UniProt ID
O15427
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in bladder cancer [ 1 ]

Location

 TSS1500 (cg23141183)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.15E+00 Statistic Test p-value:5.12E-06; Z-score:-7.74E+00

Methylation in Case

 7.70E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Bladder cancer[ ICD-11:2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS1500 (cg23141183)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.02E+00 Statistic Test p-value:1.73E-04; Z-score:-2.71E+00

Methylation in Case

 9.61E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

 Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg23141183)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.03E+00 Statistic Test p-value:1.08E-07; Z-score:-2.17E+00

Methylation in Case

 9.09E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

 Colorectal cancer[ ICD-11:2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg23141183)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.00E+00 Statistic Test p-value:3.56E-02; Z-score:-4.74E-02

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in HIV infection [ 5 ]

Location

 TSS1500 (cg23141183)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:1.12E+00 Statistic Test p-value:1.02E-04; Z-score:2.55E+00

Methylation in Case

 8.47E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 HIV infection[ ICD-11:1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg23141183)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.01E+00 Statistic Test p-value:6.63E-04; Z-score:-4.92E-01

Methylation in Case

 9.44E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 Methylation of SLC16A3 in colon adenocarcinoma [ 7 ]

Location

 Body (cg06043886)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change:-1.07E+00 Statistic Test p-value:4.88E-05; Z-score:-3.66E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Colon cancer[ ICD-11:2B90]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          31 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

 miR-1226 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1226 miRNA Mature ID miR-1226-5p

miRNA Sequence

 GUGAGGGCAUGCAGGCCUGGAUGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon2

 miR-149 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

 AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon3

 miR-16 directly targets SLC16A3 [ 9 ]

Epigenetic Type

 microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon4

 miR-2115 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-2115 miRNA Mature ID miR-2115-5p

miRNA Sequence

 AGCUUCCAUGACUCCUGAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon5

 miR-3074 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3074 miRNA Mature ID miR-3074-5p

miRNA Sequence

 GUUCCUGCUGAACUGAGCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon6

 miR-3135a directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3135a miRNA Mature ID miR-3135a

miRNA Sequence

 UGCCUAGGCUGAGACUGCAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon7

 miR-3616 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3616 miRNA Mature ID miR-3616-3p

miRNA Sequence

 CGAGGGCAUUUCAUGAUGCAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon8

 miR-3677 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3677 miRNA Mature ID miR-3677-5p

miRNA Sequence

 CAGUGGCCAGAGCCCUGCAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon9

 miR-4274 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4274 miRNA Mature ID miR-4274

miRNA Sequence

 CAGCAGUCCCUCCCCCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon10

 miR-4519 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4519 miRNA Mature ID miR-4519

miRNA Sequence

 CAGCAGUGCGCAGGGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon11

 miR-4710 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4710 miRNA Mature ID miR-4710

miRNA Sequence

 GGGUGAGGGCAGGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon12

 miR-4721 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4721 miRNA Mature ID miR-4721

miRNA Sequence

 UGAGGGCUCCAGGUGACGGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon13

 miR-4722 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon14

 miR-4728 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

 UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon15

 miR-4740 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4740 miRNA Mature ID miR-4740-3p

miRNA Sequence

 GCCCGAGAGGAUCCGUCCCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon16

 miR-516a directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-516a miRNA Mature ID miR-516a-3p

miRNA Sequence

 UGCUUCCUUUCAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon17

 miR-516b directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-516b miRNA Mature ID miR-516b-3p

miRNA Sequence

 UGCUUCCUUUCAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon18

 miR-5693 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5693 miRNA Mature ID miR-5693

miRNA Sequence

 GCAGUGGCUCUGAAAUGAACUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon19

 miR-6727 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon20

 miR-6747 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon21

 miR-6783 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6783 miRNA Mature ID miR-6783-5p

miRNA Sequence

 UAGGGGAAAAGUCCUGAUCCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon22

 miR-6785 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

 UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon23

 miR-6804 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6804 miRNA Mature ID miR-6804-5p

miRNA Sequence

 UGAGGGUGUCAGCAGGUGACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon24

 miR-6824 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6824 miRNA Mature ID miR-6824-5p

miRNA Sequence

 GUAGGGGAGGUUGGGCCAGGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon25

 miR-6825 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

 UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon26

 miR-6883 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

 AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon27

 miR-6886 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6886 miRNA Mature ID miR-6886-5p

miRNA Sequence

 CCCGCAGGUGAGAUGAGGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon28

 miR-7160 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7160 miRNA Mature ID miR-7160-3p

miRNA Sequence

 CAGGGCCCUGGCUUUAGCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon29

 miR-7162 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7162 miRNA Mature ID miR-7162-5p

miRNA Sequence

 UGCUUCCUUUCUCAGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon30

 miR-873 directly targets SLC16A3 [ 8 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-873 miRNA Mature ID miR-873-3p

miRNA Sequence

 GGAGACUGAUGAGUUCCCGGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon31

 miR-98 directly targets SLC16A3 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
9 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
10 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.