General Information of Drug Transporter (DT)
DT ID DTD0094 Transporter Info
Gene Name SLC13A4
Transporter Name Na(+)/sulfate cotransporter SUT-1
Gene ID
26266
UniProt ID
Q9UKG4
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg04783228)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.18E-02; Z-score:4.12E-01

Methylation in Case

6.90E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS200 (cg08530317)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.69E+00 Statistic Test p-value:2.73E-07; Z-score:1.37E+00

Methylation in Case

2.16E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg27138584)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:1.71E-05; Z-score:8.78E-01

Methylation in Case

1.97E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg13298691)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.81E-05; Z-score:-9.51E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg16087482)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.01E-04; Z-score:9.64E-01

Methylation in Case

8.87E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg13551263)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.38E-04; Z-score:-4.13E-01

Methylation in Case

5.37E-01 (Median) Methylation in Control 5.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC13A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

3'UTR (cg17557366)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.30E-03; Z-score:8.51E-01

Methylation in Case

6.75E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

TSS1500 (cg11608654)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:6.28E-04; Z-score:-3.19E+00

Methylation in Case

6.66E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

TSS200 (cg17382310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:5.36E-03; Z-score:-2.53E+00

Methylation in Case

7.77E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

TSS200 (cg19548649)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.43E-02; Z-score:-1.67E+00

Methylation in Case

8.72E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

1stExon (cg06869796)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.74E-05; Z-score:-1.01E+01

Methylation in Case

6.71E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.84E+00 Statistic Test p-value:7.34E-14; Z-score:-1.45E+01

Methylation in Case

2.50E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

Body (cg21403761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:2.56E-05; Z-score:-6.69E+00

Methylation in Case

4.96E-01 (Median) Methylation in Control 7.28E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:2.14E-04; Z-score:3.99E+00

Methylation in Case

5.30E-01 (Median) Methylation in Control 4.21E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

Body (cg10624823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.47E-02; Z-score:-7.95E-01

Methylation in Case

7.99E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC13A4 in bladder cancer [ 2 ]

Location

3'UTR (cg23063666)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.86E-02; Z-score:-1.20E+00

Methylation in Case

8.76E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

TSS1500 (cg03640993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.11E-04; Z-score:-9.69E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

TSS200 (cg23715104)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:5.44E-04; Z-score:7.17E-01

Methylation in Case

7.25E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

TSS200 (cg25963505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.55E-03; Z-score:-2.39E-01

Methylation in Case

7.09E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

1stExon (cg06869796)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:6.28E-05; Z-score:-1.12E+00

Methylation in Case

7.42E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.14E-19; Z-score:-6.17E+00

Methylation in Case

6.65E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:2.06E-17; Z-score:3.13E+00

Methylation in Case

6.38E-01 (Median) Methylation in Control 4.77E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

Body (cg21403761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:2.09E-11; Z-score:-3.19E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

Body (cg26773342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.52E-03; Z-score:-7.56E-01

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

Body (cg10624823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.06E-03; Z-score:-5.99E-01

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC13A4 in breast cancer [ 3 ]

Location

3'UTR (cg23063666)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.90E-02; Z-score:-3.35E-01

Methylation in Case

8.93E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

TSS1500 (cg03640993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:5.77E-04; Z-score:-9.43E-01

Methylation in Case

6.95E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

TSS200 (cg25963505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:5.81E-08; Z-score:-2.86E+00

Methylation in Case

7.17E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

TSS200 (cg17382310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.88E-04; Z-score:-3.60E-01

Methylation in Case

9.21E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

TSS200 (cg19548649)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.56E-03; Z-score:-4.40E-01

Methylation in Case

9.15E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

TSS200 (cg23715104)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.34E-03; Z-score:-6.53E-01

Methylation in Case

8.52E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

1stExon (cg06869796)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.22E-07; Z-score:-2.35E+00

Methylation in Case

8.62E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

Body (cg21403761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.99E-11; Z-score:-3.77E+00

Methylation in Case

7.11E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.46E-08; Z-score:-2.74E+00

Methylation in Case

8.75E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

Body (cg26773342)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.06E-07; Z-score:-1.83E+00

Methylation in Case

8.92E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC13A4 in colorectal cancer [ 4 ]

Location

Body (cg10624823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:3.37E-02; Z-score:7.82E-02

Methylation in Case

9.25E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg25771897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.97E+00 Statistic Test p-value:8.59E-11; Z-score:3.70E+00

Methylation in Case

2.91E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg17495154)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.37E+00 Statistic Test p-value:1.87E-10; Z-score:4.41E+00

Methylation in Case

2.08E-01 (Median) Methylation in Control 8.77E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

TSS200 (cg19548649)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.39E-05; Z-score:-4.11E-01

Methylation in Case

8.60E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

TSS200 (cg17382310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.93E-04; Z-score:-5.35E-01

Methylation in Case

8.07E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

Body (cg19631651)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:3.96E-16; Z-score:-3.35E+00

