General Information of Drug Transporter (DT)
DT ID DTD0533 Transporter Info
Gene Name ATP7B
Transporter Name Copper-transporting ATPase 2
Gene ID
540
UniProt ID
P35670
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-222 directly targets ATP7B [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-222 miRNA Mature ID miR-222-3p

miRNA Sequence

AGCUACAUCUGGCUACUGGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-26a directly targets ATP7B [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon3

miR-26b directly targets ATP7B [ 2 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon4

miR-27a directly targets ATP7B [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-27b directly targets ATP7B [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-615 directly targets ATP7B [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-616 directly targets ATP7B [ 1 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-98 directly targets ATP7B [ 2 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

Methylation

  Cerebellar liponeurocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ATP7B in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.022675158; Fold-change:0.226902458; Z-score:0.632403524
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Pituitary adenoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of ATP7B in pituitary adenoma than that in healthy individual

Studied Phenotype

Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:7.62E-08; Fold-change:0.254875655; Z-score:3.039399152
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Third ventricle chordoid glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of ATP7B in third ventricle chordoid glioma than that in healthy individual

Studied Phenotype

Third ventricle chordoid glioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.001220481; Fold-change:0.469404105; Z-score:1.470635876
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of ATP7B in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.72E-10; Fold-change:-0.367583502; Z-score:-2.512641964
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
References
1 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
2 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.