Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0094 Transporter Info | ||||
Gene Name | SLC13A4 | ||||
Transporter Name | Na(+)/sulfate cotransporter SUT-1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Pancretic ductal adenocarcinoma |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
5'UTR (cg04783228) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.18E-02; Z-score:4.12E-01 | ||
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 6.74E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
TSS200 (cg08530317) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.69E+00 | Statistic Test | p-value:2.73E-07; Z-score:1.37E+00 | ||
Methylation in Case |
2.16E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg27138584) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:1.71E-05; Z-score:8.78E-01 | ||
Methylation in Case |
1.97E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg13298691) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.81E-05; Z-score:-9.51E-01 | ||
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg16087482) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.01E-04; Z-score:9.64E-01 | ||
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
Body (cg13551263) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.38E-04; Z-score:-4.13E-01 | ||
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 5.51E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC13A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
Location |
3'UTR (cg17557366) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.30E-03; Z-score:8.51E-01 | ||
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
TSS1500 (cg11608654) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:6.28E-04; Z-score:-3.19E+00 | ||
Methylation in Case |
6.66E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
TSS200 (cg17382310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.36E-03; Z-score:-2.53E+00 | ||
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
TSS200 (cg19548649) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.43E-02; Z-score:-1.67E+00 | ||
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
1stExon (cg06869796) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.74E-05; Z-score:-1.01E+01 | ||
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-2.84E+00 | Statistic Test | p-value:7.34E-14; Z-score:-1.45E+01 | ||
Methylation in Case |
2.50E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
Body (cg21403761) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.47E+00 | Statistic Test | p-value:2.56E-05; Z-score:-6.69E+00 | ||
Methylation in Case |
4.96E-01 (Median) | Methylation in Control | 7.28E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
Body (cg13459035) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:2.14E-04; Z-score:3.99E+00 | ||
Methylation in Case |
5.30E-01 (Median) | Methylation in Control | 4.21E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
Body (cg10624823) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.47E-02; Z-score:-7.95E-01 | ||
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC13A4 in bladder cancer | [ 2 ] | |||
Location |
3'UTR (cg23063666) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.86E-02; Z-score:-1.20E+00 | ||
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
TSS1500 (cg03640993) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.11E-04; Z-score:-9.69E-01 | ||
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
TSS200 (cg23715104) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:5.44E-04; Z-score:7.17E-01 | ||
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
TSS200 (cg25963505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.55E-03; Z-score:-2.39E-01 | ||
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
1stExon (cg06869796) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:6.28E-05; Z-score:-1.12E+00 | ||
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:1.14E-19; Z-score:-6.17E+00 | ||
Methylation in Case |
6.65E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
Body (cg13459035) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.34E+00 | Statistic Test | p-value:2.06E-17; Z-score:3.13E+00 | ||
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 4.77E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
Body (cg21403761) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:2.09E-11; Z-score:-3.19E+00 | ||
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 6.74E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
Body (cg26773342) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.52E-03; Z-score:-7.56E-01 | ||
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
Body (cg10624823) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.06E-03; Z-score:-5.99E-01 | ||
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC13A4 in breast cancer | [ 3 ] | |||
Location |
3'UTR (cg23063666) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.90E-02; Z-score:-3.35E-01 | ||
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
TSS1500 (cg03640993) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:5.77E-04; Z-score:-9.43E-01 | ||
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 7.50E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
TSS200 (cg25963505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:5.81E-08; Z-score:-2.86E+00 | ||
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
TSS200 (cg17382310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.88E-04; Z-score:-3.60E-01 | ||
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
TSS200 (cg19548649) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.56E-03; Z-score:-4.40E-01 | ||
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
TSS200 (cg23715104) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:8.34E-03; Z-score:-6.53E-01 | ||
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
1stExon (cg06869796) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.22E-07; Z-score:-2.35E+00 | ||
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg21403761) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.99E-11; Z-score:-3.77E+00 | ||
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.46E-08; Z-score:-2.74E+00 | ||
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon9 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg26773342) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.06E-07; Z-score:-1.83E+00 | ||
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon10 |
Methylation of SLC13A4 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg10624823) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:3.37E-02; Z-score:7.82E-02 | ||
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.25E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS1500 (cg25771897) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.97E+00 | Statistic Test | p-value:8.59E-11; Z-score:3.70E+00 | ||
Methylation in Case |
2.91E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS1500 (cg17495154) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:2.37E+00 | Statistic Test | p-value:1.87E-10; Z-score:4.41E+00 | ||
Methylation in Case |
2.08E-01 (Median) | Methylation in Control | 8.77E-02 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS200 (cg19548649) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.39E-05; Z-score:-4.11E-01 | ||
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
TSS200 (cg17382310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.93E-04; Z-score:-5.35E-01 | ||
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg19631651) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.60E+00 | Statistic Test | p-value:3.96E-16; Z-score:-3.35E+00 | ||
Methylation in Case |
3.86E-01 (Median) | Methylation in Control | 6.18E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon6 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.15E-07; Z-score:-1.96E+00 | ||
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon7 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg10624823) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.18E-06; Z-score:-2.21E+00 | ||
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon8 |
Methylation of SLC13A4 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg13459035) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.20E-05; Z-score:9.97E-01 | ||
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in panic disorder | [ 6 ] | |||
Location |
TSS1500 (cg11608654) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.34E+00 | Statistic Test | p-value:9.19E-03; Z-score:3.35E-01 | ||
Methylation in Case |
5.12E-01 (Median) | Methylation in Control | 3.82E-01 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in panic disorder | [ 6 ] | |||
Location |
TSS200 (cg19548649) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:6.70E-03; Z-score:4.25E-01 | ||
Methylation in Case |
2.44E+00 (Median) | Methylation in Control | 2.23E+00 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in panic disorder | [ 6 ] | |||
Location |
TSS200 (cg25963505) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.85E-02; Z-score:5.15E-01 | ||
Methylation in Case |
2.05E+00 (Median) | Methylation in Control | 1.77E+00 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in panic disorder | [ 6 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.98E-03; Z-score:3.24E-01 | ||
Methylation in Case |
3.21E+00 (Median) | Methylation in Control | 3.11E+00 (Median) | ||
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
TSS1500 (cg11608654) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.21E-04; Z-score:-8.76E-01 | ||
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
TSS200 (cg17382310) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:5.57E-05; Z-score:1.32E+00 | ||
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
TSS200 (cg23715104) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:7.71E-03; Z-score:4.43E-01 | ||
Methylation in Case |
6.03E-01 (Median) | Methylation in Control | 5.73E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg13459035) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:7.16E-05; Z-score:-1.10E+00 | ||
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 6.10E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon5 |
Methylation of SLC13A4 in papillary thyroid cancer | [ 7 ] | |||
Location |
Body (cg10624823) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.63E-03; Z-score:-4.85E-01 | ||
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in prostate cancer | [ 8 ] | |||
Location |
TSS1500 (cg06895831) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:4.18E-03; Z-score:3.03E+00 | ||
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in prostate cancer | [ 8 ] | |||
Location |
Body (cg16073846) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.82E+00 | Statistic Test | p-value:5.98E-03; Z-score:-3.33E+00 | ||
Methylation in Case |
1.66E-02 (Median) | Methylation in Control | 3.01E-02 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in prostate cancer | [ 8 ] | |||
Location |
Body (cg08034816) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.92E-02; Z-score:1.95E+00 | ||
Methylation in Case |
9.13E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in lung adenocarcinoma | [ 9 ] | |||
Location |
TSS200 (cg23715104) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:3.70E-02; Z-score:1.38E+00 | ||
Methylation in Case |
7.30E-01 (Median) | Methylation in Control | 6.51E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in lung adenocarcinoma | [ 9 ] | |||
Location |
Body (cg13459035) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:7.57E-03; Z-score:2.66E+00 | ||
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 5.87E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in lung adenocarcinoma | [ 9 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.93E-02; Z-score:-1.26E+00 | ||
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in atypical teratoid rhabdoid tumor | [ 10 ] | |||
Location |
1stExon (cg06869796) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.79E+00 | Statistic Test | p-value:3.04E-22; Z-score:-3.53E+00 | ||
Methylation in Case |
4.18E-01 (Median) | Methylation in Control | 7.48E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in atypical teratoid rhabdoid tumor | [ 10 ] | |||
Location |
Body (cg10624823) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.70E-02; Z-score:4.12E-01 | ||
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 6.30E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon3 |
Methylation of SLC13A4 in atypical teratoid rhabdoid tumor | [ 10 ] | |||
Location |
Body (cg13459035) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.62E-02; Z-score:4.02E-01 | ||
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon4 |
Methylation of SLC13A4 in atypical teratoid rhabdoid tumor | [ 10 ] | |||
Location |
3'UTR (cg23063666) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:8.30E-10; Z-score:1.58E+00 | ||
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
Methylation of SLC13A4 in HIV infection | [ 11 ] | |||
Location |
1stExon (cg06869796) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.22E-02; Z-score:-1.11E+00 | ||
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon2 |
Methylation of SLC13A4 in HIV infection | [ 11 ] | |||
Location |
Body (cg20392616) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.33E-02; Z-score:-6.60E-01 | ||
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
microRNA |
|||||
Unclear Phenotype |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon1 |
miR-145 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-145 | miRNA Mature ID | miR-145-3p | ||
miRNA Sequence |
GGAUUCCUGGAAAUACUGUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon2 |
miR-17 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-3p | ||
miRNA Sequence |
ACUGCAGUGAAGGCACUUGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon3 |
miR-26b directly targets SLC13A4 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon4 |
miR-3074 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3074 | miRNA Mature ID | miR-3074-5p | ||
miRNA Sequence |
GUUCCUGCUGAACUGAGCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon5 |
miR-335 directly targets SLC13A4 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon6 |
miR-3614 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3614 | miRNA Mature ID | miR-3614-5p | ||
miRNA Sequence |
CCACUUGGAUCUGAAGGCUGCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon7 |
miR-6134 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6134 | miRNA Mature ID | miR-6134 | ||
miRNA Sequence |
UGAGGUGGUAGGAUGUAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon8 |
miR-6500 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6500 | miRNA Mature ID | miR-6500-3p | ||
miRNA Sequence |
ACACUUGUUGGGAUGACCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon9 |
miR-6815 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6815 | miRNA Mature ID | miR-6815-5p | ||
miRNA Sequence |
UAGGUGGCGCCGGAGGAGUCAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon10 |
miR-6865 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6865 | miRNA Mature ID | miR-6865-5p | ||
miRNA Sequence |
UAGGUGGCAGAGGAGGGACUUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon11 |
miR-7854 directly targets SLC13A4 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7854 | miRNA Mature ID | miR-7854-3p | ||
miRNA Sequence |
UGAGGUGACCGCAGAUGGGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.