Methylation in Case

3.86E-01 (Median) Methylation in Control 6.18E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.15E-07; Z-score:-1.96E+00

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

Body (cg10624823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.18E-06; Z-score:-2.21E+00

Methylation in Case

7.89E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC13A4 in hepatocellular carcinoma [ 5 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.20E-05; Z-score:9.97E-01

Methylation in Case

6.86E-01 (Median) Methylation in Control 6.33E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in panic disorder [ 6 ]

Location

TSS1500 (cg11608654)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:9.19E-03; Z-score:3.35E-01

Methylation in Case

5.12E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in panic disorder [ 6 ]

Location

TSS200 (cg19548649)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:6.70E-03; Z-score:4.25E-01

Methylation in Case

2.44E+00 (Median) Methylation in Control 2.23E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in panic disorder [ 6 ]

Location

TSS200 (cg25963505)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.85E-02; Z-score:5.15E-01

Methylation in Case

2.05E+00 (Median) Methylation in Control 1.77E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in panic disorder [ 6 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:5.98E-03; Z-score:3.24E-01

Methylation in Case

3.21E+00 (Median) Methylation in Control 3.11E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

TSS1500 (cg11608654)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.21E-04; Z-score:-8.76E-01

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

TSS200 (cg17382310)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:5.57E-05; Z-score:1.32E+00

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

TSS200 (cg23715104)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:7.71E-03; Z-score:4.43E-01

Methylation in Case

6.03E-01 (Median) Methylation in Control 5.73E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:7.16E-05; Z-score:-1.10E+00

Methylation in Case

5.47E-01 (Median) Methylation in Control 6.10E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC13A4 in papillary thyroid cancer [ 7 ]

Location

Body (cg10624823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.63E-03; Z-score:-4.85E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in prostate cancer [ 8 ]

Location

TSS1500 (cg06895831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:4.18E-03; Z-score:3.03E+00

Methylation in Case

8.96E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in prostate cancer [ 8 ]

Location

Body (cg16073846)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.82E+00 Statistic Test p-value:5.98E-03; Z-score:-3.33E+00

Methylation in Case

1.66E-02 (Median) Methylation in Control 3.01E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in prostate cancer [ 8 ]

Location

Body (cg08034816)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.92E-02; Z-score:1.95E+00

Methylation in Case

9.13E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in lung adenocarcinoma [ 9 ]

Location

TSS200 (cg23715104)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.70E-02; Z-score:1.38E+00

Methylation in Case

7.30E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in lung adenocarcinoma [ 9 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:7.57E-03; Z-score:2.66E+00

Methylation in Case

7.25E-01 (Median) Methylation in Control 5.87E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in lung adenocarcinoma [ 9 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.93E-02; Z-score:-1.26E+00

Methylation in Case

8.30E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

1stExon (cg06869796)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.79E+00 Statistic Test p-value:3.04E-22; Z-score:-3.53E+00

Methylation in Case

4.18E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg10624823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.70E-02; Z-score:4.12E-01

Methylation in Case

7.01E-01 (Median) Methylation in Control 6.30E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg13459035)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.62E-02; Z-score:4.02E-01

Methylation in Case

9.57E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC13A4 in atypical teratoid rhabdoid tumor [ 10 ]

Location

3'UTR (cg23063666)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:8.30E-10; Z-score:1.58E+00

Methylation in Case

8.12E-01 (Median) Methylation in Control 5.97E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  HIV infection

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC13A4 in HIV infection [ 11 ]

Location

1stExon (cg06869796)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.22E-02; Z-score:-1.11E+00

Methylation in Case

8.31E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC13A4 in HIV infection [ 11 ]

Location

Body (cg20392616)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.33E-02; Z-score:-6.60E-01

Methylation in Case

8.65E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-145 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-145 miRNA Mature ID miR-145-3p

miRNA Sequence

GGAUUCCUGGAAAUACUGUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-17 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-3p

miRNA Sequence

ACUGCAGUGAAGGCACUUGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-26b directly targets SLC13A4 [ 13 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon4

miR-3074 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3074 miRNA Mature ID miR-3074-5p

miRNA Sequence

GUUCCUGCUGAACUGAGCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-335 directly targets SLC13A4 [ 14 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-3614 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3614 miRNA Mature ID miR-3614-5p

miRNA Sequence

CCACUUGGAUCUGAAGGCUGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-6134 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

UGAGGUGGUAGGAUGUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-6500 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6500 miRNA Mature ID miR-6500-3p

miRNA Sequence

ACACUUGUUGGGAUGACCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-6815 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6815 miRNA Mature ID miR-6815-5p

miRNA Sequence

UAGGUGGCGCCGGAGGAGUCAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-6865 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6865 miRNA Mature ID miR-6865-5p

miRNA Sequence

UAGGUGGCAGAGGAGGGACUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-7854 directly targets SLC13A4 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7854 miRNA Mature ID miR-7854-3p

miRNA Sequence

UGAGGUGACCGCAGAUGGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
13 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.