General Information of Drug Transporter (DT)
DT ID DTD0087 Transporter Info
Gene Name SLC12A6
Transporter Name Electroneutral potassium-chloride cotransporter 3
Gene ID
9990
UniProt ID
Q9UHW9
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A6 in bladder cancer [ 1 ]

Location

TSS1500 (cg01053714)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.33E-02; Z-score:-1.37E+00

Methylation in Case

5.50E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A6 in breast cancer [ 2 ]

Location

TSS1500 (cg01053714)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:9.18E-03; Z-score:1.94E-01

Methylation in Case

6.53E-01 (Median) Methylation in Control 6.39E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A6 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg01053714)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.21E-03; Z-score:-7.34E-01

Methylation in Case

7.09E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A6 in papillary thyroid cancer [ 4 ]

Location

TSS1500 (cg01053714)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.61E-02; Z-score:1.68E+00

Methylation in Case

7.91E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A6 in pancretic ductal adenocarcinoma [ 5 ]

Location

1stExon (cg04643655)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.89E-03; Z-score:-6.56E-01

Methylation in Case

4.77E-01 (Median) Methylation in Control 4.99E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         38 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-106a directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-106b directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-126 directly targets SLC12A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-126 miRNA Mature ID miR-126-5p

miRNA Sequence

CAUUAUUACUUUUGGUACGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-17 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-186 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-20a directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-20b directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-302a directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-302b directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-302c directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-302d directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-302e directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-302e miRNA Mature ID miR-302e

miRNA Sequence

UAAGUGCUUCCAUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-372 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-373 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4438 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

CACAGGCUUAGAAAAGACAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-4731 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-4795 directly targets SLC12A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4795 miRNA Mature ID miR-4795-3p

miRNA Sequence

AUAUUAUUAGCCACUUCUGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-5089 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-512 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-512 miRNA Mature ID miR-512-3p

miRNA Sequence

AAGUGCUGUCAUAGCUGAGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-519d directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-520a directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-520c directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-520d directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-520g directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-520h directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-520h miRNA Mature ID miR-520h

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-526b directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-5589 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-5689 directly targets SLC12A6 [ 7 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5689 miRNA Mature ID miR-5689

miRNA Sequence

AGCAUACACCUGUAGUCCUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-5702 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5702 miRNA Mature ID miR-5702

miRNA Sequence

UGAGUCAGCAACAUAUCCCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-619 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-6504 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

CAUUACAGCACAGCCAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-6506 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-652 directly targets SLC12A6 [ 8 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-652 miRNA Mature ID miR-652-3p

miRNA Sequence

AAUGGCGCCACUAGGGUUGUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon34

miR-6890 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

CCACUGCCUAUGCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-7151 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-888 directly targets SLC12A6 [ 9 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-888 miRNA Mature ID miR-888-5p

miRNA Sequence

UACUCAAAAAGCUGUCAGUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-93 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-937 directly targets SLC12A6 [ 6 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-937 miRNA Mature ID miR-937-5p

miRNA Sequence

GUGAGUCAGGGUGGGGCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
7 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
8 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.