Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0036 Transporter Info
Gene Name	ABCA1
Transporter Name	ATP-binding cassette sub-family A member 1
Gene ID	19
UniProt ID	O95477

Epigenetic Regulations of This DT (EGR)
Methylation
Atherosclerosis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of ABCA1 in atherosclerosis			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Nested methylation PCR
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
Studied Phenotype	Atherosclerosis[ ICD-11:BD40]
Frequency	90 (60%) out of the 150 studied AS samples
Experimental Material	Patient tissue samples
Additional Notes	ABCA1 may serve as a valuable biomarker for the early detection of AS.
Ovarian cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of ABCA1 in ovarian cancer			[ 2 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
Studied Phenotype	Ovarian cancer[ ICD-11:2C73]
Experimental Material	Multiple cell lines of human
Additional Notes	Hypermethylation of ABCA1 associates with poor prognosis in ovarian cancer patients.
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of ABCA1 in prostate cancer			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	Western Blot
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Additional Notes	ABCA1 Hypermethylation and loss of protein expression direct high intracellular cholesterol levels and hence contribute to an environment conducive to tumor progression.
Epigenetic Phenomenon2	Hypermethylation of ABCA1 in prostate cancer			[ 3 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples, Multiple cell lines of human
Additional Notes	ABCA1 Hypermethylation and loss of protein expression direct high intracellular cholesterol levels and hence contribute to an environment conducive to tumor progression.
Epigenetic Phenomenon3	Methylation of ABCA1 in prostate cancer			[ 19 ]
Location	Body (cg06260647)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.46E-03; Z-score:4.09E+00
Methylation in Case	9.52E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Pulmonary arterial hypertension	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of ABCA1 in pulmonary arterial hypertension			[ 4 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
Studied Phenotype	Pulmonary arterial hypertension[ ICD-11:BB01.0]
Experimental Material	Patient tissue samples
Additional Notes	This experiment validated ABCA1 downregulation as a pathomechanism of PAH and made the proof-of-concept that its targeting may offer novel therapeutic options.
Epigenetic Phenomenon2	Hypermethylation of ABCA1 in pulmonary arterial hypertension			[ 4 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	Immunohistochemistry
Studied Phenotype	Pulmonary arterial hypertension[ ICD-11:BB01.0]
Experimental Material	Patient tissue samples
Additional Notes	This experiment validated ABCA1 downregulation as a pathomechanism of PAH and made the proof-of-concept that its targeting may offer novel therapeutic options.
Coronary artery disease	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of ABCA1 in coronary artery disease			[ 5 ]
Location	Promoter (8 CpG sites)
Epigenetic Type	Methylation	Experiment Method	Bisulfite sequencing
Related Molecular Changes	level ofABCA1Unchanged	Experiment Method	RT-qPCR
Studied Phenotype	Coronary artery disease[ ICD-11:BA6Z]
Frequency	40% of the studied CAD samples
Experimental Material	Patient tissue samples
Additional Notes	ABCA1 epigenotypes were associated with HDL particle-related phenotypes and CAD.
Epigenetic Phenomenon2	Hypermethylation of ABCA1 in coronary artery disease			[ 24 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Studied Phenotype	Coronary artery disease[ ICD-11:BA6Z]
Frequency	73% of the studied CAD samples
Experimental Material	Patient tissue samples
Additional Notes	DNA methylation levels at the ABCA1 gene promoter locus are associated with aging and CAD in men.
Epigenetic Phenomenon3	Hypermethylation of ABCA1 in coronary artery disease			[ 25 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Studied Phenotype	Coronary artery disease[ ICD-11:BA6Z]
Frequency	18 (16%) out of the 110 studied CAD samples
Experimental Material	Patient tissue samples
Additional Notes	No association was seen between plasma lipid concentration and the promoter DNA methylation status of ABCA1 (P>0.05). Also, the association between the severity of CAD and methylation of ABCA1 gene was not significant (P>0.05).
Atypical teratoid rhabdoid tumor	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg02945674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:1.36E-08; Z-score:1.31E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:7.89E-07; Z-score:1.10E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	6.01E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14313833)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:7.97E-07; Z-score:-1.13E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14431850)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.82E+00	Statistic Test	p-value:8.27E-07; Z-score:-1.45E+00
Methylation in Case	1.67E-01 (Median)	Methylation in Control	3.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14470647)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:9.03E-07; Z-score:-1.06E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14491628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.66E+00	Statistic Test	p-value:9.21E-07; Z-score:-1.42E+00
Methylation in Case	2.29E-01 (Median)	Methylation in Control	3.81E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14564724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:9.33E-07; Z-score:-1.61E+00
Methylation in Case	5.71E-01 (Median)	Methylation in Control	7.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg14630985)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:9.63E-07; Z-score:1.00E+00
Methylation in Case	9.11E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg20211653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:4.01E-06; Z-score:1.01E+00
Methylation in Case	8.60E-01 (Median)	Methylation in Control	7.50E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	5'UTR (cg21572316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:5.24E-06; Z-score:8.95E-01
Methylation in Case	9.02E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	Body (cg13571501)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.71E-02; Z-score:-2.87E-01
Methylation in Case	9.55E-01 (Median)	Methylation in Control	9.73E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	Body (cg14063654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:4.24E-02; Z-score:5.14E-01
Methylation in Case	3.80E-01 (Median)	Methylation in Control	3.58E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	Body (cg14065382)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.79E+00	Statistic Test	p-value:4.25E-02; Z-score:-5.66E-01
Methylation in Case	2.36E-02 (Median)	Methylation in Control	4.22E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	Body (cg14299235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:4.44E-02; Z-score:-1.37E-01
Methylation in Case	8.38E-02 (Median)	Methylation in Control	8.67E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	Body (cg14326305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:4.54E-02; Z-score:6.49E-01
Methylation in Case	4.18E-01 (Median)	Methylation in Control	3.57E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of ABCA1 in atypical teratoid rhabdoid tumor			[ 6 ]
Location	3'UTR (cg13559409)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:2.62E-11; Z-score:-2.31E+00
Methylation in Case	7.40E-01 (Median)	Methylation in Control	8.53E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.87E+00	Statistic Test	p-value:2.69E-04; Z-score:-3.26E+00
Methylation in Case	3.84E-02 (Median)	Methylation in Control	7.18E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	5'UTR (cg02945674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.46E-03; Z-score:-9.25E-01
Methylation in Case	7.67E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	5'UTR (cg14630985)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:5.28E-03; Z-score:-2.45E+00
Methylation in Case	9.96E-02 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:4.28E-03; Z-score:2.64E+00
Methylation in Case	5.06E-01 (Median)	Methylation in Control	4.13E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	Body (cg14326305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.04E+00	Statistic Test	p-value:1.03E-08; Z-score:-8.74E+00
Methylation in Case	2.62E-01 (Median)	Methylation in Control	5.34E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	Body (cg13571501)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.21E-03; Z-score:-2.32E+00
Methylation in Case	6.00E-01 (Median)	Methylation in Control	7.13E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	Body (cg14299235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.13E-03; Z-score:-2.23E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of ABCA1 in bladder cancer			[ 7 ]
Location	3'UTR (cg13559409)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:8.59E-04; Z-score:-2.87E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.38E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in breast cancer			[ 8 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:9.18E-06; Z-score:1.07E+00
Methylation in Case	5.88E-02 (Median)	Methylation in Control	3.71E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in breast cancer			[ 8 ]
Location	5'UTR (cg21572316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:3.28E-05; Z-score:9.48E-01
Methylation in Case	7.48E-02 (Median)	Methylation in Control	5.91E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in breast cancer			[ 8 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:8.07E-25; Z-score:3.43E+00
Methylation in Case	5.74E-01 (Median)	Methylation in Control	3.63E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in breast cancer			[ 8 ]
Location	Body (cg14065382)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.33E-07; Z-score:-1.47E+00
Methylation in Case	8.47E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in clear cell renal cell carcinoma			[ 9 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-4.02E+00	Statistic Test	p-value:1.38E-11; Z-score:-1.74E+00
Methylation in Case	3.40E-02 (Median)	Methylation in Control	1.37E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in clear cell renal cell carcinoma			[ 9 ]
Location	5'UTR (cg14564724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:7.22E-06; Z-score:-1.92E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in clear cell renal cell carcinoma			[ 9 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:4.92E-05; Z-score:1.56E+00
Methylation in Case	5.18E-01 (Median)	Methylation in Control	4.02E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in clear cell renal cell carcinoma			[ 9 ]
Location	TSS200 (cg05286874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:6.22E-03; Z-score:5.93E-01
Methylation in Case	1.87E-02 (Median)	Methylation in Control	1.61E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colon cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in colon adenocarcinoma			[ 10 ]
Location	5'UTR (cg06204922)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.58E+00	Statistic Test	p-value:1.38E-08; Z-score:5.57E+00
Methylation in Case	5.73E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in colon adenocarcinoma			[ 10 ]
Location	TSS200 (cg22331862)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:5.61E-06; Z-score:1.40E+00
Methylation in Case	6.45E-01 (Median)	Methylation in Control	5.34E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg17835072)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:2.13E-05; Z-score:-3.47E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in colon adenocarcinoma			[ 10 ]
Location	Body (cg01940336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:9.82E-04; Z-score:-3.03E+00
Methylation in Case	6.39E-01 (Median)	Methylation in Control	6.99E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in colorectal cancer			[ 11 ]
Location	5'UTR (cg14313833)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.49E-02; Z-score:-6.12E-01
Methylation in Case	8.89E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in colorectal cancer			[ 11 ]
Location	5'UTR (cg21572316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.11E-02; Z-score:9.56E-01
Methylation in Case	9.68E-02 (Median)	Methylation in Control	8.44E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in colorectal cancer			[ 11 ]
Location	Body (cg14065382)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:6.85E-05; Z-score:-1.35E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in colorectal cancer			[ 11 ]
Location	Body (cg13571501)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:2.29E-02; Z-score:-4.83E-01
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of ABCA1 in colorectal cancer			[ 11 ]
Location	3'UTR (cg13559409)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.39E-04; Z-score:1.11E+00
Methylation in Case	9.21E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	16 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg21572316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:1.83E-04; Z-score:-7.76E-01
Methylation in Case	5.64E-02 (Median)	Methylation in Control	6.77E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg14431850)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:2.40E-04; Z-score:-1.13E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	5.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg14313833)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:2.41E-04; Z-score:-1.00E+00
Methylation in Case	4.01E-01 (Median)	Methylation in Control	4.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg14564724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:9.23E-04; Z-score:-1.03E+00
Methylation in Case	4.69E-01 (Median)	Methylation in Control	5.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg14470647)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:1.44E-03; Z-score:-4.25E-01
Methylation in Case	4.38E-02 (Median)	Methylation in Control	5.22E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.27E+00	Statistic Test	p-value:6.84E-03; Z-score:-5.41E-01
Methylation in Case	4.40E-02 (Median)	Methylation in Control	5.58E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	5'UTR (cg14630985)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.67E-02; Z-score:-4.89E-01
Methylation in Case	8.54E-02 (Median)	Methylation in Control	9.45E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.04E-05; Z-score:1.56E+00
Methylation in Case	6.63E-01 (Median)	Methylation in Control	5.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	TSS1500 (cg13430450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.36E-02; Z-score:-1.24E-01
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	TSS200 (cg05286874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.87E-03; Z-score:-5.81E-01
Methylation in Case	5.60E-02 (Median)	Methylation in Control	6.17E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg15746253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.01E+00	Statistic Test	p-value:1.11E-25; Z-score:-3.39E+00
Methylation in Case	3.38E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg21938718)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.38E+00	Statistic Test	p-value:2.74E-14; Z-score:-4.09E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	7.51E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg14063654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:3.94E-08; Z-score:1.06E+00
Methylation in Case	7.73E-01 (Median)	Methylation in Control	6.69E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg14326305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:1.43E-06; Z-score:-1.14E+00
Methylation in Case	3.65E-01 (Median)	Methylation in Control	4.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg14065382)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:2.21E-03; Z-score:5.54E-01
Methylation in Case	8.86E-01 (Median)	Methylation in Control	8.68E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of ABCA1 in hepatocellular carcinoma			[ 12 ]
Location	Body (cg14299235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.43E-02; Z-score:-1.94E-01
Methylation in Case	7.45E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	5'UTR (cg14470647)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.80E+00	Statistic Test	p-value:5.84E-05; Z-score:1.98E+00
Methylation in Case	6.75E-02 (Median)	Methylation in Control	3.75E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	5'UTR (cg21572316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:7.21E-05; Z-score:1.14E+00
Methylation in Case	8.55E-02 (Median)	Methylation in Control	6.61E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	5'UTR (cg14630985)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:1.18E-03; Z-score:1.27E+00
Methylation in Case	1.02E-01 (Median)	Methylation in Control	8.28E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.68E+00	Statistic Test	p-value:6.96E-03; Z-score:9.16E-01
Methylation in Case	8.50E-02 (Median)	Methylation in Control	5.05E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:3.45E-02; Z-score:3.63E-01
Methylation in Case	6.55E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	TSS200 (cg05286874)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.44E+00	Statistic Test	p-value:1.23E-04; Z-score:1.80E+00
Methylation in Case	6.99E-02 (Median)	Methylation in Control	4.85E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	Body (cg14065382)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:4.59E-07; Z-score:-2.50E+00
Methylation in Case	8.85E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	Body (cg14326305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:5.59E-07; Z-score:-2.76E+00
Methylation in Case	8.47E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	Body (cg14299235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:4.95E-02; Z-score:-7.93E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	9.25E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of ABCA1 in HIV infection			[ 13 ]
Location	3'UTR (cg13559409)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:5.51E-04; Z-score:-1.54E+00
Methylation in Case	8.46E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in lung adenocarcinoma			[ 14 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.94E+00	Statistic Test	p-value:6.58E-04; Z-score:-2.00E+00
Methylation in Case	1.26E-01 (Median)	Methylation in Control	2.45E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in lung adenocarcinoma			[ 14 ]
Location	5'UTR (cg20211653)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:1.34E-02; Z-score:-1.14E+00
Methylation in Case	7.76E-02 (Median)	Methylation in Control	9.08E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in lung adenocarcinoma			[ 14 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.24E+00	Statistic Test	p-value:1.20E-03; Z-score:2.30E+00
Methylation in Case	6.85E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in panic disorder			[ 15 ]
Location	5'UTR (cg14313833)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:3.09E-02; Z-score:4.30E-01
Methylation in Case	2.96E+00 (Median)	Methylation in Control	2.86E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in panic disorder			[ 15 ]
Location	Body (cg14326305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.16E-02; Z-score:3.54E-01
Methylation in Case	3.16E+00 (Median)	Methylation in Control	3.00E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in papillary thyroid cancer			[ 16 ]
Location	5'UTR (cg14470647)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:1.84E-07; Z-score:-6.83E-01
Methylation in Case	6.70E-02 (Median)	Methylation in Control	8.77E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in papillary thyroid cancer			[ 16 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:1.76E-02; Z-score:-6.00E-01
Methylation in Case	8.00E-02 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in papillary thyroid cancer			[ 16 ]
Location	5'UTR (cg21572316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:2.11E-02; Z-score:-5.29E-01
Methylation in Case	4.85E-02 (Median)	Methylation in Control	5.39E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in papillary thyroid cancer			[ 16 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.48E-02; Z-score:9.68E-01
Methylation in Case	5.55E-01 (Median)	Methylation in Control	5.08E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in systemic lupus erythematosus			[ 17 ]
Location	5'UTR (cg14170545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.20E-02; Z-score:1.59E-01
Methylation in Case	6.96E-02 (Median)	Methylation in Control	6.16E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in systemic lupus erythematosus			[ 17 ]
Location	TSS1500 (cg14019050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.83E-02; Z-score:1.19E-01
Methylation in Case	7.19E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg14065382)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.57E-02; Z-score:-1.89E-01
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in systemic lupus erythematosus			[ 17 ]
Location	Body (cg14063654)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.05E-02; Z-score:-3.15E-01
Methylation in Case	9.22E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of ABCA1 in pancretic ductal adenocarcinoma			[ 18 ]
Location	TSS1500 (cg09378339)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:6.13E-08; Z-score:-1.10E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of ABCA1 in pancretic ductal adenocarcinoma			[ 18 ]
Location	TSS1500 (cg07080372)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.50E+00	Statistic Test	p-value:4.10E-02; Z-score:-1.09E+00
Methylation in Case	1.95E-01 (Median)	Methylation in Control	2.92E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of ABCA1 in pancretic ductal adenocarcinoma			[ 18 ]
Location	TSS200 (cg18871020)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:1.54E-09; Z-score:2.54E-01
Methylation in Case	1.11E-01 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of ABCA1 in pancretic ductal adenocarcinoma			[ 18 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.71E+00	Statistic Test	p-value:3.09E-16; Z-score:2.57E+00
Methylation in Case	1.70E-01 (Median)	Methylation in Control	9.92E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
microRNA
Ischemic stroke	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Higher expression of miR-23a-5p in acute ischemic stroke			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-23a	miRNA Mature ID	miR-23a-5p
miRNA Sequence	GGGGUUCCUGGGGAUGGGAUUU
miRNA Target Type	Direct
Studied Phenotype	Ischemic stroke[ ICD-11:8B11]
Experimental Material	Patient tissue samples
Additional Notes	miR-23a-5p regulates cholesterol efflux in ABCA1-dependent pathway and miR-23a-5p might be a potential therapeutic target for suppressing atherosclerosis.
Atherosclerosis	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Higher expression of miR-33b in hypercholesterolemic plaques			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Bioinformatic prediction
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-33b	miRNA Mature ID	miR-33a-3p
miRNA Sequence	CAAUGUUUCCACAGUGCAUCAC
miRNA Target Type	Direct
Studied Phenotype	Atherosclerosis[ ICD-11:BD40]
Experimental Material	Patient tissue samples
Additional Notes	microRNA 33b is a potential modulators of ABCA1 expression in human atherosclerotic plaques.
Epigenetic Phenomenon2	Higher expression of miR-758 in hypercholesterolemic plaques			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Bioinformatic prediction
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	Western Blot
miRNA Stemloop ID	miR-758	miRNA Mature ID	miR-758-5p
miRNA Sequence	GAUGGUUGACCAGAGAGCACAC
miRNA Target Type	Direct
Studied Phenotype	Atherosclerosis[ ICD-11:BD40]
Experimental Material	Patient tissue samples
Additional Notes	microRNA 758 is a potential modulators of ABCA1 expression in human atherosclerotic plaques.
Epigenetic Phenomenon3	miR-486 downregulates ABCA1 expression			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-486	miRNA Mature ID	miR-486-3p
miRNA Sequence	CGGGGCAGCUCAGUACAGGAU
miRNA Target Type	Direct
Studied Phenotype	Atherosclerosis[ ICD-11:BD40]
Experimental Material	THP-1 macrophage-derived foam cells
Additional Notes	miR-486 inhibits ABCA1 mediated cholesterol efflux by targeting the 3UTR of HAT1, which can negatively regulate the acetylation levels of H4K5 and H4K12.
Pancreatic islets	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Lower expression of miR-33a in pancreatic islets (compare with liver)			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation ofABCA1	Experiment Method	RT-qPCR
miRNA Stemloop ID	miR-33a	miRNA Mature ID	miR-33a-3p
miRNA Sequence	CAAUGUUUCCACAGUGCAUCAC
miRNA Target Type	Direct
Studied Phenotype	Pancreatic islets
Experimental Material	Model organism in vivo (mouse)
Additional Notes	miR-33a modulates ABCA1 expression, cholesterol accumulation, and insulin secretion in pancreatic islets.
Unclear Phenotype	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-106b directly targets ABCA1			[ 26 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon2	miR-10b directly targets RALBP1			[ 27 ]
Epigenetic Type	microRNA	Experiment Method	miRNA Microarray Analysis
miRNA Stemloop ID	miR-10b	miRNA Mature ID	miR-10b-5p
miRNA Sequence	UACCCUGUAGAACCGAAUUUGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	miR-20a directly targets ABCA1			[ 26 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20a	miRNA Mature ID	miR-20a-5p
miRNA Sequence	UAAAGUGCUUAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-20b directly targets ABCA1			[ 26 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20b	miRNA Mature ID	miR-20b-5p
miRNA Sequence	CAAAGUGCUCAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-26b directly targets ABCA1			[ 28 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon6	miR-519d directly targets ABCA1			[ 26 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-3p
miRNA Sequence	CAAAGUGCCUCCCUUUAGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis. Mol Med Rep. 2016 Jun;13(6):4791-9.
2	Hypermethylation of the TGF- target, ABCA1 is associated with poor prognosis in ovarian cancer patients. Clin Epigenetics. 2015 Jan 14;7:1.
3	Dysregulation of cholesterol homeostasis in human prostate cancer through loss of ABCA1. Cancer Res. 2013 Feb 1;73(3):1211-8.
4	Pulmonary endothelial cell DNA methylation signature in pulmonary arterial hypertension. Oncotarget. 2017 May 19;8(32):52995-53016.
5	ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia. Epigenetics. 2012 May;7(5):464-72.
6	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
7	DNA Methylation Dynamics in Urological Tumors.
8	Genome-wide Scan for Methylation Profiles in Breast Cancer
9	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
10	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
12	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
13	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
14	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
17	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
19	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
20	MicroRNA-23a-5p promotes atherosclerotic plaque progression and vulnerability by repressing ATP-binding cassette transporter A1/G1 in macrophages. J Mol Cell Cardiol. 2018 Oct;123:139-149.
21	Identification of microRNAs 758 and 33b as potential modulators of ABCA1 expression in human atherosclerotic plaques. Nutr Metab Cardiovasc Dis. 2015 Feb;25(2):202-9.
22	miR-33a modulates ABCA1 expression, cholesterol accumulation, and insulin secretion in pancreatic islets. Diabetes. 2012 Mar;61(3):653-8.
23	MiR-486 regulates cholesterol efflux by targeting HAT1. Biochem Biophys Res Commun. 2016 Apr 8;472(3):418-24.
24	Acetylsalicylic acid, aging and coronary artery disease are associated with ABCA1 DNA methylation in men. Clin Epigenetics. 2014 Jul 29;6(1):14.
25	A preliminary study of the association between the ABCA1 gene promoter DNA methylation and coronary artery disease risk. Mol Biol Res Commun. 2018 Jun;7(2):59-65.
26	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
27	Gut microbiota metabolism of anthocyanin promotes reverse cholesterol transport in mice via repressing miRNA-10b. Circ Res. 2012 Sep 28;111(8):967-81.
28	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence