General Information of Drug Transporter (DT)
DT ID DTD0080 Transporter Info
Gene Name SLC11A1
Transporter Name Natural resistance-associated macrophage protein 1
Gene ID
6556
UniProt ID
P49279
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

5'UTR (cg26870567)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:5.48E-06; Z-score:-2.90E+00

Methylation in Case

6.51E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

TSS200 (cg16857852)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.14E-05; Z-score:-1.67E+00

Methylation in Case

3.83E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

Body (cg14788003)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.37E+00 Statistic Test p-value:1.04E-06; Z-score:-5.42E+00

Methylation in Case

5.36E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

Body (cg14260073)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:9.68E-06; Z-score:8.85E-01

Methylation in Case

5.54E-01 (Median) Methylation in Control 4.93E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

Body (cg19115882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:5.18E-05; Z-score:-2.10E+00

Methylation in Case

5.79E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

Body (cg08490220)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:8.79E-05; Z-score:-3.58E+00

Methylation in Case

5.40E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

Body (cg23516560)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:9.75E-04; Z-score:-1.62E+00

Methylation in Case

6.72E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in colon adenocarcinoma [ 1 ]

Location

Body (cg11244695)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.36E-03; Z-score:-9.18E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

5'UTR (cg01289541)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:7.47E-07; Z-score:-1.55E+00

Methylation in Case

3.94E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg02313331)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.53E+00 Statistic Test p-value:1.03E-06; Z-score:-1.29E+00

Methylation in Case

2.41E-01 (Median) Methylation in Control 3.68E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg07583503)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.89E-04; Z-score:3.27E-01

Methylation in Case

2.55E-01 (Median) Methylation in Control 2.34E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg11455040)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.64E-03; Z-score:-3.80E-01

Methylation in Case

7.51E-02 (Median) Methylation in Control 8.64E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg19616230)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:3.57E-11; Z-score:-2.04E+00

Methylation in Case

2.10E-01 (Median) Methylation in Control 2.75E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg02615599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:1.32E-07; Z-score:-1.53E+00

Methylation in Case

1.48E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg10881110)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:1.96E-03; Z-score:6.00E-01

Methylation in Case

5.95E-01 (Median) Methylation in Control 5.43E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

1stExon (cg10671668)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.72E+00 Statistic Test p-value:2.65E-13; Z-score:2.70E+00

Methylation in Case

4.88E-01 (Median) Methylation in Control 1.31E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg04106903)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:4.01E-05; Z-score:-1.17E+00

Methylation in Case

1.66E-01 (Median) Methylation in Control 2.02E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg13224075)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.53E-04; Z-score:9.23E-01

Methylation in Case

9.36E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg17172593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:3.27E-03; Z-score:-7.74E-01

Methylation in Case

4.86E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg05561775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:9.85E-03; Z-score:5.63E-01

Methylation in Case

8.77E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.35E-02; Z-score:-3.17E-01

Methylation in Case

7.62E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg01977413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.50E-02; Z-score:-4.97E-01

Methylation in Case

1.26E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC11A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg25423829)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.54E-02; Z-score:-6.04E-01

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.69E+00 Statistic Test p-value:7.10E-13; Z-score:-1.50E+01

Methylation in Case

3.44E-01 (Median) Methylation in Control 5.82E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

TSS1500 (cg13802355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:7.32E-06; Z-score:-4.42E+00

Methylation in Case

3.14E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

TSS1500 (cg09617319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:5.41E-05; Z-score:-1.19E+01

Methylation in Case

7.37E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

TSS200 (cg18329052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.94E+00 Statistic Test p-value:2.44E-10; Z-score:-1.11E+01

Methylation in Case

3.41E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

TSS200 (cg07719512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:4.65E-10; Z-score:-8.21E+00

Methylation in Case

3.89E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg16926316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.06E+00 Statistic Test p-value:1.33E-16; Z-score:-2.12E+01

Methylation in Case

4.26E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg23212579)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.01E+00 Statistic Test p-value:3.54E-15; Z-score:-1.12E+02

