Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0034 Transporter Info
Gene Name	SLC18A2
Transporter Name	Vesicular amine transporter 2
Gene ID	6571
UniProt ID	Q05940

Epigenetic Regulations of This DT (EGR)
Methylation
Prostate cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Hypermethylation of SLC18A2 in prostate cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation ofSLC18A2	Experiment Method	Microarrays
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Additional Notes	SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer.
Epigenetic Phenomenon2	Hypermethylation of SLC18A2 in prostate cancer			[ 1 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Related Molecular Changes	Down regulation ofSLC18A2	Experiment Method	Western Blot
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Additional Notes	SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer.
Epigenetic Phenomenon3	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	5'UTR (cg01790523)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.91E+00	Statistic Test	p-value:2.79E-02; Z-score:-2.20E+00
Methylation in Case	3.48E-01 (Median)	Methylation in Control	6.65E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	5'UTR (cg05919690)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.16E-02; Z-score:-1.56E+00
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	TSS1500 (cg26062856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:4.93E-02; Z-score:5.88E+00
Methylation in Case	8.25E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	TSS200 (cg22928082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.05E+00	Statistic Test	p-value:4.52E-04; Z-score:7.67E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	3.58E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	TSS200 (cg18158438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.83E+00	Statistic Test	p-value:3.25E-02; Z-score:2.53E+00
Methylation in Case	5.97E-01 (Median)	Methylation in Control	3.26E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	Body (cg19807207)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:2.81E-02; Z-score:1.76E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	Body (cg15829073)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:4.36E-02; Z-score:1.60E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in prostate cancer			[ 12 ]
Location	3'UTR (cg13605398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.95E+00	Statistic Test	p-value:3.96E-02; Z-score:1.29E+01
Methylation in Case	4.97E-01 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Hypermethylation of SLC18A2 in prostate cancer			[ 17 ]
Location	Promoter (cg00498305)
Epigenetic Type	Methylation	Experiment Method	HumanMethylation450 BeadChip
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Additional Notes	A novel four-gene (AOX1xGSTP1xHAPLN3xSLC18A2) epigenetic field effect signature with over 30% sensitivity for PC at 100% fixed specificity.
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:5.20E-09; Z-score:-1.42E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.68E+00	Statistic Test	p-value:1.38E-07; Z-score:-1.64E+00
Methylation in Case	1.49E-01 (Median)	Methylation in Control	4.00E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:3.35E-06; Z-score:1.54E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	5.47E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:4.53E-05; Z-score:1.28E+00
Methylation in Case	9.09E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.43E-02; Z-score:3.55E-01
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in atypical teratoid rhabdoid tumor			[ 2 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.26E+00	Statistic Test	p-value:5.64E-11; Z-score:-2.04E+00
Methylation in Case	6.97E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:1.91E-03; Z-score:5.16E+00
Methylation in Case	1.75E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.74E+00	Statistic Test	p-value:2.91E-03; Z-score:3.00E+00
Methylation in Case	1.05E-01 (Median)	Methylation in Control	6.02E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:7.40E-03; Z-score:3.03E+00
Methylation in Case	1.53E-02 (Median)	Methylation in Control	1.07E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:1.98E-02; Z-score:2.75E+00
Methylation in Case	4.87E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.61E+00	Statistic Test	p-value:3.51E-03; Z-score:1.82E+00
Methylation in Case	1.20E-01 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-4.26E+00	Statistic Test	p-value:2.78E-08; Z-score:-7.77E+00
Methylation in Case	9.29E-02 (Median)	Methylation in Control	3.95E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:4.41E-04; Z-score:-4.92E+00
Methylation in Case	8.75E-02 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.30E+00	Statistic Test	p-value:5.98E-04; Z-score:-2.56E+00
Methylation in Case	6.31E-02 (Median)	Methylation in Control	8.21E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.45E-02; Z-score:-7.98E-01
