General Information of Drug Transporter (DT)
DT ID DTD0082 Transporter Info
Gene Name SLC12A1
Transporter Name Bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2
Gene ID
6557
UniProt ID
Q13621
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

5'UTR (cg10829727)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.60E+00 Statistic Test p-value:6.02E-17; Z-score:2.91E+00

Methylation in Case

4.93E-01 (Median) Methylation in Control 3.07E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg14583675)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:9.67E-14; Z-score:2.18E+00

Methylation in Case

6.71E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg20388916)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:6.55E-11; Z-score:-3.28E+00

Methylation in Case

4.47E-01 (Median) Methylation in Control 6.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:1.04E-08; Z-score:-2.79E+00

Methylation in Case

5.77E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg14857792)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:1.99E-08; Z-score:-3.11E+00

Methylation in Case

4.28E-01 (Median) Methylation in Control 5.82E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:5.97E-05; Z-score:-1.22E+00

Methylation in Case

6.82E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:4.13E-04; Z-score:-2.21E+00

Methylation in Case

3.08E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Bladder cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.29E+00 Statistic Test p-value:2.95E-12; Z-score:-1.44E+01

Methylation in Case

3.20E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg07915221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:9.45E-06; Z-score:-2.03E+01

Methylation in Case

7.38E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg21384789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.28E-04; Z-score:-3.57E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg14167964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.57E+00 Statistic Test p-value:6.03E-09; Z-score:-8.44E+00

Methylation in Case

3.29E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg14930674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:6.81E-07; Z-score:-6.57E+01

Methylation in Case

5.30E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.90E+00 Statistic Test p-value:1.30E-06; Z-score:-8.61E+00

Methylation in Case

2.37E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:1.57E-06; Z-score:-1.21E+01

Methylation in Case

5.29E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg14857792)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.83E+00 Statistic Test p-value:4.00E-06; Z-score:-7.06E+00

Methylation in Case

3.73E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:6.16E-06; Z-score:-1.60E+01

Methylation in Case

6.48E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC12A1 in bladder cancer [ 2 ]

Location

Body (cg13944105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:6.70E-04; Z-score:-7.55E+00

Methylation in Case

3.66E-01 (Median) Methylation in Control 5.12E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

TSS1500 (cg07915221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.71E-06; Z-score:-1.26E+00

Methylation in Case

8.87E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:1.90E-03; Z-score:-1.15E+00

Methylation in Case

5.66E-01 (Median) Methylation in Control 6.84E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:9.85E-14; Z-score:-2.54E+00

Methylation in Case

7.44E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:9.25E-09; Z-score:1.74E+00

Methylation in Case

3.58E-01 (Median) Methylation in Control 2.64E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:9.24E-08; Z-score:-1.37E+00

Methylation in Case

8.03E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

Body (cg14167964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.87E-07; Z-score:-1.26E+00

Methylation in Case

7.23E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

Body (cg14930674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.06E-03; Z-score:-3.35E-01

Methylation in Case

7.72E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A1 in breast cancer [ 3 ]

Location

Body (cg14857792)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:4.21E-02; Z-score:-5.35E-01

Methylation in Case

6.36E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:9.68E-15; Z-score:-6.11E+00

Methylation in Case

6.57E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

TSS1500 (cg07915221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.90E-02; Z-score:3.47E-02

Methylation in Case

9.43E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:1.07E-15; Z-score:-4.25E+00

Methylation in Case

5.08E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg14857792)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:4.94E-12; Z-score:-4.99E+00

Methylation in Case

6.55E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:4.44E-09; Z-score:-2.80E+00

Methylation in Case

8.35E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.68E-06; Z-score:-3.16E+00

Methylation in Case

8.68E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg14930674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.72E-05; Z-score:-2.28E+00

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg13944105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:6.20E-05; Z-score:-1.12E+00

Methylation in Case

6.65E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC12A1 in colorectal cancer [ 4 ]

Location

Body (cg14167964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.66E-03; Z-score:-5.46E-01

Methylation in Case

8.67E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.50E-05; Z-score:-1.43E+00

Methylation in Case

7.40E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:4.84E-07; Z-score:-2.03E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

Body (cg13944105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:5.50E-06; Z-score:-2.28E+00

Methylation in Case

7.80E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.29E-04; Z-score:-1.22E+00

Methylation in Case

8.40E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

Body (cg14857792)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.46E-03; Z-score:-1.22E+00

Methylation in Case

7.57E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

Body (cg14167964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.02E-02; Z-score:-6.81E-01

Methylation in Case

9.21E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC12A1 in HIV infection [ 5 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.09E-02; Z-score:-4.83E-01

Methylation in Case

8.60E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

TSS1500 (cg20392607)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.84E+00 Statistic Test p-value:3.19E-30; Z-score:4.90E+00

Methylation in Case

3.63E-01 (Median) Methylation in Control 5.30E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

TSS1500 (cg12367786)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:1.80E-04; Z-score:-1.08E+00