Methylation in Case

4.87E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg17130789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.12E+00 Statistic Test p-value:5.06E-15; Z-score:-1.59E+01

Methylation in Case

3.65E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg11378979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.08E+00 Statistic Test p-value:7.76E-10; Z-score:-8.87E+00

Methylation in Case

3.34E-01 (Median) Methylation in Control 6.95E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg04337188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:7.93E-08; Z-score:-1.33E+01

Methylation in Case

6.13E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg01520853)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.02E-06; Z-score:-5.55E+00

Methylation in Case

7.87E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

Body (cg17010118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.35E-06; Z-score:-1.19E+01

Methylation in Case

7.92E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC11A1 in bladder cancer [ 3 ]

Location

3'UTR (cg24007161)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:7.95E-03; Z-score:-1.32E+00

Methylation in Case

5.64E-02 (Median) Methylation in Control 6.04E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:1.35E-06; Z-score:-1.45E+00

Methylation in Case

4.98E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

TSS1500 (cg13802355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.50E-03; Z-score:-6.01E-01

Methylation in Case

3.66E-01 (Median) Methylation in Control 4.20E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

TSS1500 (cg09617319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.22E-02; Z-score:-5.31E-01

Methylation in Case

7.88E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

TSS200 (cg07719512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:7.85E-04; Z-score:-1.15E+00

Methylation in Case

5.66E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

TSS200 (cg18329052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.77E-03; Z-score:-8.31E-01

Methylation in Case

6.63E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg07015784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:5.26E-15; Z-score:2.40E+00

Methylation in Case

9.04E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg11378979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.93E-12; Z-score:-2.72E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg17130789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.33E-06; Z-score:-1.28E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg04337188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:4.48E-05; Z-score:-1.13E+00

Methylation in Case

6.68E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg17010118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:9.77E-05; Z-score:-1.14E+00

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg00634542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.26E-04; Z-score:-1.08E+00

Methylation in Case

8.06E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg23212579)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.47E-03; Z-score:-5.02E-01

Methylation in Case

9.64E-01 (Median) Methylation in Control 9.79E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg01520853)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.19E-02; Z-score:-6.64E-01

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg03710889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.34E-02; Z-score:4.36E-01

Methylation in Case

5.91E-01 (Median) Methylation in Control 5.59E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg16926316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.61E-02; Z-score:-5.15E-01

Methylation in Case

8.38E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC11A1 in breast cancer [ 4 ]

Location

Body (cg04656051)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.49E-02; Z-score:2.82E-01

Methylation in Case

4.47E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:2.24E-11; Z-score:-2.30E+00

Methylation in Case

6.42E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg09617319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.99E-06; Z-score:-1.52E+00

Methylation in Case

9.02E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg13802355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.56E-02; Z-score:7.06E-01

Methylation in Case

5.74E-01 (Median) Methylation in Control 5.15E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

TSS200 (cg07719512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:2.08E-14; Z-score:-3.07E+00

Methylation in Case

6.51E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

TSS200 (cg18329052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.19E-04; Z-score:-9.35E-01

Methylation in Case

7.58E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

Body (cg04337188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.46E-10; Z-score:-4.85E+00

Methylation in Case

8.08E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

Body (cg00634542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.82E-08; Z-score:-2.10E+00

Methylation in Case

6.88E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

Body (cg17130789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.98E-08; Z-score:-2.10E+00

Methylation in Case

8.50E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

Body (cg16926316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.42E-06; Z-score:-1.49E+00

Methylation in Case

8.79E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

Body (cg23212579)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.19E-03; Z-score:-1.16E+00

Methylation in Case

9.67E-01 (Median) Methylation in Control 9.74E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

Body (cg01520853)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.77E-03; Z-score:-5.17E-01

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.33E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

3'UTR (cg24007161)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:3.73E-05; Z-score:-1.05E+00

Methylation in Case

1.09E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC11A1 in colorectal cancer [ 5 ]

Location

3'UTR (cg01379701)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.22E-03; Z-score:-1.00E+00

Methylation in Case

2.52E-02 (Median) Methylation in Control 3.18E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Moderate hypomethylation of SLC11A1 in colorectal cancer than that in healthy individual