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg26583753)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.20E-02; Z-score:-5.57E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC18A2 in bladder cancer			[ 3 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:3.23E-02; Z-score:-1.38E+00
Methylation in Case	7.73E-02 (Median)	Methylation in Control	9.27E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.44E+00	Statistic Test	p-value:5.34E-10; Z-score:2.14E+00
Methylation in Case	1.65E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.99E+00	Statistic Test	p-value:2.10E-09; Z-score:2.10E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	6.62E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:1.92E-04; Z-score:3.45E-01
Methylation in Case	1.88E-02 (Median)	Methylation in Control	1.34E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:1.71E-09; Z-score:1.82E+00
Methylation in Case	6.19E-01 (Median)	Methylation in Control	5.25E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:8.88E-09; Z-score:2.10E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	2.83E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.30E+00	Statistic Test	p-value:2.25E-08; Z-score:2.42E+00
Methylation in Case	5.29E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.52E+00	Statistic Test	p-value:5.87E-10; Z-score:2.35E+00
Methylation in Case	2.80E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.40E+00	Statistic Test	p-value:4.75E-08; Z-score:-1.64E+00
Methylation in Case	3.01E-01 (Median)	Methylation in Control	4.21E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.25E+00	Statistic Test	p-value:2.11E-06; Z-score:-2.00E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:9.03E-05; Z-score:-4.75E-01
Methylation in Case	8.19E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.38E+00	Statistic Test	p-value:6.22E-04; Z-score:-8.55E-01
Methylation in Case	7.77E-02 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:2.73E-02; Z-score:2.37E-01
Methylation in Case	4.05E-02 (Median)	Methylation in Control	3.58E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC18A2 in breast cancer			[ 4 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.72E-03; Z-score:-5.93E-01
Methylation in Case	7.75E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.32E+00	Statistic Test	p-value:3.93E-04; Z-score:8.39E-01
Methylation in Case	3.33E-02 (Median)	Methylation in Control	2.53E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:5.22E-04; Z-score:5.51E-01
Methylation in Case	1.23E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:1.08E-02; Z-score:5.31E-01
Methylation in Case	1.78E-02 (Median)	Methylation in Control	1.64E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:7.46E-06; Z-score:2.35E+00
Methylation in Case	6.54E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.45E+00	Statistic Test	p-value:1.12E-03; Z-score:2.21E+00
Methylation in Case	5.58E-01 (Median)	Methylation in Control	3.85E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:2.83E-03; Z-score:1.10E+00
Methylation in Case	2.99E-01 (Median)	Methylation in Control	2.43E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.15E+00	Statistic Test	p-value:2.30E-02; Z-score:1.95E-01
Methylation in Case	5.20E-02 (Median)	Methylation in Control	4.53E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.12E-02; Z-score:-7.55E-01
Methylation in Case	8.80E-02 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:1.42E-02; Z-score:-1.10E-02
Methylation in Case	3.64E-02 (Median)	Methylation in Control	3.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.99E-02; Z-score:-1.08E-01
Methylation in Case	2.75E-02 (Median)	Methylation in Control	2.85E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:3.43E+00	Statistic Test	p-value:4.59E-15; Z-score:9.06E+00
Methylation in Case	6.31E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+01	Statistic Test	p-value:2.72E-13; Z-score:2.84E+01
Methylation in Case	2.98E-01 (Median)	Methylation in Control	2.12E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.15E+00	Statistic Test	p-value:6.62E-13; Z-score:5.65E+00
Methylation in Case	5.79E-01 (Median)	Methylation in Control	2.70E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.23E+00	Statistic Test	p-value:8.59E-07; Z-score:1.88E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	5.83E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:8.62E-07; Z-score:1.74E+00
Methylation in Case	4.96E-01 (Median)	Methylation in Control	3.88E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:6.90E+00	Statistic Test	p-value:1.02E-15; Z-score:9.97E+00
Methylation in Case	5.63E-01 (Median)	Methylation in Control	8.17E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.70E+00	Statistic Test	p-value:7.94E-13; Z-score:7.87E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:6.42E+00	Statistic Test	p-value:4.07E-12; Z-score:1.60E+01
Methylation in Case	2.64E-01 (Median)	Methylation in Control	4.11E-02 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.29E+00	Statistic Test	p-value:9.49E-12; Z-score:-2.75E+00
