General Information of Drug Transporter (DT)
DT ID	DTD0455 Transporter Info
Gene Name	SLC6A3
Protein Name	Sodium-dependent dopamine transporter
Gene ID	6531
UniProt ID	Q01959
Genetic Polymorphisms of DT (GPD)
Genetic Polymorphism	rs2975226
Site of GPD	chr5:1445501 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>T
Minor Allele Frequency	T=0.3710/1858 (Global)
Allele A	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Clozapine	Drug Info	Schizophrenia	Correlated with the increased drug response in patients (compare with Allele T)		[ 1]
Clozapine	N.A.	Alcohol Abuse	Allele A is associated with increased response to clozapine in people with Schizophrenia as compared to allele T.		[ 1]
Clozapine	N.A.	Schizophrenia	Allele A is associated with increased response to clozapine in people with Schizophrenia as compared to allele T.		[ 1]
Genotype AA	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Antiemetics And Antinauseants	N.A.	Nausea	Genotype AA is associated with increased likelihood of Nausea and Vomiting when treated with Antiemetics And Antinauseants in children with Neoplasms as compared to genotypes AT + TT.		[ 2]
Antiemetics And Antinauseants	N.A.	Vomiting	Genotype AA is associated with increased likelihood of Nausea and Vomiting when treated with Antiemetics And Antinauseants in children with Neoplasms as compared to genotypes AT + TT.		[ 2]
Clozapine	N.A.	Schizophrenia	Patients with the AA genotype and schizophrenia may have an increased response to treatment with clozapine as compared to patients with the TT genotype. Other genetic and clinical factors may also influence response to clozapine.		[ 1]
Genotypes AA + AT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes AA + AT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype TT.		[ 3]
Genotype AT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Clozapine	N.A.	Schizophrenia	Patients with the AT genotype and schizophrenia may have an increased response to treatment with clozapine as compared to patients with the TT genotype, or a decreased response as compared to patients with the AA genotype. Other genetic and clinical factors may also influence response to clozapine.		[ 1]
Genotype TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Clozapine	N.A.	Schizophrenia	Patients with the TT genotype and schizophrenia may have a decreased response to treatment with clozapine as compared to patients with the AA genotype. Other genetic and clinical factors may also influence response to clozapine.		[ 1]
Genetic Polymorphism	rs3836790
Site of GPD	chr5:1411740-1411741 (GRCh38.p12)
GPD Type	InsertionI
Allele(s) in dbSNP	insACAT(AC)3TCAG(AC)3ATACCATGCA
Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Levodopa	Drug Info	Parkinson Disease	Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del)		[ 4]
Methylphenidate	Drug Info	Parkinson Disease	Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del)		[ 4]
Cocaine	N.A.	Death	Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA is associated with increased risk of Death when exposed to cocaine in people with Cocaine-Related Disorders as compared to genotypes CACATACCATGCAACATACACACTCAGACA/del + del/del.		[ 5]
Genotype ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Levodopa	N.A.	Attention Deficit Disorder With Hyperactivity	Genotype ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA is associated with increased response to levodopa and methylphenidate in people with Parkinson Disease as compared to genotypes ACATACACACTCAGACACACATACCATGCA/del + del/del.		[ 4]
Methylphenidate	N.A.	Attention Deficit Disorder With Hyperactivity	Genotype ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA is associated with increased response to levodopa and methylphenidate in people with Parkinson Disease as compared to genotypes ACATACACACTCAGACACACATACCATGCA/del + del/del.		[ 4]
Levodopa	N.A.	Parkinson Disease	Genotype ACATACACACTCAGACACACATACCATGCA/ACATACACACTCAGACACACATACCATGCA is associated with increased response to levodopa in people with Parkinson Disease as compared to genotypes ACATACACACTCAGACACACATACCATGCA/del + del/del.		[ 4]
Genotype ACATACACACTCAGACACACATACCATGCA/del	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Levodopa	N.A.	Parkinson Disease	Patients with the CACATACCATGCAACATACACACTCAGACA/del genotype and Parkinson Disease who are treated with levodopa may have decreased response to levodopa as compared to patients with the CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA genotype. Other genetic and clinical factors may also influence a patient's response to levodopa.		[ 4]
Genotype del/del	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Levodopa	N.A.	Parkinson Disease	Patients with the del/del genotype and Parkinson Disease who are treated with levodopa may have decreased response to levodopa as compared to patients with the CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA genotype. Other genetic and clinical factors may also influence a patient's response to levodopa.		[ 4]
Genetic Polymorphism	rs6350
Site of GPD	chr5:1443084 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	G>A / G>C
Minor Allele Frequency	A=0.0455/228 (Global)
Genotype AG	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Ethanol	Drug Info	Intractable Chronic Pain; Cystitis	Correlated with the increased alcoholism risk in patients (compare with genotype GG)		[ 3]
Ethanol	N.A.	Alcohol Abuse	Genotype AG is associated with increased risk of Alcoholism when exposed to ethanol as compared to genotype GG.		[ 3]
Ethanol	N.A.	Alcohol Abuse	Genotype AG is associated with increased risk of Alcoholism when exposed to ethanol as compared to genotype GG.		[ 3]
Genotype AA	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	There is currently no available evidence regarding the effect of the AA genotype on the risk of alcoholism in patients.		[ 3]
Genotype GG	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Patients with the GG genotype may have a decreased risk of alcoholism compared to patients with the AG genotype. Other genetic and clinical factors may also influence risk for alcoholism in patients.		[ 3]
Genetic Polymorphism	rs28363170
Site of GPD	chr5:1393785 (GRCh38.p12)
GPD Type	Deletion
Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT	Click to Show/Hide the Full List of Affected Drugs:           4 Drugs in Total
Disulfiram	N.A.	Attention Deficit Disorder With Hyperactivity	Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is associated with increased response to disulfiram in people with Cocaine-Related Disorders as compared to genotypes GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del + del/del.		[ 6]
Ethanol	N.A.	Alcohol Abuse	Patients with the rs28363170 GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT genotype may be at a decreased risk of developing alcoholism as compared to patients with the GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del or del/del genotypes. Other genetic and clinical factors may also affect risk of developing alcoholism.		[ 7]
Ethanol	N.A.	Alcohol Abuse	Patients carrying two copies of the 10-repeat allele may report less severe negative effects of alcohol as compared to patients carrying one or two copies of the 9-repeat allele. However, this association was only observed using certain scoring systems. Other genetic or clinical factors may also affect a patient's response to alcohol.		[ 8]
Disulfiram	N.A.	Cocaine Dependence	Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is associated with increased response to disulfiram in people with Cocaine-Related Disorders as compared to genotypes GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del + del/del.		[ 6]
Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Venlafaxine	N.A.	Attention Deficit Disorder With Hyperactivity	Allele GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is not associated with response to venlafaxine in people with Anxiety Disorders as compared to allele del.		[ 9]
Genotype del	Click to Show/Hide the Full List of Affected Drugs:           2 Drugs in Total
Ethanol	N.A.	Attention Deficit Disorder With Hyperactivity	Allele del is associated with increased response to ethanol in healthy individuals as compared to allele GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT.		[ 8]
Ethanol	N.A.	Alcohol Abuse	Allele del is associated with increased risk of Alcoholism due to ethanol as compared to allele GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT.		[ 7]
Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Patients with the rs28363170 GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del genotype may be at an increased risk of developing alcoholism as compared to patients with the GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT genotype. Other genetic and clinical factors may also affect risk of developing alcoholism.		[ 7]
Ethanol	N.A.	Alcohol Abuse	Patients carrying one copy of the 10-repeat allele and one copy of the 9-repeat allele may report more severe negative effects of alcohol as compared to patients carrying two copies of the 10-repeat allele. However, this association was only observed using certain scoring systems. Other genetic or clinical factors may also affect a patient's response to alcohol.		[ 8]
Disulfiram	N.A.	Cocaine Dependence	Patients with the 9,10-repeat genotype (GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del) may have a decreased response to disulfiram treatment for cocaine dependence. as compared to patients with the 10,10-repeat genotype. Other genetic and clinical factors may also affect a patient's response to disulfiram.		[ 6]
Genotype del/del	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Patients with the rs28363170 del/del genotype may be at an increased risk of developing alcoholism as compared to patients with the GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT genotype. Other genetic and clinical factors may also affect risk of developing alcoholism.		[ 7]
Ethanol	N.A.	Alcohol Abuse	Patients carrying two copies of the 9-repeat allele may report more severe negative effects of alcohol as compared to patients carrying two copies of the 10-repeat allele. However, this association was only observed using certain scoring systems. Other genetic or clinical factors may also affect a patient's response to alcohol.		[ 8]
Disulfiram	N.A.	Cocaine Dependence	Patients with the 9,9-repeat genotype (del/del) may have a decreased response to disulfiram treatment for cocaine dependence. as compared to patients with the 10,10-repeat genotype. Other genetic and clinical factors may also affect a patient's response to disulfiram.		[ 6]
Genetic Polymorphism	rs6347
Site of GPD	chr5:1411297 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	T>C
Minor Allele Frequency	T=0.6950/1375 (Global)
Genotype TT	Click to Show/Hide the Full List of Affected Drugs:           2 Drugs in Total
Bupropion	N.A.	Attention Deficit Disorder With Hyperactivity	Genotype TT is not associated with decreased response to bupropion in people with Depressive Disorder, Major as compared to genotypes CC + CT.		[ 10]
Cocaine	N.A.	Death	Genotype TT is associated with increased risk of Death when exposed to cocaine in people with Cocaine-Related Disorders as compared to genotypes CC + CT.		[ 5]
Allele C	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Methadone	N.A.	Vomiting	Allele C is not associated with dose of methadone in people with Heroin Dependence as compared to allele T.		[ 11]
Heroin	N.A.	Alcohol Abuse	Allele C is not associated with dose of heroin in people with Heroin Dependence as compared to allele T.		[ 11]
Heroin	N.A.	Memory Impairment	Allele C is not associated with risk of Memory Disorders due to heroin in people with Heroin Dependence as compared to allele T.		[ 11]
Genotypes CC + CT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes CC + CT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs27072
Site of GPD	chr5:1394407 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	C>A / C>T
Minor Allele Frequency	C=0.7950/1573 (Global)
Genotypes CT + TT	Click to Show/Hide the Full List of Affected Drugs:           2 Drugs in Total
Nicotine	N.A.	Alcohol Abuse	Genotypes CT + TT are not associated with increased likelihood of overcoming nicotine dependence when exposed to nicotine as compared to genotype CC.		[ 12]
Ethanol	N.A.	Alcohol Abuse	Genotypes CT + TT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Allele T	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Heroin	N.A.	Alcohol Abuse	Allele T is not associated with response to heroin as compared to allele C.		[ 11]
Methadone	N.A.	Alcohol Abuse	Allele T is not associated with dose of methadone in people with Heroin Dependence as compared to allele C.		[ 11]
Heroin	N.A.	Memory Impairment	Allele T is not associated with risk of Memory Disorders due to heroin in people with Heroin Dependence as compared to allele C.		[ 11]
Genetic Polymorphism	rs460000
Site of GPD	chr5:1432710 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	G>A / G>C / G>T
Minor Allele Frequency	G=0.5860/1159 (Global)
Genotype GG	Click to Show/Hide the Full List of Affected Drugs:           2 Drugs in Total
Amphetamine	N.A.	Alcohol Abuse	Genotype GG is associated with increased response to amphetamine in healthy individuals as compared to genotypes GT + TT.		[ 13]
Ethanol	N.A.	Alcohol Abuse	Genotype GG is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype TT.		[ 3]
Genotype GT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype GT is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype TT.		[ 3]
Genetic Polymorphism	rs2550948
Site of GPD	chr5:1450329 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	C>T
Minor Allele Frequency	C=0.6650/1316 (Global)
Genotypes CC + CT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Methylphenidate	N.A.	Vomiting	Genotypes CC + CT are associated with increased response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to genotype TT.		[ 14]
Allele C	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Venlafaxine	N.A.	Vomiting	Allele C is not associated with response to venlafaxine in people with Anxiety Disorders as compared to allele T.		[ 9]
Genotypes CT + TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes CT + TT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs1042098
Site of GPD	chr5:1394700 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>G
Minor Allele Frequency	A=0.6960/1377 (Global)
Allele G	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Methadone	N.A.	Vomiting	Allele G is not associated with dose of methadone in people with Heroin Dependence as compared to allele A.		[ 11]
Heroin	N.A.	Alcohol Abuse	Allele G is not associated with dose of heroin in people with Heroin Dependence as compared to allele A.		[ 11]
Heroin	N.A.	Memory Impairment	Allele G is not associated with risk of Memory Disorders due to heroin in people with Heroin Dependence as compared to allele A.		[ 11]
Genetic Polymorphism	rs2652511
Site of GPD	chr5:1446274 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>G
Minor Allele Frequency	A=0.6170/1221 (Global)
Allele G	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Methylphenidate	N.A.	Vomiting	Allele G is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele A.		[ 14]
Genotypes AG + GG	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes AG + GG are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype AA.		[ 3]
Genetic Polymorphism	rs37022
Site of GPD	chr5:1415514 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>T
Minor Allele Frequency	A=0.6490/1284 (Global)
Genotype TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype TT is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype AA.		[ 3]
Genotype AT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AT is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype AA.		[ 3]
Genetic Polymorphism	rs27048
Site of GPD	chr5:1412530 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	C>A / C>G / C>T
Minor Allele Frequency	C=0.6760/1337 (Global)
Genotypes CT + TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes CT + TT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs464049
Site of GPD	chr5:1423790 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>G / A>T
Minor Allele Frequency	A=0.3952/1979 (Global)
Genotype AA	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AA is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype GG.		[ 3]
Genotype AG	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AG is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype GG.		[ 3]
Genetic Polymorphism	rs37020
Site of GPD	chr5:1418259 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>C / A>T
Minor Allele Frequency	A=0.3952/1979 (Global)
Genotype AC	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AC is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genotype AA	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AA is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs40184
Site of GPD	chr5:1394962 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	C>T
Minor Allele Frequency	C=0.5850/1157 (Global)
Genotypes CT + TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes CT + TT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs11133767
Site of GPD	chr5:1401465 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	C>T
Minor Allele Frequency	C=0.6720/1329 (Global)
Genotypes CT + TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotypes CT + TT are not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs403636
Site of GPD	chr5:1438239 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	A>C / A>T
Minor Allele Frequency	A=0.2410/476 (Global)
Genotype AA	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AA is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genotype AC	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype AC is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs2981359
Site of GPD	chr5:1442617 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	G>C
Minor Allele Frequency	G=0.4780/945 (Global)
Genotype CG	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype CG is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype GG.		[ 3]
Genotype CC	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype CC is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype GG.		[ 3]
Genetic Polymorphism	rs460700
Site of GPD	chr5:1429854 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	T>C
Minor Allele Frequency	T=0.6430/1272 (Global)
Genotype CT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype CT is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genotype TT	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Ethanol	N.A.	Alcohol Abuse	Genotype TT is not associated with risk of Alcoholism when exposed to ethanol as compared to genotype CC.		[ 3]
Genetic Polymorphism	rs10064525
Site of GPD	chr5:1392606 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	T>G
Minor Allele Frequency	T=0.9100/1800 (Global)
Allele G	Click to Show/Hide the Full List of Affected Drugs:           3 Drugs in Total
Methadone	N.A.	Alcohol Abuse	Allele G is not associated with dose of methadone in people with Heroin Dependence as compared to allele T.		[ 11]
Heroin	N.A.	Alcohol Abuse	Allele G is not associated with response to heroin as compared to allele T.		[ 11]
Heroin	N.A.	Memory Impairment	Allele G is not associated with risk of Memory Disorders due to heroin in people with Heroin Dependence as compared to allele T.		[ 11]
Genetic Polymorphism	rs2550956
Site of GPD	chr5:1447726 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	G>A
Minor Allele Frequency	G=0.8310/1644 (Global)
Allele G	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Methylphenidate	N.A.	Alcohol Abuse	Allele G is not associated with response to methylphenidate in children with Attention Deficit Disorder with Hyperactivity as compared to allele A.		[ 15]
Allele A	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Selective Serotonin Reuptake Inhibitors	N.A.	Death	Allele A is not associated with response to Selective serotonin reuptake inhibitors in people with Depressive Disorder, Major as compared to allele G.		[ 16]
Genetic Polymorphism	rs3863145
Site of GPD	chr5:1392596 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	G>A / G>C
Minor Allele Frequency	G=0.8320/1646 (Global)
Genotype GG	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Selective Serotonin Reuptake Inhibitors	N.A.	Death	Genotype GG is not associated with response to Selective serotonin reuptake inhibitors in people with Depressive Disorder, Major as compared to genotypes AA + AG.		[ 16]
Genetic Polymorphism	rs2292023
Site of GPD	chr5:1461274 (GRCh38.p12)
GPD Type	SNP
Allele(s) in dbSNP	C>A / C>T
Minor Allele Frequency	C=0.6680/1321 (Global)
Allele A	Click to Show/Hide the Full List of Affected Drugs:           1 Drugs in Total
Selective Serotonin Reuptake Inhibitors	N.A.	Death	Allele A is not associated with response to Selective serotonin reuptake inhibitors in people with Depressive Disorder, Major as compared to allele C.		[ 16]
References
1	Pharacogenetic effects of dopamine transporter gene polymorphisms on response to chlorpromazine and clozapine and on extrapyramidal syndrome in schizophrenia. Prog Neuropsychopharmacol Biol Psychiatry. 2010 Aug 16;34(6):1026-32.
2	Background sensitivity to chemotherapy-induced nausea and vomiting and response to antiemetics in paediatric patients: a genetic association study. Pharmacogenet Genomics. 2022 Feb 01;32(2):72-78.
3	The SLC6A3 gene possibly affects susceptibility to late-onset alcohol dependence but not specific personality traits in a Han Chinese population. PLoS One. 2017 Feb 9;12(2):e0171170.
4	Polymorphism of the dopamine transporter type 1 gene modifies the treatment response in Parkinson's disease. Brain. 2015 May;138(Pt 5):1271-83.
5	Dopamine transporter DAT and receptor DRD2 variants affect risk of lethal cocaine abuse: a gene-gene-environment interaction. Transl Psychiatry. 2013 Jan 22;3(1):e222.
6	Pharmacogenetic role of dopamine transporter (SLC6A3) variation on response to disulfiram treatment for cocaine addiction. Am J Addict. 2019 Jul;28(4):311-317.
7	Association between opioid and dopamine receptor gene polymorphisms OPRM1 rs1799971, DAT VNTR 9-10 repeat allele, DRD1 rs4532 and DRD2 rs1799732 and alcohol dependence: an ethnicity oriented meta-analysis. Pharmacogenet Genomics. 2023 Sep 01;33(7):139-152.
8	Independent and Interactive Effects of OPRM1 and DAT1 Polymorphisms on Alcohol Consumption and Subjective Responses in Social Drinkers. Alcohol Clin Exp Res. 2017 Jun;41(6):1093-1104.
9	Lack of influence of DAT1 and DRD2 gene variants on antidepressant response in generalized anxiety disorder. Hum Psychopharmacol. 2014 Jul;29(4):316-21.
10	Analysis of 34 candidate genes in bupropion and placebo remission. Int J Neuropsychopharmacol. 2013 May;16(4):771-81.
11	Association studies of dopamine synthesis and metabolism genes with multiple phenotypes of heroin dependence. BMC Med Genet. 2020 Jul 31;21(1):157.
12	Dopamine-related genes and spontaneous smoking cessation in ever-heavy smokers. Pharmacogenomics. 2011 Aug;12(8):1099-106.
13	Polymorphisms in dopamine transporter (SLC6A3) are associated with stimulant effects of D-amphetamine: an exploratory pharmacogenetic study using healthy volunteers. Behav Genet. 2010 Mar;40(2):255-61.
14	Pharmacogenetics of methylphenidate in childhood attention-deficit/hyperactivity disorder: long-term effects. Sci Rep. 2017 Sep 04;7(1):10391.
15	No support for association between the dopamine transporter (DAT1) gene and ADHD. Am J Med Genet B Neuropsychiatr Genet. 2005 Nov 05;139B(1):7-10.
16	TPH, SLC6A2, SLC6A3, DRD2 and DRD4 Polymorphisms and Neuroendocrine Factors Predict SSRIs Treatment Outcome in the Chinese Population with Major Depression. Pharmacopsychiatry. 2015 May;48(3):95-103.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.