Studied Phenotype

Colorectal cancer [ICD-11:2B91]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.09E-18; Fold-change:-0.204270851; Z-score:-1.734780754
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

  Hepatocellular carcinoma

         16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.23E+00 Statistic Test p-value:5.81E-09; Z-score:-2.21E+00

Methylation in Case

4.46E-01 (Median) Methylation in Control 5.50E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg09617319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:1.01E-08; Z-score:-1.06E+00

Methylation in Case

7.21E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

TSS1500 (cg13802355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.25E-02; Z-score:-1.10E-01

Methylation in Case

3.85E-01 (Median) Methylation in Control 3.98E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg08706670)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.20E+00 Statistic Test p-value:2.78E-14; Z-score:9.33E+00

Methylation in Case

3.82E-01 (Median) Methylation in Control 6.16E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg26482893)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.97E+00 Statistic Test p-value:6.27E-13; Z-score:2.26E+00

Methylation in Case

6.41E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

TSS200 (cg07719512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:6.56E-05; Z-score:-9.56E-01

Methylation in Case

5.44E-01 (Median) Methylation in Control 5.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg00712593)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.62E+00 Statistic Test p-value:5.57E-18; Z-score:-6.08E+00

Methylation in Case

5.05E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg17780246)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.63E+00 Statistic Test p-value:6.46E-16; Z-score:2.86E+00

Methylation in Case

5.42E-01 (Median) Methylation in Control 3.33E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg19807207)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.12E-10; Z-score:-3.47E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg04337188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.36E-08; Z-score:-2.26E+00

Methylation in Case

7.15E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg11378979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:8.59E-07; Z-score:-1.43E+00

Methylation in Case

7.91E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg17130789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:7.66E-06; Z-score:-1.01E+00

Methylation in Case

7.91E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg00634542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.05E-04; Z-score:-6.07E-01

Methylation in Case

7.51E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg23212579)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.81E-03; Z-score:-5.76E-01

Methylation in Case

9.78E-01 (Median) Methylation in Control 9.82E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

Body (cg07015784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:6.95E-03; Z-score:6.26E-01

Methylation in Case

9.49E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC11A1 in hepatocellular carcinoma [ 6 ]

Location

3'UTR (cg22234897)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.68E+00 Statistic Test p-value:3.22E-10; Z-score:2.49E+00

Methylation in Case

1.88E-01 (Median) Methylation in Control 6.99E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.35E-02; Z-score:-1.33E+00

Methylation in Case

5.78E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

Body (cg03291396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:3.59E-04; Z-score:2.91E+00

Methylation in Case

2.99E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

Body (cg14645545)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.47E+00 Statistic Test p-value:4.41E-03; Z-score:2.78E+00

Methylation in Case

3.52E-01 (Median) Methylation in Control 2.39E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

Body (cg04337188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:7.99E-03; Z-score:-1.72E+00

Methylation in Case

7.85E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

Body (cg07015784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.05E-02; Z-score:-3.06E+00

Methylation in Case

9.10E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

Body (cg03710889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:3.76E-02; Z-score:1.41E+00

Methylation in Case

6.52E-01 (Median) Methylation in Control 5.63E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in lung adenocarcinoma [ 7 ]

Location

Body (cg17010118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.20E-02; Z-score:-6.00E-01

Methylation in Case

8.93E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in panic disorder [ 8 ]

Location

TSS1500 (cg13802355)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.49E-01 Statistic Test p-value:2.30E-02; Z-score:3.36E-01

Methylation in Case

-1.09E+00 (Median) Methylation in Control -1.14E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in panic disorder [ 8 ]

Location

Body (cg00634542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:7.71E-03; Z-score:-4.00E-01

Methylation in Case

5.34E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in panic disorder [ 8 ]

Location

Body (cg04656051)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-8.98E-01 Statistic Test p-value:1.19E-02; Z-score:-4.29E-01

Methylation in Case

-2.20E+00 (Median) Methylation in Control -1.98E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in panic disorder [ 8 ]

Location

3'UTR (cg24007161)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.82E-01 Statistic Test p-value:4.83E-02; Z-score:3.39E-01

Methylation in Case

-4.97E+00 (Median) Methylation in Control -5.07E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

TSS1500 (cg15099037)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:3.34E-16; Z-score:-3.70E+00

Methylation in Case

4.61E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

TSS200 (cg07719512)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.79E-02; Z-score:-5.16E-01

Methylation in Case

6.38E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg01520853)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.93E-05; Z-score:-7.92E-01

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg04656051)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:7.63E-05; Z-score:9.77E-01

Methylation in Case

3.62E-01 (Median) Methylation in Control 3.13E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg17130789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.01E-04; Z-score:-7.86E-01

Methylation in Case

8.46E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg11378979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.45E-04; Z-score:-6.58E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg14645545)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:3.93E-04; Z-score:7.05E-01

Methylation in Case

3.27E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg03291396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:6.28E-04; Z-score:6.60E-01

Methylation in Case

2.16E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg00634542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.11E-04; Z-score:-8.01E-01

Methylation in Case

9.27E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg03710889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.45E-03; Z-score:9.53E-01

Methylation in Case

6.77E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg23212579)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.24E-03; Z-score:-2.29E-01

Methylation in Case

9.65E-01 (Median) Methylation in Control 9.66E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

Body (cg16926316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.16E-02; Z-score:-3.08E-01

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC11A1 in papillary thyroid cancer [ 9 ]

Location

3'UTR (cg24007161)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:8.88E-05; Z-score:-7.98E-01

Methylation in Case

4.14E-02 (Median) Methylation in Control 4.82E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in prostate cancer [ 10 ]

Location

TSS200 (cg02595219)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.43E+00 Statistic Test p-value:1.01E-03; Z-score:1.22E+01

Methylation in Case

7.45E-01 (Median) Methylation in Control 3.06E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in prostate cancer [ 10 ]

Location

TSS200 (cg09408768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.22E+00 Statistic Test p-value:1.48E-02; Z-score:8.03E+00

Methylation in Case

3.07E-01 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in prostate cancer [ 10 ]

Location

Body (cg19854293)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:8.84E-03; Z-score:3.63E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 6.53E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg00634542)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:6.62E-07; Z-score:-3.05E+00

Methylation in Case

9.13E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg14645545)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.41E+00 Statistic Test p-value:6.98E-06; Z-score:1.93E+00

Methylation in Case

2.10E-01 (Median) Methylation in Control 8.72E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg04337188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.55E-05; Z-score:-1.58E+00

Methylation in Case

9.00E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg03291396)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.91E+00 Statistic Test p-value:1.82E-05; Z-score:1.01E+00

Methylation in Case

1.26E-01 (Median) Methylation in Control 6.57E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg17010118)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.78E-04; Z-score:-1.52E+00

Methylation in Case

9.74E-01 (Median) Methylation in Control 9.80E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg17130789)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.72E-04; Z-score:-1.41E+00

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg07015784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.28E-02; Z-score:1.70E-02

Methylation in Case

9.64E-01 (Median) Methylation in Control 9.64E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

Body (cg16926316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.33E-02; Z-score:-5.92E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC11A1 in clear cell renal cell carcinoma [ 11 ]

Location

3'UTR (cg01379701)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:6.11E-03; Z-score:2.44E-01

Methylation in Case

1.87E-02 (Median) Methylation in Control 1.80E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Obesity

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC11A1 in obesity than that in healthy individual

Studied Phenotype

Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.27E-20; Fold-change:0.277008523; Z-score:2.907798559
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Anaplastic pilocytic astrocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in anaplastic pilocytic astrocytoma than that in healthy individual

Studied Phenotype

Anaplastic pilocytic astrocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:8.14E-08; Fold-change:-0.218390547; Z-score:-1.416137848
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Anaplastic pleomorphic xanthoastrocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual

Studied Phenotype

Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.001164993; Fold-change:-0.23154836; Z-score:-1.299217618
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Cerebral hemispheric glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in cerebral hemispheric glioma than that in healthy individual

Studied Phenotype

Cerebral hemispheric glioma [ICD-11:2A00.5]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.00128614; Fold-change:-0.28786962; Z-score:-1.711180215
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Chordoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in chordoma than that in healthy individual

Studied Phenotype

Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000724679; Fold-change:-0.279618904; Z-score:-2.474746527
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Craniopharyngioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in craniopharyngioma than that in healthy individual

Studied Phenotype

Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.12E-05; Fold-change:-0.22221579; Z-score:-1.325712884
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Diffuse midline glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in diffuse midline glioma than that in healthy individual

Studied Phenotype

Diffuse midline glioma [ICD-11:2A00.0Z]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.27E-19; Fold-change:-0.252639361; Z-score:-1.397814588
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  RELA YAP fusion ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC11A1 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:9.69E-11; Fold-change:-0.21659148; Z-score:-1.361411235
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.33E-13; Fold-change:-0.374098079; Z-score:-2.355102323
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroepithelial tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in brain neuroepithelial tumour than that in healthy individual

Studied Phenotype

Brain neuroepithelial tumour [ICD-11:2A00.2Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.66E-13; Fold-change:-0.442569994; Z-score:-2.875966396
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Cerebellar liponeurocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:3.33E-10; Fold-change:-0.59127381; Z-score:-3.485579053
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Glioblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in glioblastoma than that in healthy individual

Studied Phenotype

Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:6.50E-13; Fold-change:-0.3668635; Z-score:-2.131240355
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.26E-33; Fold-change:-0.597484731; Z-score:-3.960907715
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.32E-22; Fold-change:-0.512063328; Z-score:-3.287101202
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Posterior fossa ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLC11A1 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.00E-86; Fold-change:-0.57869342; Z-score:-3.242845843
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1199 directly targets SLC11A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1199 miRNA Mature ID miR-1199-3p

miRNA Sequence

UGCGGCCGGUGCUCAACCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1233 directly targets SLC11A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1233 miRNA Mature ID miR-1233-5p

miRNA Sequence

AGUGGGAGGCCAGGGCACGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-182 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-182 miRNA Mature ID miR-182-5p

miRNA Sequence

UUUGGCAAUGGUAGAACUCACACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1908 directly targets SLC11A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1908 miRNA Mature ID miR-1908-3p

miRNA Sequence

CCGGCCGCCGGCUCCGCCCCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-196a directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-196a miRNA Mature ID miR-196a-3p

miRNA Sequence

CGGCAACAAGAAACUGCCUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-339 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-4446 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4446 miRNA Mature ID miR-4446-5p

miRNA Sequence

AUUUCCCUGCCAUUCCCUUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-4510 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4510 miRNA Mature ID miR-4510

miRNA Sequence

UGAGGGAGUAGGAUGUAUGGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-4755 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-5p

miRNA Sequence

UUUCCCUUCAGAGCCUGGCUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-5006 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5006 miRNA Mature ID miR-5006-3p

miRNA Sequence

UUUCCCUUUCCAUCCUGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-6127 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6127 miRNA Mature ID miR-6127

miRNA Sequence

UGAGGGAGUGGGUGGGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-6129 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6129 miRNA Mature ID miR-6129

miRNA Sequence

UGAGGGAGUUGGGUGUAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-6130 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6130 miRNA Mature ID miR-6130

miRNA Sequence

UGAGGGAGUGGAUUGUAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-6133 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6133 miRNA Mature ID miR-6133

miRNA Sequence

UGAGGGAGGAGGUUGGGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-6760 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6760 miRNA Mature ID miR-6760-5p

miRNA Sequence

CAGGGAGAAGGUGGAAGUGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-6778 directly targets SLC11A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-5p

miRNA Sequence

AGUGGGAGGACAGGAGGCAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-6853 directly targets SLC11A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6853 miRNA Mature ID miR-6853-5p

miRNA Sequence

AGCGUGGGAUGUCCAUGAAGUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-6873 directly targets SLC11A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6873 miRNA Mature ID miR-6873-5p

miRNA Sequence

CAGAGGGAAUACAGAGGGCAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
12 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
13 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.