General Information of Drug Transporter (DT)
DT ID DTD0096 Transporter Info
Gene Name SLC14A1
Transporter Name Urea transporter 1
Gene ID
6563
UniProt ID
Q13336
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC14A1 in Prostate cancer [ 1 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Bioinformatic analysis & experimental validation

Related Molecular Changes

Down regulation ofSLC14A1 Experiment Method Methylation-specific PCR,RT-qPCR, Western blot

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

PCa clinical samples & cell lines

Additional Notes

SLC14A1 is downregulated in PCa due to promoter hypermethylation, which correlates with poor prognosis. Overexpression inhibits tumor progression by suppressing CDK1/CCNB1 and mTOR/MMP-9 pathways. Enriched in prostate basal cells.

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC14A1 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.003502222; Fold-change:0.252289369; Z-score:3.9078375
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Vestibular melanotic schwannoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC14A1 in vestibular melanotic schwannoma than that in healthy individual

Studied Phenotype

Vestibular melanotic schwannoma [ICD-11:2A02.3]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.28E-06; Fold-change:-0.284184142; Z-score:-5.014551273
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC14A1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.24E-20; Fold-change:-0.372844903; Z-score:-4.746585448
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Chordoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC14A1 in chordoma than that in healthy individual

Studied Phenotype

Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.006142735; Fold-change:-0.310814319; Z-score:-4.049089173
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Diffuse midline glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC14A1 in diffuse midline glioma than that in healthy individual

Studied Phenotype

Diffuse midline glioma [ICD-11:2A00.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.53E-36; Fold-change:-0.321814141; Z-score:-4.587671851
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-3613 directly targets SLC14A1 [ 2 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Down-regulation of SLC14A1 in prostate cancer activates CDK1/CCNB1 and mTOR pathways and promotes tumor progression. Sci Rep. 2024 Jun 28;14(1):14914.
2 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.