Methylation in Case

3.98E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

TSS1500 (cg16667710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.94E-02; Z-score:-3.07E-01

Methylation in Case

8.86E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg10841552)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.77E+00 Statistic Test p-value:1.35E-21; Z-score:3.72E+00

Methylation in Case

4.33E-01 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg04408162)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:4.24E-10; Z-score:-2.14E+00

Methylation in Case

2.79E-01 (Median) Methylation in Control 3.49E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in pancretic ductal adenocarcinoma [ 6 ]

Location

Body (cg25196715)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.08E-03; Z-score:9.34E-01

Methylation in Case

8.92E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in panic disorder [ 7 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:6.05E-03; Z-score:4.56E-01

Methylation in Case

1.94E+00 (Median) Methylation in Control 1.79E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in panic disorder [ 7 ]

Location

TSS1500 (cg07915221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:2.57E-02; Z-score:5.07E-01

Methylation in Case

7.59E-01 (Median) Methylation in Control 5.50E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in panic disorder [ 7 ]

Location

Body (cg14167964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.70E+00 Statistic Test p-value:1.16E-04; Z-score:-7.15E-01

Methylation in Case

1.95E-01 (Median) Methylation in Control 5.27E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in panic disorder [ 7 ]

Location

Body (cg13944105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:5.36E-03; Z-score:5.99E-01

Methylation in Case

1.67E+00 (Median) Methylation in Control 1.45E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in panic disorder [ 7 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:9.73E-03; Z-score:5.28E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in papillary thyroid cancer [ 8 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.12E-03; Z-score:-1.26E-01

Methylation in Case

7.71E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in papillary thyroid cancer [ 8 ]

Location

TSS1500 (cg07915221)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.06E-02; Z-score:-4.70E-01

Methylation in Case

9.40E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in papillary thyroid cancer [ 8 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.90E-03; Z-score:-6.38E-01

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in papillary thyroid cancer [ 8 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:6.13E-03; Z-score:-9.49E-01

Methylation in Case

6.16E-01 (Median) Methylation in Control 6.65E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in papillary thyroid cancer [ 8 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.32E-03; Z-score:-4.36E-01

Methylation in Case

8.63E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in prostate cancer [ 9 ]

Location

TSS1500 (cg22294577)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.10E-02; Z-score:5.09E+00

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in prostate cancer [ 9 ]

Location

TSS1500 (cg02428538)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.98E-02; Z-score:1.48E+00

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in systemic lupus erythematosus [ 10 ]

Location

TSS1500 (cg26317549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:8.95E-03; Z-score:-1.50E-01

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg14930674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.31E-03; Z-score:-2.27E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg14857792)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.32E-03; Z-score:-3.11E-01

Methylation in Case

7.84E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.97E-02; Z-score:-2.20E-01

Methylation in Case

8.29E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC12A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg13944105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.19E-02; Z-score:-1.27E-01

Methylation in Case

8.14E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC12A1 in systemic lupus erythematosus [ 10 ]

Location

Body (cg23530596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:3.74E-02; Z-score:4.30E-03

Methylation in Case

7.27E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.28E+00 Statistic Test p-value:1.66E-02; Z-score:-3.16E-01

Methylation in Case

3.45E-02 (Median) Methylation in Control 7.86E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg13944105)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.01E-02; Z-score:4.34E-01

Methylation in Case

8.85E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg14167964)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:4.28E-02; Z-score:-6.74E-01

Methylation in Case

1.51E-01 (Median) Methylation in Control 1.94E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC12A1 in atypical teratoid rhabdoid tumor [ 11 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.36E-02; Z-score:2.81E-01

Methylation in Case

7.66E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC12A1 in lung adenocarcinoma [ 12 ]

Location

Body (cg14229516)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:6.27E-03; Z-score:-1.78E+00

Methylation in Case

8.03E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC12A1 in lung adenocarcinoma [ 12 ]

Location

Body (cg10616694)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.57E-02; Z-score:-1.67E+00

Methylation in Case

7.60E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC12A1 in lung adenocarcinoma [ 12 ]

Location

Body (cg14930674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.56E-02; Z-score:-1.20E+00

Methylation in Case

7.94E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

microRNA

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Higher expression of miR-21 in clear cell renal cell carcinoma (compare with normal kidney tissue) [ 13 ]

Epigenetic Type

microRNA Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Down regulation ofSLC12A1 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-21 miRNA Mature ID miR-21-5p

miRNA Sequence

UAGCUUAUCAGACUGAUGUUGA

miRNA Target Type

Direct

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

Additional Notes

miR-21 was up-regulated in clear cell renal cell carcinoma and regulated SLC12A1 expression via binding to the SLC12A1 mRNA.
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 Identifying mRNA targets of microRNA dysregulated in cancer: with application to clear cell Renal Cell Carcinoma. BMC Syst Biol. 2010 Apr 27;4:51.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.