Methylation in Case	2.26E-01 (Median)	Methylation in Control	5.17E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.26E+00	Statistic Test	p-value:2.48E-11; Z-score:8.40E+00
Methylation in Case	2.89E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.99E+00	Statistic Test	p-value:5.50E-11; Z-score:5.51E+00
Methylation in Case	3.93E-01 (Median)	Methylation in Control	1.97E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:3.62E-06; Z-score:2.52E+00
Methylation in Case	6.74E-01 (Median)	Methylation in Control	5.13E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.90E-03; Z-score:-9.63E-01
Methylation in Case	9.29E-01 (Median)	Methylation in Control	9.39E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC18A2 in colorectal cancer			[ 6 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.61E-03; Z-score:-8.11E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.60E+00	Statistic Test	p-value:1.05E-07; Z-score:2.92E+00
Methylation in Case	2.73E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.48E+00	Statistic Test	p-value:1.59E-06; Z-score:2.04E+00
Methylation in Case	1.54E-01 (Median)	Methylation in Control	1.04E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.18E+00	Statistic Test	p-value:2.64E-13; Z-score:-2.16E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	7.13E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS1500 (cg19024632)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.46E+00	Statistic Test	p-value:1.43E-10; Z-score:2.03E+00
Methylation in Case	3.97E-01 (Median)	Methylation in Control	2.71E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.09E-03; Z-score:1.74E-01
Methylation in Case	7.69E-02 (Median)	Methylation in Control	6.93E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg08701543)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.62E+00	Statistic Test	p-value:9.74E-20; Z-score:-4.09E+00
Methylation in Case	3.96E-01 (Median)	Methylation in Control	6.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg19000612)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.49E+00	Statistic Test	p-value:9.29E-18; Z-score:-5.51E+00
Methylation in Case	5.71E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg17493839)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.54E+00	Statistic Test	p-value:4.62E-17; Z-score:-2.18E+01
Methylation in Case	6.28E-01 (Median)	Methylation in Control	9.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg20122943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:4.61E+00	Statistic Test	p-value:5.61E-16; Z-score:1.19E+01
Methylation in Case	3.54E-01 (Median)	Methylation in Control	7.67E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg23880589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.59E+00	Statistic Test	p-value:2.33E-13; Z-score:3.53E+00
Methylation in Case	4.80E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.01E+00	Statistic Test	p-value:2.89E-09; Z-score:-1.98E+00
Methylation in Case	1.18E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.03E+00	Statistic Test	p-value:5.62E-08; Z-score:3.21E+00
Methylation in Case	1.33E-01 (Median)	Methylation in Control	6.52E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.41E+00	Statistic Test	p-value:1.28E-06; Z-score:2.54E+00
Methylation in Case	1.89E-01 (Median)	Methylation in Control	1.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:4.41E-05; Z-score:1.65E+00
Methylation in Case	3.28E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.18E+00	Statistic Test	p-value:2.29E-04; Z-score:9.10E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:5.37E-03; Z-score:4.12E-01
Methylation in Case	8.86E-02 (Median)	Methylation in Control	8.30E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg10838500)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.65E+00	Statistic Test	p-value:2.32E-19; Z-score:-4.12E+00
Methylation in Case	3.27E-01 (Median)	Methylation in Control	5.39E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon18	Methylation of SLC18A2 in hepatocellular carcinoma			[ 7 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.08E-03; Z-score:-4.92E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.46E+00	Statistic Test	p-value:7.70E-05; Z-score:1.62E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	9.07E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.67E+00	Statistic Test	p-value:9.85E-05; Z-score:1.21E+00
Methylation in Case	1.12E-01 (Median)	Methylation in Control	6.73E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.90E+00	Statistic Test	p-value:4.13E-03; Z-score:1.70E+00
Methylation in Case	1.99E-02 (Median)	Methylation in Control	1.04E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.54E-06; Z-score:1.80E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	7.11E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.48E-02; Z-score:1.22E+00
Methylation in Case	5.08E-01 (Median)	Methylation in Control	4.50E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.67E+00	Statistic Test	p-value:1.64E-03; Z-score:2.07E+00
Methylation in Case	1.32E-01 (Median)	Methylation in Control	7.90E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:2.00E-04; Z-score:1.21E+00
Methylation in Case	9.86E-02 (Median)	Methylation in Control	7.64E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:6.82E-04; Z-score:1.35E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:7.16E-04; Z-score:8.22E-01
Methylation in Case	8.41E-02 (Median)	Methylation in Control	7.26E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.65E+00	Statistic Test	p-value:1.04E-03; Z-score:1.01E+00
Methylation in Case	4.38E-02 (Median)	Methylation in Control	2.66E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg01043119)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:4.69E-03; Z-score:4.13E-01
Methylation in Case	7.90E-02 (Median)	Methylation in Control	6.99E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	Body (cg15520443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:1.25E-02; Z-score:1.01E+00
Methylation in Case	6.92E-02 (Median)	Methylation in Control	4.37E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC18A2 in HIV infection			[ 8 ]
Location	3'UTR (cg14995160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:1.40E-02; Z-score:4.17E-01
Methylation in Case	7.41E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg08521987)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.46E+00	Statistic Test	p-value:6.15E-03; Z-score:7.97E+00
Methylation in Case	3.34E-01 (Median)	Methylation in Control	1.36E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg00512279)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.79E+00	Statistic Test	p-value:7.85E-03; Z-score:4.34E+00
Methylation in Case	2.88E-01 (Median)	Methylation in Control	1.61E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.54E+00	Statistic Test	p-value:1.84E-02; Z-score:9.58E+00
Methylation in Case	1.00E-01 (Median)	Methylation in Control	3.93E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:1.31E-04; Z-score:3.92E+00
Methylation in Case	6.41E-01 (Median)	Methylation in Control	5.13E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg00498305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:8.41E-04; Z-score:4.29E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS1500 (cg13980799)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.40E+00	Statistic Test	p-value:2.79E-03; Z-score:2.88E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	TSS200 (cg15173134)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.60E+00	Statistic Test	p-value:2.60E-03; Z-score:8.38E+00
Methylation in Case	4.13E-01 (Median)	Methylation in Control	1.59E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:4.74E-03; Z-score:2.58E+00
Methylation in Case	3.69E-01 (Median)	Methylation in Control	2.68E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	Body (cg16099210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.41E+00	Statistic Test	p-value:1.78E-02; Z-score:4.66E+00
Methylation in Case	1.37E-01 (Median)	Methylation in Control	5.71E-02 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC18A2 in lung adenocarcinoma			[ 9 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:3.83E-02; Z-score:2.40E+00
Methylation in Case	1.64E-01 (Median)	Methylation in Control	1.28E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	5'UTR (cg18003231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:6.19E-07; Z-score:-1.52E+00
Methylation in Case	8.05E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	TSS1500 (cg02915746)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.26E+00	Statistic Test	p-value:2.70E-12; Z-score:1.29E+00
Methylation in Case	7.61E-02 (Median)	Methylation in Control	6.06E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	TSS1500 (cg05907949)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.05E-02; Z-score:-3.74E-02
Methylation in Case	1.17E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	TSS200 (cg00292986)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.07E-02; Z-score:-2.25E-01
Methylation in Case	8.42E-02 (Median)	Methylation in Control	9.43E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	1stExon (cg11915641)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.35E+00	Statistic Test	p-value:2.49E-05; Z-score:-8.69E-01
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:3.31E-04; Z-score:-8.48E-01
Methylation in Case	9.98E-02 (Median)	Methylation in Control	1.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	Body (cg24529484)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.43E+00	Statistic Test	p-value:4.45E-02; Z-score:-1.33E+00
Methylation in Case	1.76E-01 (Median)	Methylation in Control	2.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in pancretic ductal adenocarcinoma			[ 10 ]
Location	3'UTR (cg00321824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:2.83E-06; Z-score:1.68E+00
Methylation in Case	8.09E-01 (Median)	Methylation in Control	7.40E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:1.29E-02; Z-score:6.35E-01
Methylation in Case	4.87E-02 (Median)	Methylation in Control	4.40E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg15806304)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:2.75E-03; Z-score:9.61E-01
Methylation in Case	4.70E-01 (Median)	Methylation in Control	4.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	Body (cg20102878)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:5.81E-04; Z-score:-7.54E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.23E-02; Z-score:2.58E-01
Methylation in Case	9.67E-02 (Median)	Methylation in Control	9.17E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in papillary thyroid cancer			[ 11 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.75E-02; Z-score:2.83E-01
Methylation in Case	6.87E-02 (Median)	Methylation in Control	6.57E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in systemic lupus erythematosus			[ 13 ]
Location	5'UTR (cg19721867)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.96E-02; Z-score:-4.99E-02
Methylation in Case	1.36E-02 (Median)	Methylation in Control	1.43E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg19617377)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:4.16E-02; Z-score:-7.02E-02
Methylation in Case	9.25E-02 (Median)	Methylation in Control	9.45E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Colon cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg13202751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:9.23E-05; Z-score:1.39E+00
Methylation in Case	5.85E-01 (Median)	Methylation in Control	5.05E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg09177518)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.44E+00	Statistic Test	p-value:2.06E-04; Z-score:1.95E+00
Methylation in Case	3.67E-01 (Median)	Methylation in Control	2.54E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg26153885)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.69E-03; Z-score:-1.50E+00
Methylation in Case	7.73E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	TSS1500 (cg08072251)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.38E+00	Statistic Test	p-value:2.12E-03; Z-score:1.85E+00
Methylation in Case	1.25E-01 (Median)	Methylation in Control	9.05E-02 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg23274660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.60E+00	Statistic Test	p-value:5.67E-06; Z-score:-1.47E+00
Methylation in Case	1.79E-01 (Median)	Methylation in Control	2.86E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg08362628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.19E-04; Z-score:-2.85E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg06070755)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.64E-03; Z-score:-2.19E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.19E+00	Statistic Test	p-value:3.41E-03; Z-score:-9.05E-01
Methylation in Case	2.81E-01 (Median)	Methylation in Control	3.33E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC18A2 in colon adenocarcinoma			[ 14 ]
Location	3'UTR (cg03234405)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.60E-04; Z-score:-3.04E+00
Methylation in Case	7.47E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in depression			[ 15 ]
Location	Body (cg10245915)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.26E-03; Z-score:6.15E-01
Methylation in Case	6.86E-02 (Median)	Methylation in Control	6.33E-02 (Median)
Studied Phenotype	Depression[ ICD-11:6A8Z]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC18A2 in panic disorder			[ 16 ]
Location	Body (cg15225091)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-9.28E-01	Statistic Test	p-value:2.59E-02; Z-score:-3.94E-01
Methylation in Case	-3.22E+00 (Median)	Methylation in Control	-2.99E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-431 directly targets SLC18A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-431	miRNA Mature ID	miR-431-5p
miRNA Sequence	UGUCUUGCAGGCCGUCAUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	miR-4639 directly targets SLC18A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4639	miRNA Mature ID	miR-4639-5p
miRNA Sequence	UUGCUAAGUAGGCUGAGAUUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon3	miR-6507 directly targets SLC18A2			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6507	miRNA Mature ID	miR-6507-5p
miRNA Sequence	GAAGAAUAGGAGGGACUUUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Large-scale evaluation of SLC18A2 in prostate cancer reveals diagnostic and prognostic biomarker potential at three molecular levels. Mol Oncol. 2016 Jun;10(6):825-37.
2	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
16	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
17	Heterogeneous patterns of DNA methylation-based field effects in histologically normal prostate tissue from cancer patients. Sci Rep. 2017 Jan 13;7:40636.
18	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence