General Information of Drug Transporter (DT)
DT ID DTD0034 Transporter Info
Gene Name SLC18A2
Transporter Name Vesicular amine transporter 2
Gene ID
6571
UniProt ID
Q05940
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC18A2 in prostate cancer [ 1 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

Down regulation ofSLC18A2 Experiment Method Microarrays

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

Additional Notes

SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer.

  Epigenetic Phenomenon2

Hypermethylation of SLC18A2 in prostate cancer [ 1 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

Down regulation ofSLC18A2 Experiment Method Western Blot

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

Additional Notes

SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer.

  Epigenetic Phenomenon3

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

5'UTR (cg01790523)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.91E+00 Statistic Test p-value:2.79E-02; Z-score:-2.20E+00

Methylation in Case

3.48E-01 (Median) Methylation in Control 6.65E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

5'UTR (cg05919690)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.16E-02; Z-score:-1.56E+00

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

TSS1500 (cg26062856)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:4.93E-02; Z-score:5.88E+00

Methylation in Case

8.25E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

TSS200 (cg22928082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.05E+00 Statistic Test p-value:4.52E-04; Z-score:7.67E+00

Methylation in Case

7.33E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

TSS200 (cg18158438)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.83E+00 Statistic Test p-value:3.25E-02; Z-score:2.53E+00

Methylation in Case

5.97E-01 (Median) Methylation in Control 3.26E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

Body (cg19807207)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.81E-02; Z-score:1.76E+00

Methylation in Case

9.01E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

Body (cg15829073)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.36E-02; Z-score:1.60E+00

Methylation in Case

9.04E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in prostate cancer [ 12 ]

Location

3'UTR (cg13605398)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.95E+00 Statistic Test p-value:3.96E-02; Z-score:1.29E+01

Methylation in Case

4.97E-01 (Median) Methylation in Control 1.00E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Hypermethylation of SLC18A2 in prostate cancer [ 17 ]

Location

Promoter (cg00498305)

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

Additional Notes

A novel four-gene (AOX1xGSTP1xHAPLN3xSLC18A2) epigenetic field effect signature with over 30% sensitivity for PC at 100% fixed specificity.

  Atypical teratoid rhabdoid tumor

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:5.20E-09; Z-score:-1.42E+00

Methylation in Case

8.44E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.68E+00 Statistic Test p-value:1.38E-07; Z-score:-1.64E+00

Methylation in Case

1.49E-01 (Median) Methylation in Control 4.00E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:3.35E-06; Z-score:1.54E+00

Methylation in Case

7.28E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg01043119)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.53E-05; Z-score:1.28E+00

Methylation in Case

9.09E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.43E-02; Z-score:3.55E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

3'UTR (cg14995160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:5.64E-11; Z-score:-2.04E+00

Methylation in Case

6.97E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:1.91E-03; Z-score:5.16E+00

Methylation in Case

1.75E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.74E+00 Statistic Test p-value:2.91E-03; Z-score:3.00E+00

Methylation in Case

1.05E-01 (Median) Methylation in Control 6.02E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:7.40E-03; Z-score:3.03E+00

Methylation in Case

1.53E-02 (Median) Methylation in Control 1.07E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:1.98E-02; Z-score:2.75E+00

Methylation in Case

4.87E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.61E+00 Statistic Test p-value:3.51E-03; Z-score:1.82E+00

Methylation in Case

1.20E-01 (Median) Methylation in Control 7.49E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

Body (cg15520443)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.26E+00 Statistic Test p-value:2.78E-08; Z-score:-7.77E+00

Methylation in Case

9.29E-02 (Median) Methylation in Control 3.95E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:4.41E-04; Z-score:-4.92E+00

Methylation in Case

8.75E-02 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

Body (cg01043119)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:5.98E-04; Z-score:-2.56E+00

Methylation in Case

6.31E-02 (Median) Methylation in Control 8.21E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

Body (cg20102878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.45E-02; Z-score:-7.98E-01

Methylation in Case

8.17E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

Body (cg26583753)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.20E-02; Z-score:-5.57E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC18A2 in bladder cancer [ 3 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:3.23E-02; Z-score:-1.38E+00

Methylation in Case

7.73E-02 (Median) Methylation in Control 9.27E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:5.34E-10; Z-score:2.14E+00

Methylation in Case

1.65E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.99E+00 Statistic Test p-value:2.10E-09; Z-score:2.10E+00

Methylation in Case

1.32E-01 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:1.92E-04; Z-score:3.45E-01

Methylation in Case

1.88E-02 (Median) Methylation in Control 1.34E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.71E-09; Z-score:1.82E+00

Methylation in Case

6.19E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

TSS1500 (cg00498305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.34E+00 Statistic Test p-value:8.88E-09; Z-score:2.10E+00

Methylation in Case

3.77E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

TSS1500 (cg13980799)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:2.25E-08; Z-score:2.42E+00

Methylation in Case

5.29E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.52E+00 Statistic Test p-value:5.87E-10; Z-score:2.35E+00

Methylation in Case

2.80E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

Body (cg15225091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:4.75E-08; Z-score:-1.64E+00

Methylation in Case

3.01E-01 (Median) Methylation in Control 4.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

Body (cg15520443)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.25E+00 Statistic Test p-value:2.11E-06; Z-score:-2.00E+00

Methylation in Case

1.32E-01 (Median) Methylation in Control 2.98E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

Body (cg20102878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.03E-05; Z-score:-4.75E-01

Methylation in Case

8.19E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

Body (cg01043119)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:6.22E-04; Z-score:-8.55E-01

Methylation in Case

7.77E-02 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

Body (cg16099210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.73E-02; Z-score:2.37E-01

Methylation in Case

4.05E-02 (Median) Methylation in Control 3.58E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC18A2 in breast cancer [ 4 ]

Location

3'UTR (cg14995160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.72E-03; Z-score:-5.93E-01

Methylation in Case

7.75E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.32E+00 Statistic Test p-value:3.93E-04; Z-score:8.39E-01

Methylation in Case

3.33E-02 (Median) Methylation in Control 2.53E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:5.22E-04; Z-score:5.51E-01

Methylation in Case

1.23E-01 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.08E-02; Z-score:5.31E-01

Methylation in Case

1.78E-02 (Median) Methylation in Control 1.64E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:7.46E-06; Z-score:2.35E+00

Methylation in Case

6.54E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg13980799)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:1.12E-03; Z-score:2.21E+00

Methylation in Case

5.58E-01 (Median) Methylation in Control 3.85E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg00498305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:2.83E-03; Z-score:1.10E+00

Methylation in Case

2.99E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.30E-02; Z-score:1.95E-01

Methylation in Case

5.20E-02 (Median) Methylation in Control 4.53E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.12E-02; Z-score:-7.55E-01

Methylation in Case

8.80E-02 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.42E-02; Z-score:-1.10E-02

Methylation in Case

3.64E-02 (Median) Methylation in Control 3.65E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg16099210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.99E-02; Z-score:-1.08E-01

Methylation in Case

2.75E-02 (Median) Methylation in Control 2.85E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.43E+00 Statistic Test p-value:4.59E-15; Z-score:9.06E+00

Methylation in Case

6.31E-01 (Median) Methylation in Control 1.84E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+01 Statistic Test p-value:2.72E-13; Z-score:2.84E+01

Methylation in Case

2.98E-01 (Median) Methylation in Control 2.12E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.15E+00 Statistic Test p-value:6.62E-13; Z-score:5.65E+00

Methylation in Case

5.79E-01 (Median) Methylation in Control 2.70E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

TSS1500 (cg13980799)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:8.59E-07; Z-score:1.88E+00

Methylation in Case

7.15E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

TSS1500 (cg00498305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:8.62E-07; Z-score:1.74E+00

Methylation in Case

4.96E-01 (Median) Methylation in Control 3.88E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.90E+00 Statistic Test p-value:1.02E-15; Z-score:9.97E+00

Methylation in Case

5.63E-01 (Median) Methylation in Control 8.17E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg01043119)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.70E+00 Statistic Test p-value:7.94E-13; Z-score:7.87E+00

Methylation in Case

5.00E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg16099210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:6.42E+00 Statistic Test p-value:4.07E-12; Z-score:1.60E+01

Methylation in Case

2.64E-01 (Median) Methylation in Control 4.11E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg15520443)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.29E+00 Statistic Test p-value:9.49E-12; Z-score:-2.75E+00

Methylation in Case

2.26E-01 (Median) Methylation in Control 5.17E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.26E+00 Statistic Test p-value:2.48E-11; Z-score:8.40E+00

Methylation in Case

2.89E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.99E+00 Statistic Test p-value:5.50E-11; Z-score:5.51E+00

Methylation in Case

3.93E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg15225091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:3.62E-06; Z-score:2.52E+00

Methylation in Case

6.74E-01 (Median) Methylation in Control 5.13E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

Body (cg20102878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.90E-03; Z-score:-9.63E-01

Methylation in Case

9.29E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC18A2 in colorectal cancer [ 6 ]

Location

3'UTR (cg14995160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.61E-03; Z-score:-8.11E-01

Methylation in Case

8.55E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.60E+00 Statistic Test p-value:1.05E-07; Z-score:2.92E+00

Methylation in Case

2.73E-01 (Median) Methylation in Control 1.70E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.48E+00 Statistic Test p-value:1.59E-06; Z-score:2.04E+00

Methylation in Case

1.54E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg11826452)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:2.64E-13; Z-score:-2.16E+00

Methylation in Case

6.03E-01 (Median) Methylation in Control 7.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

TSS1500 (cg19024632)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:1.43E-10; Z-score:2.03E+00

Methylation in Case

3.97E-01 (Median) Methylation in Control 2.71E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.09E-03; Z-score:1.74E-01

Methylation in Case

7.69E-02 (Median) Methylation in Control 6.93E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg08701543)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.62E+00 Statistic Test p-value:9.74E-20; Z-score:-4.09E+00

Methylation in Case

3.96E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg19000612)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:9.29E-18; Z-score:-5.51E+00

Methylation in Case

5.71E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg17493839)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:4.62E-17; Z-score:-2.18E+01

Methylation in Case

6.28E-01 (Median) Methylation in Control 9.66E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg20122943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.61E+00 Statistic Test p-value:5.61E-16; Z-score:1.19E+01

Methylation in Case

3.54E-01 (Median) Methylation in Control 7.67E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg23880589)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.59E+00 Statistic Test p-value:2.33E-13; Z-score:3.53E+00

Methylation in Case

4.80E-01 (Median) Methylation in Control 3.02E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg15520443)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.01E+00 Statistic Test p-value:2.89E-09; Z-score:-1.98E+00

Methylation in Case

1.18E-01 (Median) Methylation in Control 2.38E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg16099210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.03E+00 Statistic Test p-value:5.62E-08; Z-score:3.21E+00

Methylation in Case

1.33E-01 (Median) Methylation in Control 6.52E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:1.28E-06; Z-score:2.54E+00

Methylation in Case

1.89E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg15225091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:4.41E-05; Z-score:1.65E+00

Methylation in Case

3.28E-01 (Median) Methylation in Control 2.55E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg01043119)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:2.29E-04; Z-score:9.10E-01

Methylation in Case

1.18E-01 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:5.37E-03; Z-score:4.12E-01

Methylation in Case

8.86E-02 (Median) Methylation in Control 8.30E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

3'UTR (cg10838500)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:2.32E-19; Z-score:-4.12E+00

Methylation in Case

3.27E-01 (Median) Methylation in Control 5.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC18A2 in hepatocellular carcinoma [ 7 ]

Location

3'UTR (cg14995160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.08E-03; Z-score:-4.92E-01

Methylation in Case

7.59E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.46E+00 Statistic Test p-value:7.70E-05; Z-score:1.62E+00

Methylation in Case

1.32E-01 (Median) Methylation in Control 9.07E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.67E+00 Statistic Test p-value:9.85E-05; Z-score:1.21E+00

Methylation in Case

1.12E-01 (Median) Methylation in Control 6.73E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.90E+00 Statistic Test p-value:4.13E-03; Z-score:1.70E+00

Methylation in Case

1.99E-02 (Median) Methylation in Control 1.04E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.54E-06; Z-score:1.80E+00

Methylation in Case

7.77E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

TSS1500 (cg00498305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.48E-02; Z-score:1.22E+00

Methylation in Case

5.08E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.67E+00 Statistic Test p-value:1.64E-03; Z-score:2.07E+00

Methylation in Case

1.32E-01 (Median) Methylation in Control 7.90E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:2.00E-04; Z-score:1.21E+00

Methylation in Case

9.86E-02 (Median) Methylation in Control 7.64E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

Body (cg15225091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:6.82E-04; Z-score:1.35E+00

Methylation in Case

2.41E-01 (Median) Methylation in Control 1.75E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:7.16E-04; Z-score:8.22E-01

Methylation in Case

8.41E-02 (Median) Methylation in Control 7.26E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

Body (cg16099210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:1.04E-03; Z-score:1.01E+00

Methylation in Case

4.38E-02 (Median) Methylation in Control 2.66E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

Body (cg01043119)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:4.69E-03; Z-score:4.13E-01

Methylation in Case

7.90E-02 (Median) Methylation in Control 6.99E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

Body (cg15520443)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.58E+00 Statistic Test p-value:1.25E-02; Z-score:1.01E+00

Methylation in Case

6.92E-02 (Median) Methylation in Control 4.37E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC18A2 in HIV infection [ 8 ]

Location

3'UTR (cg14995160)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.40E-02; Z-score:4.17E-01

Methylation in Case

7.41E-01 (Median) Methylation in Control 7.17E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg08521987)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.46E+00 Statistic Test p-value:6.15E-03; Z-score:7.97E+00

Methylation in Case

3.34E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg00512279)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.79E+00 Statistic Test p-value:7.85E-03; Z-score:4.34E+00

Methylation in Case

2.88E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.54E+00 Statistic Test p-value:1.84E-02; Z-score:9.58E+00

Methylation in Case

1.00E-01 (Median) Methylation in Control 3.93E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:1.31E-04; Z-score:3.92E+00

Methylation in Case

6.41E-01 (Median) Methylation in Control 5.13E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg00498305)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:8.41E-04; Z-score:4.29E+00

Methylation in Case

4.43E-01 (Median) Methylation in Control 3.17E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg13980799)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:2.79E-03; Z-score:2.88E+00

Methylation in Case

6.15E-01 (Median) Methylation in Control 4.38E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

TSS200 (cg15173134)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.60E+00 Statistic Test p-value:2.60E-03; Z-score:8.38E+00

Methylation in Case

4.13E-01 (Median) Methylation in Control 1.59E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

Body (cg15225091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:4.74E-03; Z-score:2.58E+00

Methylation in Case

3.69E-01 (Median) Methylation in Control 2.68E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

Body (cg16099210)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.41E+00 Statistic Test p-value:1.78E-02; Z-score:4.66E+00

Methylation in Case

1.37E-01 (Median) Methylation in Control 5.71E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC18A2 in lung adenocarcinoma [ 9 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:3.83E-02; Z-score:2.40E+00

Methylation in Case

1.64E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

5'UTR (cg18003231)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:6.19E-07; Z-score:-1.52E+00

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg02915746)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:2.70E-12; Z-score:1.29E+00

Methylation in Case

7.61E-02 (Median) Methylation in Control 6.06E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS1500 (cg05907949)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.05E-02; Z-score:-3.74E-02

Methylation in Case

1.17E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg00292986)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:1.07E-02; Z-score:-2.25E-01

Methylation in Case

8.42E-02 (Median) Methylation in Control 9.43E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

1stExon (cg11915641)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.49E-05; Z-score:-8.69E-01

Methylation in Case

1.15E-01 (Median) Methylation in Control 1.54E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

1stExon (cg06662991)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:3.31E-04; Z-score:-8.48E-01

Methylation in Case

9.98E-02 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg24529484)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:4.45E-02; Z-score:-1.33E+00

Methylation in Case

1.76E-01 (Median) Methylation in Control 2.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

3'UTR (cg00321824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.83E-06; Z-score:1.68E+00

Methylation in Case

8.09E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in papillary thyroid cancer [ 11 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.29E-02; Z-score:6.35E-01

Methylation in Case

4.87E-02 (Median) Methylation in Control 4.40E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in papillary thyroid cancer [ 11 ]

Location

TSS1500 (cg15806304)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.75E-03; Z-score:9.61E-01

Methylation in Case

4.70E-01 (Median) Methylation in Control 4.11E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in papillary thyroid cancer [ 11 ]

Location

Body (cg20102878)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.81E-04; Z-score:-7.54E-01

Methylation in Case

8.87E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in papillary thyroid cancer [ 11 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.23E-02; Z-score:2.58E-01

Methylation in Case

9.67E-02 (Median) Methylation in Control 9.17E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in papillary thyroid cancer [ 11 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.75E-02; Z-score:2.83E-01

Methylation in Case

6.87E-02 (Median) Methylation in Control 6.57E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in systemic lupus erythematosus [ 13 ]

Location

5'UTR (cg19721867)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.96E-02; Z-score:-4.99E-02

Methylation in Case

1.36E-02 (Median) Methylation in Control 1.43E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in systemic lupus erythematosus [ 13 ]

Location

Body (cg19617377)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.16E-02; Z-score:-7.02E-02

Methylation in Case

9.25E-02 (Median) Methylation in Control 9.45E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colon cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

TSS1500 (cg13202751)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:9.23E-05; Z-score:1.39E+00

Methylation in Case

5.85E-01 (Median) Methylation in Control 5.05E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

TSS1500 (cg09177518)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:2.06E-04; Z-score:1.95E+00

Methylation in Case

3.67E-01 (Median) Methylation in Control 2.54E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

TSS1500 (cg26153885)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.69E-03; Z-score:-1.50E+00

Methylation in Case

7.73E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

TSS1500 (cg08072251)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.38E+00 Statistic Test p-value:2.12E-03; Z-score:1.85E+00

Methylation in Case

1.25E-01 (Median) Methylation in Control 9.05E-02 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

Body (cg23274660)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:5.67E-06; Z-score:-1.47E+00

Methylation in Case

1.79E-01 (Median) Methylation in Control 2.86E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

Body (cg08362628)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:1.19E-04; Z-score:-2.85E+00

Methylation in Case

7.15E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

Body (cg06070755)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.64E-03; Z-score:-2.19E+00

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

Body (cg10091752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:3.41E-03; Z-score:-9.05E-01

Methylation in Case

2.81E-01 (Median) Methylation in Control 3.33E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC18A2 in colon adenocarcinoma [ 14 ]

Location

3'UTR (cg03234405)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.60E-04; Z-score:-3.04E+00

Methylation in Case

7.47E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Depression

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in depression [ 15 ]

Location

Body (cg10245915)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:5.26E-03; Z-score:6.15E-01

Methylation in Case

6.86E-02 (Median) Methylation in Control 6.33E-02 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC18A2 in panic disorder [ 16 ]

Location

Body (cg15225091)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-9.28E-01 Statistic Test p-value:2.59E-02; Z-score:-3.94E-01

Methylation in Case

-3.22E+00 (Median) Methylation in Control -2.99E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-431 directly targets SLC18A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-431 miRNA Mature ID miR-431-5p

miRNA Sequence

UGUCUUGCAGGCCGUCAUGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-4639 directly targets SLC18A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4639 miRNA Mature ID miR-4639-5p

miRNA Sequence

UUGCUAAGUAGGCUGAGAUUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-6507 directly targets SLC18A2 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6507 miRNA Mature ID miR-6507-5p

miRNA Sequence

GAAGAAUAGGAGGGACUUUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 Large-scale evaluation of SLC18A2 in prostate cancer reveals diagnostic and prognostic biomarker potential at three molecular levels. Mol Oncol. 2016 Jun;10(6):825-37.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
16 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
17 Heterogeneous patterns of DNA methylation-based field effects in histologically normal prostate tissue from cancer patients. Sci Rep. 2017 Jan 13;7:40636.
18 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.