General Information of Drug Transporter (DT)
DT ID DTD0045 Transporter Info
Gene Name ABCA7
Transporter Name ATP-binding cassette sub-family A member 7
Gene ID
10347
UniProt ID
Q8IZY2
Epigenetic Regulations of This DT (EGR)

Methylation

  Breast cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in breast cancer [ 1 ]

Location

5'UTR (cg10749413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:4.07E-03; Z-score:-5.04E-01

Methylation in Case

5.31E-02 (Median) Methylation in Control 6.63E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in breast cancer [ 1 ]

Location

TSS1500 (cg06730721)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.49E-02; Z-score:-4.94E-01

Methylation in Case

4.10E-02 (Median) Methylation in Control 4.93E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg06169110)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.28E-11; Z-score:1.50E+00

Methylation in Case

7.39E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg02986791)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:9.79E-07; Z-score:8.92E-01

Methylation in Case

8.15E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg26576206)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:1.21E-04; Z-score:4.86E-01

Methylation in Case

6.33E-02 (Median) Methylation in Control 4.98E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg12082025)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.44E-04; Z-score:6.58E-01

Methylation in Case

7.62E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg05372495)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:7.80E-04; Z-score:6.48E-01

Methylation in Case

8.06E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg02253236)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.43E-03; Z-score:1.47E+00

Methylation in Case

7.34E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg02959678)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.97E-03; Z-score:1.40E+00

Methylation in Case

8.38E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg24145486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.01E-02; Z-score:-8.89E-01

Methylation in Case

8.35E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg02807077)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:1.44E-02; Z-score:8.58E-01

Methylation in Case

8.65E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg18529892)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.58E-02; Z-score:-2.58E-02

Methylation in Case

6.86E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg23027715)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.02E-02; Z-score:5.42E-01

Methylation in Case

8.08E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA7 in breast cancer [ 1 ]

Location

Body (cg13761375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:4.93E-02; Z-score:2.56E-01

Methylation in Case

2.62E-02 (Median) Methylation in Control 2.40E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

5'UTR (cg10749413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.46E-02; Z-score:-5.95E-01

Methylation in Case

8.36E-02 (Median) Methylation in Control 9.60E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

TSS200 (cg21590311)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.74E-03; Z-score:7.14E-01

Methylation in Case

1.10E-01 (Median) Methylation in Control 9.39E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg23027715)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.06E-04; Z-score:-4.72E-01

Methylation in Case

9.22E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg05372495)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:5.43E-04; Z-score:-5.61E-01

Methylation in Case

8.20E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg10406526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.30E-03; Z-score:-7.40E-01

Methylation in Case

8.83E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg00874873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.23E-03; Z-score:-5.58E-01

Methylation in Case

9.32E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg18529892)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:8.94E-03; Z-score:-8.52E-01

Methylation in Case

8.21E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg12082025)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:3.47E-02; Z-score:-8.28E-01

Methylation in Case

5.26E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg13761375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.96E-02; Z-score:-1.28E-01

Methylation in Case

3.00E-02 (Median) Methylation in Control 3.15E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA7 in colorectal cancer [ 2 ]

Location

Body (cg24145486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.38E-02; Z-score:-5.43E-03

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

5'UTR (cg10749413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:9.62E-06; Z-score:-1.72E-02

Methylation in Case

6.07E-02 (Median) Methylation in Control 6.09E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

5'UTR (cg05989429)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.51E-05; Z-score:2.01E-01

Methylation in Case

5.23E-02 (Median) Methylation in Control 5.02E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg04957628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.02E+00 Statistic Test p-value:4.64E-16; Z-score:8.59E+00

Methylation in Case

4.37E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg26263477)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.61E-02; Z-score:-5.48E-01

Methylation in Case

8.44E-02 (Median) Methylation in Control 8.99E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

TSS200 (cg10527010)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.69E+00 Statistic Test p-value:3.38E-10; Z-score:6.56E+00

Methylation in Case

3.89E-01 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg04923840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.81E+00 Statistic Test p-value:3.58E-18; Z-score:-3.87E+00

Methylation in Case

3.25E-01 (Median) Methylation in Control 5.90E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg18529892)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.13E-05; Z-score:-6.55E-01

Methylation in Case

7.29E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg21995147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.52E-05; Z-score:4.50E-01

Methylation in Case

9.62E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg12082025)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:4.66E-05; Z-score:5.54E-01

Methylation in Case

9.32E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg02959678)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.60E-03; Z-score:7.07E-01

Methylation in Case

8.83E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg00874873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.79E-03; Z-score:-2.87E-01

Methylation in Case

8.59E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg10406526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:6.37E-03; Z-score:-1.07E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.59E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg02986791)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:9.60E-03; Z-score:4.88E-01

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg05372495)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.92E-02; Z-score:2.47E-01

Methylation in Case

9.51E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of ABCA7 in hepatocellular carcinoma [ 3 ]

Location

3'UTR (cg21318380)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.72E+00 Statistic Test p-value:8.52E-12; Z-score:-2.83E+00

Methylation in Case

2.71E-01 (Median) Methylation in Control 4.65E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in lung adenocarcinoma [ 4 ]

Location

5'UTR (cg10749413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:4.10E-03; Z-score:-1.81E+00

Methylation in Case

7.90E-02 (Median) Methylation in Control 9.19E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in lung adenocarcinoma [ 4 ]

Location

Body (cg02253236)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.70E-03; Z-score:-1.87E+00

Methylation in Case

7.88E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in lung adenocarcinoma [ 4 ]

Location

Body (cg02986791)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.78E-02; Z-score:1.28E+00

Methylation in Case

9.02E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in lung adenocarcinoma [ 4 ]

Location

Body (cg05372495)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.23E-02; Z-score:4.42E-01

Methylation in Case

9.45E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

5'UTR (cg10749413)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.87E-06; Z-score:-6.63E-01

Methylation in Case

4.25E-02 (Median) Methylation in Control 4.86E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

5'UTR (cg07951348)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.22E-02; Z-score:-1.98E-01

Methylation in Case

1.64E-01 (Median) Methylation in Control 1.70E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

TSS200 (cg07726048)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:7.54E-04; Z-score:7.58E-01

Methylation in Case

4.85E-02 (Median) Methylation in Control 4.42E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

Body (cg26576206)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.47E-03; Z-score:5.07E-01

Methylation in Case

9.38E-02 (Median) Methylation in Control 8.50E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

Body (cg02807077)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.97E-02; Z-score:4.45E-01

Methylation in Case

8.88E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

Body (cg05372495)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.12E-02; Z-score:6.30E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

Body (cg02253236)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.15E-02; Z-score:-2.73E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

Body (cg24145486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.76E-02; Z-score:-2.70E-01

Methylation in Case

9.38E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA7 in papillary thyroid cancer [ 5 ]

Location

Body (cg13761375)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.23E-02; Z-score:-5.99E-01

Methylation in Case

6.13E-02 (Median) Methylation in Control 6.78E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Bladder cancer

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

TSS1500 (cg05504606)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.21E-02; Z-score:-1.65E+00

Methylation in Case

6.10E-02 (Median) Methylation in Control 7.16E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

TSS1500 (cg26263477)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:4.47E-02; Z-score:-1.99E+00

Methylation in Case

9.29E-02 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg18529892)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:6.96E-06; Z-score:-8.93E+00

Methylation in Case

5.68E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg24145486)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:9.54E-06; Z-score:-6.98E+00

Methylation in Case

8.60E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg02253236)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.87E+00 Statistic Test p-value:9.58E-06; Z-score:-5.34E+00

Methylation in Case

4.07E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg02959678)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.64E-03; Z-score:-1.69E+00

Methylation in Case

8.07E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg10406526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:9.71E-03; Z-score:-8.25E-01

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg23657707)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.59E-02; Z-score:-2.71E+00

Methylation in Case

9.78E-01 (Median) Methylation in Control 9.84E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg26576206)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:1.65E-02; Z-score:-2.19E+00

Methylation in Case

5.31E-02 (Median) Methylation in Control 8.45E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA7 in bladder cancer [ 6 ]

Location

Body (cg02817925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.89E-02; Z-score:-2.73E+00

Methylation in Case

9.77E-01 (Median) Methylation in Control 9.83E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in clear cell renal cell carcinoma [ 7 ]

Location

TSS1500 (cg06730721)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.39E-03; Z-score:7.52E-01

Methylation in Case

1.56E-02 (Median) Methylation in Control 1.37E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in clear cell renal cell carcinoma [ 7 ]

Location

TSS200 (cg07726048)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.88E-04; Z-score:7.93E-01

Methylation in Case

1.79E-02 (Median) Methylation in Control 1.58E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in clear cell renal cell carcinoma [ 7 ]

Location

TSS200 (cg21590311)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.03E-03; Z-score:4.11E-01

Methylation in Case

2.40E-02 (Median) Methylation in Control 2.25E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in clear cell renal cell carcinoma [ 7 ]

Location

Body (cg18529892)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.23E-03; Z-score:-3.14E-01

Methylation in Case

8.69E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in clear cell renal cell carcinoma [ 7 ]

Location

Body (cg26576206)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.39E+00 Statistic Test p-value:5.00E-03; Z-score:4.44E-01

Methylation in Case

4.71E-02 (Median) Methylation in Control 3.39E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in clear cell renal cell carcinoma [ 7 ]

Location

Body (cg02817925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:3.00E-02; Z-score:9.08E-02

Methylation in Case

9.72E-01 (Median) Methylation in Control 9.72E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in colon adenocarcinoma [ 8 ]

Location

TSS1500 (cg18543242)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:5.33E-05; Z-score:-1.62E+00

Methylation in Case

5.16E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in colon adenocarcinoma [ 8 ]

Location

TSS1500 (cg13126638)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:4.08E-04; Z-score:-1.29E+00

Methylation in Case

4.75E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in colon adenocarcinoma [ 8 ]

Location

Body (cg15573830)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:5.21E-04; Z-score:-1.46E+00

Methylation in Case

3.95E-01 (Median) Methylation in Control 4.93E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in colon adenocarcinoma [ 8 ]

Location

Body (cg03771731)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:6.45E-04; Z-score:-5.11E+00

Methylation in Case

7.05E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in colon adenocarcinoma [ 8 ]

Location

Body (cg14634247)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:7.89E-04; Z-score:-7.33E-01

Methylation in Case

1.10E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in colon adenocarcinoma [ 8 ]

Location

Body (cg24585559)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.38E-03; Z-score:-1.25E+00

Methylation in Case

8.29E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.62E-03; Z-score:-7.37E-01

Methylation in Case

5.32E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS1500 (cg24977541)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.53E-02; Z-score:8.80E-01

Methylation in Case

7.58E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS200 (cg13177758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:7.79E-14; Z-score:1.20E+00

Methylation in Case

1.45E-01 (Median) Methylation in Control 1.13E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS200 (cg13433302)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:1.27E-06; Z-score:7.08E-01

Methylation in Case

2.38E-01 (Median) Methylation in Control 2.00E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS200 (cg01227078)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.96E-03; Z-score:-3.92E-01

Methylation in Case

1.19E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg16484020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.00E-06; Z-score:-1.00E+00

Methylation in Case

6.40E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg09467487)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.00E-05; Z-score:1.16E+00

Methylation in Case

7.53E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg01856752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.74E-04; Z-score:9.13E-01

Methylation in Case

7.72E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg12853184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:7.13E-04; Z-score:-8.76E-01

Methylation in Case

2.19E-01 (Median) Methylation in Control 2.79E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg00893603)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.09E-03; Z-score:-6.43E-01

Methylation in Case

7.51E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg07525751)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.83E-02; Z-score:4.97E-01

Methylation in Case

8.18E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

3'UTR (cg24697925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.03E-04; Z-score:9.58E-01

Methylation in Case

8.83E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of ABCA7 in pancretic ductal adenocarcinoma [ 9 ]

Location

3'UTR (cg01923881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.47E-02; Z-score:4.34E-01

Methylation in Case

8.23E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Panic disorder

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in panic disorder [ 10 ]

Location

TSS1500 (cg05504606)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:9.92E-01 Statistic Test p-value:4.07E-02; Z-score:1.30E-01

Methylation in Case

-4.86E+00 (Median) Methylation in Control -4.89E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of ABCA7 in panic disorder [ 10 ]

Location

Body (cg00874873)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.04E-02; Z-score:3.99E-01

Methylation in Case

3.60E+00 (Median) Methylation in Control 3.39E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of ABCA7 in panic disorder [ 10 ]

Location

Body (cg10406526)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.52E-02; Z-score:-3.93E-01

Methylation in Case

5.49E+00 (Median) Methylation in Control 5.56E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of ABCA7 in panic disorder [ 10 ]

Location

Body (cg02817925)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.36E-02; Z-score:-2.94E-01

Methylation in Case

5.26E+00 (Median) Methylation in Control 5.31E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of ABCA7 in panic disorder [ 10 ]

Location

Body (cg18529892)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.53E-02; Z-score:3.62E-01

Methylation in Case

1.68E+00 (Median) Methylation in Control 1.56E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of ABCA7 in panic disorder [ 10 ]

Location

Body (cg21995147)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.01E-02; Z-score:-2.33E-01

Methylation in Case

4.96E+00 (Median) Methylation in Control 5.04E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of ABCA7 in prostate cancer [ 11 ]

Location

Body (cg04100956)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.94E-02; Z-score:1.91E+00

Methylation in Case

8.50E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-335 directly targets ABCA7 [ 12 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide Scan for Methylation Profiles in Breast Cancer
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 DNA Methylation Dynamics in Urological Tumors.
7 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.