Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0515 Transporter Info | ||||
| Gene Name | ATP10A | ||||
| Transporter Name | Probable phospholipid-transporting ATPase VA | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
24 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg07626033) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:1.26E-03; Z-score:-2.27E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg13685964) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.53E-03; Z-score:-1.61E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg01530032) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:5.50E-06; Z-score:-2.00E+00 | ||
|
Methylation in Case |
5.44E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg01717150) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.07E+00 | Statistic Test | p-value:1.97E-04; Z-score:7.11E+00 | ||
|
Methylation in Case |
2.99E-01 (Median) | Methylation in Control | 9.74E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg02671204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.04E-03; Z-score:-7.59E-01 | ||
|
Methylation in Case |
5.22E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg12604192) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:2.52E-03; Z-score:-1.86E+00 | ||
|
Methylation in Case |
5.06E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg07061355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.03E-04; Z-score:-2.39E+00 | ||
|
Methylation in Case |
7.53E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.67E+00 | Statistic Test | p-value:3.92E-03; Z-score:-1.43E+00 | ||
|
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 3.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg03040581) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:3.03E-04; Z-score:-2.68E+00 | ||
|
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg06869796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:7.64E-04; Z-score:-2.27E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09565111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.12E-06; Z-score:-2.00E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02844593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:3.37E-06; Z-score:-3.60E+00 | ||
|
Methylation in Case |
4.07E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg17403817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:9.01E-06; Z-score:-2.92E+00 | ||
|
Methylation in Case |
6.21E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04583232) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.17E-04; Z-score:1.60E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00764668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.70E-04; Z-score:-2.55E+00 | ||
|
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15668533) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:4.35E-04; Z-score:1.45E+00 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 4.13E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg01359329) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:5.94E-04; Z-score:-1.11E+00 | ||
|
Methylation in Case |
5.30E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19866594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:7.39E-04; Z-score:-3.20E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09170397) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.34E-03; Z-score:-1.11E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg16648603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.57E-03; Z-score:-1.94E+00 | ||
|
Methylation in Case |
6.45E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11226148) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:1.96E-03; Z-score:2.79E+00 | ||
|
Methylation in Case |
1.89E-01 (Median) | Methylation in Control | 1.33E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24178621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.76E-03; Z-score:-2.58E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13716321) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.90E-03; Z-score:-9.38E-01 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg20733663) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.48E-05; Z-score:-2.71E+00 | ||
|
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
45 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg01393327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.67E+00 | Statistic Test | p-value:1.32E-14; Z-score:2.49E+00 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 4.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg24639117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.60E+00 | Statistic Test | p-value:3.29E-11; Z-score:-3.54E+00 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg10949773) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:1.90E-15; Z-score:-2.96E+00 | ||
|
Methylation in Case |
5.70E-01 (Median) | Methylation in Control | 7.46E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg22337136) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:1.08E-13; Z-score:-1.73E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09282497) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.07E+00 | Statistic Test | p-value:3.28E-12; Z-score:4.04E+00 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 5.63E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg07470694) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:1.79E-09; Z-score:-4.17E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg26879349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:1.94E-08; Z-score:-4.30E+00 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.94E+00 | Statistic Test | p-value:2.76E-08; Z-score:2.72E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 6.66E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.67E+00 | Statistic Test | p-value:1.12E-07; Z-score:3.49E+00 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 7.94E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:2.52E-07; Z-score:3.09E+00 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:5.26E-07; Z-score:-1.71E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:3.97E-06; Z-score:1.66E+00 | ||
|
Methylation in Case |
1.13E-01 (Median) | Methylation in Control | 8.08E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.94E-04; Z-score:4.31E-01 | ||
|
Methylation in Case |
6.21E-02 (Median) | Methylation in Control | 5.24E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:3.53E-04; Z-score:5.67E-01 | ||
|
Methylation in Case |
4.93E-02 (Median) | Methylation in Control | 4.34E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.68E-03; Z-score:1.58E-01 | ||
|
Methylation in Case |
7.95E-02 (Median) | Methylation in Control | 7.72E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.40E-02; Z-score:-9.80E-02 | ||
|
Methylation in Case |
8.48E-02 (Median) | Methylation in Control | 8.68E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg19980771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:1.87E-15; Z-score:1.91E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 4.77E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg16857852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.56E+00 | Statistic Test | p-value:3.83E-15; Z-score:-3.05E+00 | ||
|
Methylation in Case |
3.25E-01 (Median) | Methylation in Control | 5.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.72E+00 | Statistic Test | p-value:1.42E-08; Z-score:1.61E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 3.82E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:1.97E-07; Z-score:5.06E-01 | ||
|
Methylation in Case |
3.96E-02 (Median) | Methylation in Control | 2.83E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:3.74E-07; Z-score:3.11E-01 | ||
|
Methylation in Case |
3.93E-02 (Median) | Methylation in Control | 3.00E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:3.60E-06; Z-score:2.54E-01 | ||
|
Methylation in Case |
3.67E-02 (Median) | Methylation in Control | 2.89E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:5.12E-06; Z-score:2.69E-01 | ||
|
Methylation in Case |
4.81E-02 (Median) | Methylation in Control | 4.08E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg06835822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.46E+00 | Statistic Test | p-value:1.18E-16; Z-score:-8.25E+00 | ||
|
Methylation in Case |
6.09E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.02E-04; Z-score:6.36E-03 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg24178621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.96E+00 | Statistic Test | p-value:4.75E-24; Z-score:-7.09E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05099596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:4.74E-17; Z-score:-5.02E+00 | ||
|
Methylation in Case |
4.06E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04077417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.56E+00 | Statistic Test | p-value:4.35E-16; Z-score:-3.87E+00 | ||
|
Methylation in Case |
4.19E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14224786) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:5.81E-16; Z-score:-4.82E+00 | ||
|
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg20961940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:2.75E-15; Z-score:-3.21E+00 | ||
|
Methylation in Case |
3.67E-01 (Median) | Methylation in Control | 5.33E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:1.95E-14; Z-score:-3.34E+00 | ||
|
Methylation in Case |
4.38E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00378292) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:2.83E-14; Z-score:-2.43E+00 | ||
|
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 3.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04524933) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:6.12E-14; Z-score:-1.05E+01 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13363904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:4.30E-12; Z-score:-2.97E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15632787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:1.47E-11; Z-score:-4.57E+00 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg11204913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:2.11E-11; Z-score:-2.25E+00 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19156231) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:2.01E-10; Z-score:1.72E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01163597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:3.15E-10; Z-score:-1.26E+00 | ||
|
Methylation in Case |
9.82E-02 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21164967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:5.07E-10; Z-score:-2.98E+00 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03771731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:5.38E-10; Z-score:-3.13E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.78E-09; Z-score:-2.65E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:6.99E-06; Z-score:-1.46E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 4.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02747151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:8.49E-05; Z-score:-7.23E-01 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16727862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.45E-04; Z-score:3.61E-01 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 1.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of ATP10A in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg23948362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.36E-09; Z-score:-2.09E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
68 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg13591783) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.31E+00 | Statistic Test | p-value:4.58E-23; Z-score:-4.09E+00 | ||
|
Methylation in Case |
2.61E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg01791587) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.97E+00 | Statistic Test | p-value:5.22E-14; Z-score:2.27E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 1.75E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg25508319) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.92E+00 | Statistic Test | p-value:2.15E-09; Z-score:-1.94E+00 | ||
|
Methylation in Case |
2.03E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg02114946) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.74E+00 | Statistic Test | p-value:1.98E-07; Z-score:-1.41E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 2.59E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg10829727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.84E+00 | Statistic Test | p-value:1.34E-06; Z-score:-1.94E+00 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 3.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg00762738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:2.16E-06; Z-score:1.63E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg23336810) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.18E-05; Z-score:-1.16E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg00152041) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:4.62E-05; Z-score:-8.48E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 1.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg12296552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:7.17E-04; Z-score:7.50E-01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg12518775) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.59E-03; Z-score:-2.80E-01 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg15982419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:2.14E-21; Z-score:-3.65E+00 | ||
|
Methylation in Case |
2.97E-01 (Median) | Methylation in Control | 4.09E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg25281171) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.39E-15; Z-score:2.24E+00 | ||
|
Methylation in Case |
9.21E-02 (Median) | Methylation in Control | 7.15E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg23141183) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:9.95E-10; Z-score:-1.33E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg20066612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.97E-09; Z-score:-1.38E+00 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 5.29E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.61E+00 | Statistic Test | p-value:1.33E-08; Z-score:1.37E+00 | ||
|
Methylation in Case |
1.48E-01 (Median) | Methylation in Control | 9.17E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg20495009) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.37E-07; Z-score:-1.17E+00 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg13993179) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.47E-07; Z-score:-1.40E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.38E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.54E+00 | Statistic Test | p-value:7.72E-05; Z-score:1.45E+00 | ||
|
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg05591210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.05E-04; Z-score:-1.14E+00 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg24789128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.30E-03; Z-score:2.91E-01 | ||
|
Methylation in Case |
7.04E-02 (Median) | Methylation in Control | 6.55E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg03702545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.83E-02; Z-score:4.51E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24565369) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.48E+00 | Statistic Test | p-value:8.03E-14; Z-score:7.50E-01 | ||
|
Methylation in Case |
7.19E-02 (Median) | Methylation in Control | 4.85E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg15026150) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.70E-07; Z-score:5.43E-01 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg21306329) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-5.18E+00 | Statistic Test | p-value:2.48E-06; Z-score:-1.61E+00 | ||
|
Methylation in Case |
6.06E-02 (Median) | Methylation in Control | 3.14E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg05339727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:1.21E-05; Z-score:-1.30E+00 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 3.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg14494721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:5.40E-04; Z-score:8.33E-01 | ||
|
Methylation in Case |
3.57E-01 (Median) | Methylation in Control | 3.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg14588399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:9.39E-04; Z-score:-5.83E-01 | ||
|
Methylation in Case |
4.84E-01 (Median) | Methylation in Control | 5.18E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24363298) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:5.89E-03; Z-score:-5.59E-01 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg24154937) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:5.69E-13; Z-score:2.42E+00 | ||
|
Methylation in Case |
5.24E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg04874129) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:3.74E-08; Z-score:1.43E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 2.71E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg13555101) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.18E-03; Z-score:-6.47E-01 | ||
|
Methylation in Case |
9.64E-02 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23517752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:4.54E-39; Z-score:-5.28E+00 | ||
|
Methylation in Case |
5.71E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:1.39E-13; Z-score:1.83E+00 | ||
|
Methylation in Case |
3.30E-01 (Median) | Methylation in Control | 2.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15022049) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:4.81E-13; Z-score:-2.26E+00 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.40E-10; Z-score:-1.59E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08362628) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.37E-10; Z-score:-1.45E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16680214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:3.33E-10; Z-score:-1.91E+00 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 3.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19272348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.46E+00 | Statistic Test | p-value:5.15E-10; Z-score:-1.99E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg04602747) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:1.31E-08; Z-score:-1.46E+00 | ||
|
Methylation in Case |
3.06E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:3.84E-08; Z-score:-1.75E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 6.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg12355681) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.00E+00 | Statistic Test | p-value:6.01E-08; Z-score:-1.56E+00 | ||
|
Methylation in Case |
1.56E-01 (Median) | Methylation in Control | 3.11E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg11637076) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:1.13E-07; Z-score:-1.66E+00 | ||
|
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 2.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00026803) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:3.68E-07; Z-score:1.71E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg05621157) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.02E+00 | Statistic Test | p-value:7.53E-07; Z-score:-1.42E+00 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 2.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16665234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.01E-06; Z-score:-5.52E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.88E+00 | Statistic Test | p-value:4.36E-06; Z-score:-1.66E+00 | ||
|
Methylation in Case |
2.11E-01 (Median) | Methylation in Control | 3.96E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg06018240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:5.25E-06; Z-score:9.06E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09344281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:7.06E-06; Z-score:1.45E+00 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg02641941) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:7.77E-06; Z-score:-1.12E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg06888094) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.39E+00 | Statistic Test | p-value:2.03E-05; Z-score:-1.17E+00 | ||
|
Methylation in Case |
2.32E-01 (Median) | Methylation in Control | 3.21E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14387909) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.90E-05; Z-score:1.43E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg25350825) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:9.22E-05; Z-score:9.23E-01 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14574489) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.33E-04; Z-score:-6.63E-01 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09152490) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.53E-04; Z-score:5.89E-01 | ||
|
Methylation in Case |
6.55E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg06903325) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.39E-04; Z-score:-6.74E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17306339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.04E-03; Z-score:7.93E-01 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 4.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg07601645) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.13E-03; Z-score:-9.26E-01 | ||
|
Methylation in Case |
6.13E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.59E-03; Z-score:6.49E-01 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg11491407) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.62E-03; Z-score:7.63E-01 | ||
|
Methylation in Case |
4.18E-01 (Median) | Methylation in Control | 3.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.85E-03; Z-score:6.13E-01 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08830588) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:2.09E-03; Z-score:-1.12E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg12384004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.62E-03; Z-score:7.43E-01 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 6.16E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09150064) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.82E-03; Z-score:3.02E-01 | ||
|
Methylation in Case |
3.08E-01 (Median) | Methylation in Control | 2.94E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19853440) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.82E-02; Z-score:3.75E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg00452252) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:4.16E-09; Z-score:-1.71E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg11673687) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.22E-08; Z-score:-1.58E+00 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 7.13E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg21880222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:8.78E-07; Z-score:1.36E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of ATP10A in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg19122460) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.65E-02; Z-score:-4.50E-01 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
78 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:5.03E+00 | Statistic Test | p-value:2.85E-06; Z-score:1.10E+01 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 5.77E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.71E+00 | Statistic Test | p-value:2.94E-06; Z-score:-4.83E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.48E+00 | Statistic Test | p-value:6.93E-06; Z-score:1.06E+01 | ||
|
Methylation in Case |
2.69E-01 (Median) | Methylation in Control | 6.00E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.74E+00 | Statistic Test | p-value:1.13E-05; Z-score:3.60E+01 | ||
|
Methylation in Case |
2.88E-01 (Median) | Methylation in Control | 6.08E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.38E+00 | Statistic Test | p-value:2.24E-05; Z-score:1.31E+01 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 9.38E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.88E+00 | Statistic Test | p-value:3.10E-05; Z-score:4.26E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.18E+00 | Statistic Test | p-value:6.40E-05; Z-score:4.33E+00 | ||
|
Methylation in Case |
6.18E-01 (Median) | Methylation in Control | 2.84E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:7.86E-05; Z-score:-4.21E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.15E-04; Z-score:-3.43E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:3.00E-04; Z-score:-3.86E+00 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.02E+00 | Statistic Test | p-value:3.06E-04; Z-score:5.56E+00 | ||
|
Methylation in Case |
2.01E-01 (Median) | Methylation in Control | 9.93E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.78E+00 | Statistic Test | p-value:4.00E-04; Z-score:8.71E+00 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.26E+00 | Statistic Test | p-value:4.68E-04; Z-score:4.33E+00 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 6.22E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.92E+00 | Statistic Test | p-value:5.75E-04; Z-score:9.10E+00 | ||
|
Methylation in Case |
1.97E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:1.13E-03; Z-score:-3.00E+00 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 5.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:9.61E-03; Z-score:-2.40E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.63E-02; Z-score:1.16E+00 | ||
|
Methylation in Case |
7.57E-02 (Median) | Methylation in Control | 5.89E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:1.71E-02; Z-score:2.93E+00 | ||
|
Methylation in Case |
7.50E-02 (Median) | Methylation in Control | 4.68E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.26E+01 | Statistic Test | p-value:3.47E-04; Z-score:1.34E+01 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 5.85E-03 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:5.59E+00 | Statistic Test | p-value:3.56E-04; Z-score:2.67E+01 | ||
|
Methylation in Case |
1.20E-01 (Median) | Methylation in Control | 2.15E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.49E+01 | Statistic Test | p-value:6.80E-04; Z-score:9.45E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 6.99E-03 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:5.68E+00 | Statistic Test | p-value:1.18E-03; Z-score:8.95E+00 | ||
|
Methylation in Case |
5.37E-02 (Median) | Methylation in Control | 9.46E-03 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.07E+00 | Statistic Test | p-value:1.94E-03; Z-score:7.41E+00 | ||
|
Methylation in Case |
8.28E-02 (Median) | Methylation in Control | 2.70E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.27E+00 | Statistic Test | p-value:1.60E-14; Z-score:-2.60E+01 | ||
|
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.88E+00 | Statistic Test | p-value:1.66E-12; Z-score:-1.15E+01 | ||
|
Methylation in Case |
2.24E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.10E+00 | Statistic Test | p-value:3.36E-11; Z-score:-1.41E+01 | ||
|
Methylation in Case |
2.79E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.96E+00 | Statistic Test | p-value:5.28E-11; Z-score:-9.96E+00 | ||
|
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.99E+00 | Statistic Test | p-value:2.59E-10; Z-score:-1.24E+01 | ||
|
Methylation in Case |
3.85E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.72E+00 | Statistic Test | p-value:2.67E-10; Z-score:-1.47E+01 | ||
|
Methylation in Case |
4.68E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.23E+00 | Statistic Test | p-value:4.56E-10; Z-score:-7.87E+00 | ||
|
Methylation in Case |
3.09E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:1.00E-09; Z-score:-2.00E+01 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.88E+00 | Statistic Test | p-value:3.72E-09; Z-score:-8.41E+00 | ||
|
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 5.33E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.46E+00 | Statistic Test | p-value:4.10E-09; Z-score:-9.36E+00 | ||
|
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:5.77E-09; Z-score:-3.95E+01 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg23158862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:5.96E-09; Z-score:-2.13E+01 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:2.97E-08; Z-score:-1.21E+01 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16605633) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:9.82E-08; Z-score:-5.79E+00 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:1.05E-07; Z-score:-1.41E+01 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:1.53E-07; Z-score:-9.25E+00 | ||
|
Methylation in Case |
6.42E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:2.07E-07; Z-score:-4.74E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:3.84E-07; Z-score:-5.40E+00 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 4.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:6.72E-07; Z-score:-1.06E+01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:8.75E-07; Z-score:-1.91E+01 | ||
|
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07318335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:1.01E-06; Z-score:-9.65E+00 | ||
|
Methylation in Case |
7.18E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:2.04E-06; Z-score:-3.93E+01 | ||
|
Methylation in Case |
7.60E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:2.08E-06; Z-score:-1.33E+01 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 8.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:2.91E-06; Z-score:-6.90E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:2.96E-06; Z-score:-1.04E+01 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24602704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:5.99E-06; Z-score:-1.87E+01 | ||
|
Methylation in Case |
7.18E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:6.85E-06; Z-score:-6.52E+00 | ||
|
Methylation in Case |
5.18E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:8.60E-06; Z-score:-1.27E+01 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg25703338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:8.61E-06; Z-score:-6.65E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg23880822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.44E-05; Z-score:-8.92E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09978546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:1.60E-05; Z-score:-7.18E+00 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:2.86E-05; Z-score:-1.01E+01 | ||
|
Methylation in Case |
6.93E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:3.12E-05; Z-score:-4.97E+00 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:4.46E-05; Z-score:-4.16E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 5.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:5.15E-05; Z-score:-7.44E+00 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:6.23E-05; Z-score:-7.20E+00 | ||
|
Methylation in Case |
6.31E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:7.22E-05; Z-score:-4.27E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:1.28E-04; Z-score:-4.81E+00 | ||
|
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 5.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg16651441) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.89E-04; Z-score:-3.10E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.79E-04; Z-score:-5.11E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24576051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:7.89E-04; Z-score:-2.60E+00 | ||
|
Methylation in Case |
6.07E-01 (Median) | Methylation in Control | 7.18E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.13E+00 | Statistic Test | p-value:1.08E-03; Z-score:-2.55E+00 | ||
|
Methylation in Case |
1.78E-01 (Median) | Methylation in Control | 3.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.21E-03; Z-score:-3.93E+00 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.80E-03; Z-score:-1.30E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg17260954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.80E-03; Z-score:-4.06E+00 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon69 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.80E-03; Z-score:-1.57E+00 | ||
|
Methylation in Case |
9.69E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon70 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:2.02E-03; Z-score:-2.80E+00 | ||
|
Methylation in Case |
4.19E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon71 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg14216870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.94E-03; Z-score:-3.60E+00 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon72 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.22E-02; Z-score:-1.27E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon73 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.52E-02; Z-score:9.83E-01 | ||
|
Methylation in Case |
1.61E-01 (Median) | Methylation in Control | 1.40E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon74 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.56E-02; Z-score:-8.88E-01 | ||
|
Methylation in Case |
9.73E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon75 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.49E-02; Z-score:1.27E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon76 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:3.50E-02; Z-score:1.21E+00 | ||
|
Methylation in Case |
5.60E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon77 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:2.53E-08; Z-score:-2.72E+01 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon78 |
Methylation of ATP10A in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:9.02E-07; Z-score:-1.07E+01 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
76 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.61E+00 | Statistic Test | p-value:1.83E-09; Z-score:2.32E+00 | ||
|
Methylation in Case |
8.82E-02 (Median) | Methylation in Control | 5.48E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:5.69E-09; Z-score:1.49E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:9.84E-07; Z-score:1.14E+00 | ||
|
Methylation in Case |
8.49E-02 (Median) | Methylation in Control | 6.71E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:6.31E-06; Z-score:7.69E-01 | ||
|
Methylation in Case |
9.52E-02 (Median) | Methylation in Control | 7.84E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:8.07E-06; Z-score:8.58E-01 | ||
|
Methylation in Case |
9.58E-02 (Median) | Methylation in Control | 7.62E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:2.83E-05; Z-score:8.33E-01 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 9.96E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:2.85E-05; Z-score:5.05E-01 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.78E-04; Z-score:4.22E-01 | ||
|
Methylation in Case |
5.94E-02 (Median) | Methylation in Control | 5.06E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:6.58E-04; Z-score:1.00E-01 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 7.47E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.15E-03; Z-score:5.19E-01 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 1.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:5.28E-03; Z-score:-8.42E-01 | ||
|
Methylation in Case |
6.74E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:7.16E-03; Z-score:-4.76E-01 | ||
|
Methylation in Case |
5.66E-01 (Median) | Methylation in Control | 6.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:8.25E-03; Z-score:-7.48E-03 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.59E-02; Z-score:-5.92E-01 | ||
|
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.65E-02; Z-score:1.78E-01 | ||
|
Methylation in Case |
4.46E-02 (Median) | Methylation in Control | 4.21E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.82E+00 | Statistic Test | p-value:2.60E-05; Z-score:8.45E-01 | ||
|
Methylation in Case |
3.85E-02 (Median) | Methylation in Control | 2.12E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:3.03E-04; Z-score:4.73E-01 | ||
|
Methylation in Case |
2.36E-02 (Median) | Methylation in Control | 1.77E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:3.22E-04; Z-score:6.55E-01 | ||
|
Methylation in Case |
2.64E-02 (Median) | Methylation in Control | 1.74E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:4.18E-04; Z-score:5.45E-01 | ||
|
Methylation in Case |
1.50E-02 (Median) | Methylation in Control | 1.04E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.69E+00 | Statistic Test | p-value:5.69E-04; Z-score:1.05E+00 | ||
|
Methylation in Case |
5.02E-02 (Median) | Methylation in Control | 2.97E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.44E-02; Z-score:1.14E-01 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.27E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.41E+00 | Statistic Test | p-value:3.22E-12; Z-score:2.80E+00 | ||
|
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 7.36E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.70E-10; Z-score:-2.34E+00 | ||
|
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:4.07E-10; Z-score:-2.03E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:6.28E-10; Z-score:-1.65E+00 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:2.08E-09; Z-score:-1.82E+00 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 3.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:7.32E-09; Z-score:-1.75E+00 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.84E+00 | Statistic Test | p-value:3.25E-08; Z-score:-1.64E+00 | ||
|
Methylation in Case |
2.68E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg18256640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:6.52E-08; Z-score:2.14E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 6.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.43E-07; Z-score:-1.78E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.92E-07; Z-score:-2.45E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:5.06E-07; Z-score:-1.35E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:8.64E-07; Z-score:-1.30E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.08E-06; Z-score:-1.54E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.57E-06; Z-score:-9.48E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.60E-06; Z-score:-1.22E+00 | ||
|
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 7.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.52E-06; Z-score:-1.24E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.95E-06; Z-score:-8.51E-01 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:5.24E-06; Z-score:-1.06E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.04E-05; Z-score:-9.25E-01 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.24E-05; Z-score:-7.28E-01 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20696050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.25E-05; Z-score:-1.42E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.82E-05; Z-score:-9.63E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.83E-05; Z-score:-9.20E-01 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:3.23E-05; Z-score:5.42E-01 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 2.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.06E-05; Z-score:-8.87E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg23158862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.51E-05; Z-score:-9.68E-01 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:5.26E-05; Z-score:-1.34E+00 | ||
|
Methylation in Case |
6.78E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:5.97E-05; Z-score:-1.21E+00 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 7.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:7.33E-05; Z-score:-9.75E-01 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:9.88E-05; Z-score:-8.78E-01 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.21E-04; Z-score:-8.89E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.46E-04; Z-score:-2.70E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.86E-04; Z-score:1.29E+00 | ||
|
Methylation in Case |
4.95E-01 (Median) | Methylation in Control | 4.30E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg17260954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.13E-04; Z-score:-7.69E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.51E-04; Z-score:-9.60E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.11E-04; Z-score:-5.49E-01 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:8.48E-04; Z-score:-9.17E-01 | ||
|
Methylation in Case |
5.53E-01 (Median) | Methylation in Control | 6.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg13825334) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.28E-03; Z-score:-9.37E-01 | ||
|
Methylation in Case |
8.47E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg23880822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.64E-03; Z-score:-7.50E-01 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg24602704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:2.02E-03; Z-score:-8.63E-01 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.30E-03; Z-score:-1.07E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 9.80E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:3.26E-03; Z-score:2.10E-01 | ||
|
Methylation in Case |
3.48E-02 (Median) | Methylation in Control | 2.79E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15338782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:3.57E-03; Z-score:7.09E-01 | ||
|
Methylation in Case |
5.30E-01 (Median) | Methylation in Control | 4.69E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02287939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.10E-03; Z-score:-1.27E+00 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.77E-03; Z-score:-3.13E-01 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:6.25E-03; Z-score:-9.99E-01 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16605633) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:6.44E-03; Z-score:-9.08E-01 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon69 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:8.20E-03; Z-score:-5.75E-01 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon70 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07318335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:9.04E-03; Z-score:-2.74E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon71 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.02E-02; Z-score:-2.85E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon72 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.91E-02; Z-score:-3.58E-01 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 6.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon73 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (ch.15.89498F) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:3.79E-02; Z-score:-3.53E-01 | ||
|
Methylation in Case |
2.74E-02 (Median) | Methylation in Control | 3.40E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon74 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:4.02E-02; Z-score:-1.17E+00 | ||
|
Methylation in Case |
4.87E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon75 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.86E-05; Z-score:-1.08E+00 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon76 |
Methylation of ATP10A in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.07E-04; Z-score:-1.17E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in celiac disease | [ 6 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.48E+00 | Statistic Test | p-value:2.53E-02; Z-score:1.14E+00 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 3.13E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease[ ICD-11:DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:3.44E-06; Z-score:2.18E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26879349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:3.60E-06; Z-score:1.96E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.15E+00 | Statistic Test | p-value:7.20E-06; Z-score:2.10E+00 | ||
|
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 8.03E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.29E-05; Z-score:2.30E+00 | ||
|
Methylation in Case |
6.51E-01 (Median) | Methylation in Control | 5.73E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:1.59E-04; Z-score:1.05E+00 | ||
|
Methylation in Case |
6.53E-02 (Median) | Methylation in Control | 5.19E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:4.42E-04; Z-score:1.48E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:1.02E-03; Z-score:1.62E+00 | ||
|
Methylation in Case |
3.17E-02 (Median) | Methylation in Control | 1.99E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:1.72E-03; Z-score:2.89E-01 | ||
|
Methylation in Case |
2.94E-02 (Median) | Methylation in Control | 2.67E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:2.71E-03; Z-score:2.25E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 5.68E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:3.63E-03; Z-score:2.62E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:4.64E-03; Z-score:7.35E-01 | ||
|
Methylation in Case |
3.35E-02 (Median) | Methylation in Control | 2.98E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:4.79E-03; Z-score:1.46E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:8.33E-03; Z-score:5.78E-01 | ||
|
Methylation in Case |
7.40E-02 (Median) | Methylation in Control | 6.31E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:8.91E-03; Z-score:5.65E-01 | ||
|
Methylation in Case |
4.85E-02 (Median) | Methylation in Control | 4.25E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:1.25E-02; Z-score:8.73E-01 | ||
|
Methylation in Case |
3.18E-02 (Median) | Methylation in Control | 2.41E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.74E-02; Z-score:5.66E-01 | ||
|
Methylation in Case |
1.23E-02 (Median) | Methylation in Control | 1.11E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.77E-02; Z-score:1.20E+00 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.90E-02; Z-score:6.94E-01 | ||
|
Methylation in Case |
3.45E-02 (Median) | Methylation in Control | 2.90E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.96E-02; Z-score:7.05E-01 | ||
|
Methylation in Case |
2.24E-02 (Median) | Methylation in Control | 1.92E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.54E-02; Z-score:4.01E-01 | ||
|
Methylation in Case |
2.04E-02 (Median) | Methylation in Control | 1.87E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:8.27E-04; Z-score:6.95E-01 | ||
|
Methylation in Case |
9.08E-02 (Median) | Methylation in Control | 7.93E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:5.11E-04; Z-score:-5.66E-01 | ||
|
Methylation in Case |
9.78E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.68E-03; Z-score:-6.08E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.80E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.01E-02; Z-score:3.96E-01 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 6.81E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.69E-02; Z-score:-3.70E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
77 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:6.35E-16; Z-score:-6.02E+00 | ||
|
Methylation in Case |
6.58E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:4.27E-15; Z-score:-4.66E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.50E-11; Z-score:-2.94E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.50E-10; Z-score:-2.67E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.19E+00 | Statistic Test | p-value:3.32E-09; Z-score:2.02E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 2.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.28E-08; Z-score:-3.83E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.07E+00 | Statistic Test | p-value:2.06E-07; Z-score:1.81E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.77E+00 | Statistic Test | p-value:2.92E-07; Z-score:1.69E+00 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:3.82E-07; Z-score:-1.77E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.68E+00 | Statistic Test | p-value:3.19E-06; Z-score:1.72E+00 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 3.82E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.07E+00 | Statistic Test | p-value:3.36E-06; Z-score:1.40E+00 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 9.46E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:2.25E-05; Z-score:1.01E+00 | ||
|
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:6.21E-05; Z-score:1.17E+00 | ||
|
Methylation in Case |
6.25E-01 (Median) | Methylation in Control | 4.13E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.48E+00 | Statistic Test | p-value:1.05E-04; Z-score:1.32E+00 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 4.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg22797991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:3.38E-03; Z-score:6.09E-01 | ||
|
Methylation in Case |
4.45E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.19E-02; Z-score:7.82E-01 | ||
|
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 3.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:2.89E-02; Z-score:7.30E-01 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 4.25E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.71E+00 | Statistic Test | p-value:3.48E-12; Z-score:2.94E+00 | ||
|
Methylation in Case |
3.70E-01 (Median) | Methylation in Control | 9.99E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.09E+00 | Statistic Test | p-value:5.82E-11; Z-score:2.63E+00 | ||
|
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.71E+00 | Statistic Test | p-value:7.61E-10; Z-score:2.14E+00 | ||
|
Methylation in Case |
4.35E-01 (Median) | Methylation in Control | 1.60E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.48E+00 | Statistic Test | p-value:5.51E-09; Z-score:2.01E+00 | ||
|
Methylation in Case |
5.10E-01 (Median) | Methylation in Control | 2.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.35E+00 | Statistic Test | p-value:1.30E-07; Z-score:1.84E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 2.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.61E+00 | Statistic Test | p-value:4.52E-10; Z-score:2.19E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 4.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:2.85E-17; Z-score:-4.57E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.44E-16; Z-score:-8.90E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.22E-15; Z-score:-4.90E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:2.87E-14; Z-score:-4.45E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:2.28E-12; Z-score:-3.49E+00 | ||
|
Methylation in Case |
6.68E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:3.24E-12; Z-score:-5.26E+00 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.97E-12; Z-score:-7.81E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.34E-11; Z-score:-5.93E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.53E-11; Z-score:-2.89E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.22E-11; Z-score:-2.83E+00 | ||
|
Methylation in Case |
7.12E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:4.46E-11; Z-score:-2.73E+00 | ||
|
Methylation in Case |
7.06E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:4.51E-11; Z-score:-3.77E+00 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.63E-11; Z-score:-2.58E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23158862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:5.59E-11; Z-score:-9.81E+00 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.23E-10; Z-score:-4.60E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16605633) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:2.32E-10; Z-score:-2.34E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:5.88E-10; Z-score:-9.18E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 9.45E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:8.18E-08; Z-score:-7.00E+00 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.18E-07; Z-score:-1.69E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.64E-07; Z-score:-1.94E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.65E-07; Z-score:-3.03E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:1.90E-07; Z-score:1.56E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 4.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.35E-07; Z-score:-2.20E+00 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.38E-07; Z-score:-2.31E+00 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:8.62E-07; Z-score:-1.51E+00 | ||
|
Methylation in Case |
7.91E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg24602704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.26E-06; Z-score:-2.18E+00 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.74E-06; Z-score:-2.26E+00 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg25703338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:4.17E-06; Z-score:-1.81E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:7.33E-06; Z-score:-1.19E+00 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.40E-06; Z-score:-2.61E+00 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.34E-05; Z-score:-1.68E+00 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.39E-05; Z-score:-8.68E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:5.79E-05; Z-score:-1.09E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.08E-04; Z-score:-5.77E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:1.26E-04; Z-score:-1.43E+00 | ||
|
Methylation in Case |
2.67E-01 (Median) | Methylation in Control | 3.99E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16651441) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.97E-04; Z-score:-7.82E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:2.88E-04; Z-score:-1.19E+00 | ||
|
Methylation in Case |
4.34E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.08E-04; Z-score:-1.56E+00 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.85E-04; Z-score:-1.12E+00 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:5.33E-04; Z-score:-9.93E-01 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:6.72E-04; Z-score:-5.60E-01 | ||
|
Methylation in Case |
9.76E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.03E-03; Z-score:-2.43E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.21E-03; Z-score:-8.61E-01 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg09978546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.49E-03; Z-score:-8.66E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.88E-03; Z-score:8.64E-01 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 6.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon69 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg17260954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.16E-03; Z-score:-9.40E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon70 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11817038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.50E-03; Z-score:-4.83E-01 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon71 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23880822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.48E-03; Z-score:-5.87E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon72 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg20696050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:7.77E-03; Z-score:-3.63E-01 | ||
|
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon73 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.30E-02; Z-score:1.86E-02 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon74 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.11E-02; Z-score:8.99E-02 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 3.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon75 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.59E-05; Z-score:-1.08E+00 | ||
|
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon76 |
Methylation of ATP10A in colorectal cancer | [ 8 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.37E-04; Z-score:-1.44E+00 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:6.93E-03; Z-score:5.29E-01 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 9.04E-02 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
TSS1500 (cg09638395) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.97E-02; Z-score:2.49E-01 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.77E-02; Z-score:4.79E-01 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 6.96E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.63E-03; Z-score:6.28E-01 | ||
|
Methylation in Case |
9.59E-02 (Median) | Methylation in Control | 8.94E-02 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:2.94E-03; Z-score:7.03E-01 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 2.13E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in depression | [ 9 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.25E-02; Z-score:-4.89E-01 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
55 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.46E+00 | Statistic Test | p-value:3.27E-07; Z-score:4.60E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 9.37E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:1.95E-05; Z-score:2.09E+00 | ||
|
Methylation in Case |
4.55E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.52E-04; Z-score:-1.25E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:1.65E-03; Z-score:1.78E+00 | ||
|
Methylation in Case |
5.59E-02 (Median) | Methylation in Control | 4.09E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:3.97E-03; Z-score:1.47E+00 | ||
|
Methylation in Case |
7.26E-02 (Median) | Methylation in Control | 5.71E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:4.54E-03; Z-score:1.27E+00 | ||
|
Methylation in Case |
9.24E-02 (Median) | Methylation in Control | 7.14E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg13417268) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:9.90E-03; Z-score:7.50E-01 | ||
|
Methylation in Case |
5.44E-02 (Median) | Methylation in Control | 4.26E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.09E-02; Z-score:2.93E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg18939241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.23E-02; Z-score:-8.73E-01 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.07E-02; Z-score:7.64E-01 | ||
|
Methylation in Case |
6.23E-02 (Median) | Methylation in Control | 5.11E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:2.64E-02; Z-score:4.26E-01 | ||
|
Methylation in Case |
5.37E-02 (Median) | Methylation in Control | 4.72E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg26519141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:3.96E-02; Z-score:4.21E-01 | ||
|
Methylation in Case |
2.47E-01 (Median) | Methylation in Control | 2.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.08E+00 | Statistic Test | p-value:3.15E-04; Z-score:1.18E+00 | ||
|
Methylation in Case |
2.37E-02 (Median) | Methylation in Control | 1.14E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.77E+00 | Statistic Test | p-value:6.46E-04; Z-score:9.16E-01 | ||
|
Methylation in Case |
3.27E-02 (Median) | Methylation in Control | 1.84E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.22E+00 | Statistic Test | p-value:7.01E-04; Z-score:1.11E+00 | ||
|
Methylation in Case |
3.15E-02 (Median) | Methylation in Control | 1.42E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:1.99E-03; Z-score:5.83E-01 | ||
|
Methylation in Case |
3.51E-02 (Median) | Methylation in Control | 2.23E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.17E-02; Z-score:5.19E-01 | ||
|
Methylation in Case |
4.20E-02 (Median) | Methylation in Control | 3.44E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg25703338) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.72E-13; Z-score:1.59E+00 | ||
|
Methylation in Case |
9.56E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.69E-12; Z-score:1.67E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.50E-10; Z-score:1.43E+00 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.63E+00 | Statistic Test | p-value:2.02E-09; Z-score:2.96E+00 | ||
|
Methylation in Case |
5.64E-01 (Median) | Methylation in Control | 3.47E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.54E+00 | Statistic Test | p-value:7.60E-09; Z-score:3.34E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 4.15E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.56E+00 | Statistic Test | p-value:1.87E-08; Z-score:2.65E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 3.19E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.24E-08; Z-score:1.17E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20119871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.46E-08; Z-score:1.32E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:5.30E-08; Z-score:9.61E-01 | ||
|
Methylation in Case |
9.36E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.95E+00 | Statistic Test | p-value:1.22E-07; Z-score:3.34E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 1.72E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.87E-07; Z-score:1.23E+00 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.85E-07; Z-score:2.02E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg13361023) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.41E-06; Z-score:-1.77E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.95E-06; Z-score:1.11E+00 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.05E-05; Z-score:1.23E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20696050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:9.95E-05; Z-score:8.83E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.90E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.30E-04; Z-score:1.45E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.70E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.04E-04; Z-score:6.06E-01 | ||
|
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.11E-04; Z-score:-1.30E+00 | ||
|
Methylation in Case |
5.73E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:8.75E-04; Z-score:-1.24E+00 | ||
|
Methylation in Case |
2.07E-01 (Median) | Methylation in Control | 2.70E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.15E-03; Z-score:4.28E-01 | ||
|
Methylation in Case |
9.85E-01 (Median) | Methylation in Control | 9.81E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg17805836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.43E-03; Z-score:6.44E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.90E-03; Z-score:2.78E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.08E-03; Z-score:1.27E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg19930802) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.43E-03; Z-score:2.22E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.68E-03; Z-score:-1.06E+00 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.93E-03; Z-score:-1.04E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15338782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.97E-03; Z-score:-5.16E-01 | ||
|
Methylation in Case |
6.21E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.39E-03; Z-score:3.68E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:6.70E-03; Z-score:2.95E-01 | ||
|
Methylation in Case |
9.63E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:7.01E-03; Z-score:5.38E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.13E-02; Z-score:7.90E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.66E-02; Z-score:-6.75E-01 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.18E-02; Z-score:2.99E-01 | ||
|
Methylation in Case |
9.95E-01 (Median) | Methylation in Control | 9.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg18749411) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.45E-02; Z-score:3.91E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16395892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.80E-02; Z-score:4.88E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.18E-04; Z-score:7.41E-01 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of ATP10A in HIV infection | [ 10 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.04E-03; Z-score:6.80E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg15523238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:6.62E-03; Z-score:3.22E+00 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg18083248) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:7.60E-03; Z-score:2.51E+00 | ||
|
Methylation in Case |
4.52E-01 (Median) | Methylation in Control | 3.23E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg17174275) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:7.87E-03; Z-score:-1.91E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.58E+00 | Statistic Test | p-value:1.58E-02; Z-score:3.42E+00 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.68E+00 | Statistic Test | p-value:3.98E-02; Z-score:2.81E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 9.00E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.19E-02; Z-score:-9.69E-01 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:4.46E-02; Z-score:2.18E+00 | ||
|
Methylation in Case |
8.18E-02 (Median) | Methylation in Control | 6.51E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg22113930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.09E+00 | Statistic Test | p-value:6.20E-03; Z-score:6.64E+00 | ||
|
Methylation in Case |
1.27E-01 (Median) | Methylation in Control | 6.08E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg16389285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.54E+00 | Statistic Test | p-value:9.28E-03; Z-score:4.15E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 4.61E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg03419058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.84E+00 | Statistic Test | p-value:9.89E-03; Z-score:9.06E+00 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 5.86E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg26230285) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.08E+00 | Statistic Test | p-value:1.28E-02; Z-score:4.67E+00 | ||
|
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 6.03E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.77E+00 | Statistic Test | p-value:1.35E-02; Z-score:3.77E+00 | ||
|
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 5.02E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:3.20E-02; Z-score:1.47E+00 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.30E-03; Z-score:2.49E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 5.74E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:9.32E-03; Z-score:2.05E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.03E-02; Z-score:-1.25E+00 | ||
|
Methylation in Case |
8.92E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.21E-02; Z-score:1.30E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:1.52E-02; Z-score:1.94E+00 | ||
|
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 1.26E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:2.50E-02; Z-score:2.76E+00 | ||
|
Methylation in Case |
4.09E-01 (Median) | Methylation in Control | 2.83E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.58E-02; Z-score:-2.20E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:2.95E-02; Z-score:1.02E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 5.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.06E-02; Z-score:-2.43E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:4.42E-02; Z-score:3.67E+00 | ||
|
Methylation in Case |
6.73E-02 (Median) | Methylation in Control | 5.32E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.91E-02; Z-score:-1.67E+00 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in lung adenocarcinoma | [ 11 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:5.16E-04; Z-score:1.99E+00 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:9.80E-01 | Statistic Test | p-value:2.54E-02; Z-score:2.80E-01 | ||
|
Methylation in Case |
-5.36E+00 (Median) | Methylation in Control | -5.46E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-8.01E-01 | Statistic Test | p-value:2.09E-03; Z-score:-2.78E-01 | ||
|
Methylation in Case |
-9.53E-01 (Median) | Methylation in Control | -7.63E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.52E-02; Z-score:4.33E-01 | ||
|
Methylation in Case |
1.13E+00 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.53E-02; Z-score:2.77E-01 | ||
|
Methylation in Case |
2.79E+00 (Median) | Methylation in Control | 2.68E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-9.13E-01 | Statistic Test | p-value:2.02E-02; Z-score:-5.03E-01 | ||
|
Methylation in Case |
-3.44E+00 (Median) | Methylation in Control | -3.14E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-8.36E-01 | Statistic Test | p-value:2.20E-02; Z-score:-5.49E-01 | ||
|
Methylation in Case |
-2.00E+00 (Median) | Methylation in Control | -1.67E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg26913186) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:2.80E-02; Z-score:5.39E-01 | ||
|
Methylation in Case |
3.20E+00 (Median) | Methylation in Control | 2.95E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.24E-02; Z-score:-1.59E-01 | ||
|
Methylation in Case |
1.51E+00 (Median) | Methylation in Control | 1.58E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in panic disorder | [ 12 ] | |||
|
Location |
Body (cg14216870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.46E-02; Z-score:2.33E-01 | ||
|
Methylation in Case |
4.66E+00 (Median) | Methylation in Control | 4.60E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.06E-03; Z-score:-6.13E-01 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg25846723) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.27E-02; Z-score:5.31E-01 | ||
|
Methylation in Case |
2.04E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:1.98E-02; Z-score:8.26E-01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 6.45E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
TSS1500 (cg07470694) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.81E-02; Z-score:7.37E-01 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.27E+00 | Statistic Test | p-value:1.21E-27; Z-score:-5.17E+00 | ||
|
Methylation in Case |
3.21E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:2.38E-16; Z-score:-5.40E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg15275965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:3.95E-12; Z-score:-3.70E+00 | ||
|
Methylation in Case |
6.47E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.44E-07; Z-score:1.61E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg18256640) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.46E-06; Z-score:1.16E+00 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg27323557) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.32E-04; Z-score:-8.05E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.69E-04; Z-score:-6.52E-01 | ||
|
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.60E-03; Z-score:1.55E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:8.42E-03; Z-score:-7.68E-01 | ||
|
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg11817038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.16E-02; Z-score:-3.26E-01 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg16397021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.37E-02; Z-score:1.40E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg16988989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.39E-02; Z-score:-6.30E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.26E-02; Z-score:3.76E-01 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.36E-02; Z-score:-8.11E-01 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 5.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.64E-02; Z-score:7.44E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg17864405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.79E-02; Z-score:1.63E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in papillary thyroid cancer | [ 13 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.99E-02; Z-score:5.74E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg08599496) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.69E-02; Z-score:1.71E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg04361126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:2.85E-02; Z-score:1.67E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg05851042) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.18E-02; Z-score:2.75E+00 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS1500 (cg16848712) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:3.76E-02; Z-score:3.01E+00 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS200 (cg21331335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.55E-02; Z-score:1.98E+00 | ||
|
Methylation in Case |
9.70E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
TSS200 (cg20947082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.67E+00 | Statistic Test | p-value:2.48E-02; Z-score:2.39E+00 | ||
|
Methylation in Case |
9.96E-02 (Median) | Methylation in Control | 5.98E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg10620395) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.36E-03; Z-score:3.76E+00 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg24984698) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:3.24E-02; Z-score:-1.77E+01 | ||
|
Methylation in Case |
6.57E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg21150675) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.85E-02; Z-score:1.43E+00 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in prostate cancer | [ 14 ] | |||
|
Location |
Body (cg12516187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:4.72E-02; Z-score:1.42E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg16417876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.16E-04; Z-score:-3.40E-01 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg00774088) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:9.30E-04; Z-score:-4.09E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg24687432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.04E-03; Z-score:-2.93E-01 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg18194306) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.83E-03; Z-score:-1.67E-01 | ||
|
Methylation in Case |
7.08E-02 (Median) | Methylation in Control | 7.50E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg00288824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.15E-03; Z-score:-1.63E-01 | ||
|
Methylation in Case |
7.52E-02 (Median) | Methylation in Control | 7.96E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg26879349) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.84E-03; Z-score:-1.24E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg08828036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.91E-03; Z-score:-3.35E-01 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg06066676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:8.42E-03; Z-score:-1.18E-01 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg02245837) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.09E-02; Z-score:-1.64E-01 | ||
|
Methylation in Case |
5.85E-02 (Median) | Methylation in Control | 6.23E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg09984339) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.19E-02; Z-score:-1.11E-01 | ||
|
Methylation in Case |
7.08E-02 (Median) | Methylation in Control | 7.33E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.98E-02; Z-score:-1.55E-01 | ||
|
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg21951425) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.33E-02; Z-score:-6.08E-02 | ||
|
Methylation in Case |
4.85E-02 (Median) | Methylation in Control | 4.93E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.37E-02; Z-score:-4.07E-02 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg07470694) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.44E-02; Z-score:-1.13E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.12E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
TSS1500 (cg03307893) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.50E-02; Z-score:-5.06E-02 | ||
|
Methylation in Case |
3.94E-02 (Median) | Methylation in Control | 4.01E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:8.77E-03; Z-score:-1.35E-01 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:2.08E-12; Z-score:-5.33E-01 | ||
|
Methylation in Case |
2.44E-01 (Median) | Methylation in Control | 2.87E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg15338782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:5.95E-05; Z-score:-4.80E-01 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 6.37E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg19326876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.91E-04; Z-score:-1.06E-01 | ||
|
Methylation in Case |
9.54E-02 (Median) | Methylation in Control | 9.88E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg26478036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.35E-03; Z-score:1.35E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.09E-03; Z-score:2.09E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg20117103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:8.84E-03; Z-score:1.37E-01 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.39E-02; Z-score:2.13E-01 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 6.77E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg26336213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.43E-02; Z-score:9.00E-02 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg16727862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.46E-02; Z-score:7.86E-02 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg19657603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.59E-02; Z-score:-1.06E-01 | ||
|
Methylation in Case |
5.46E-02 (Median) | Methylation in Control | 5.58E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.78E-02; Z-score:-2.33E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.19E-02; Z-score:2.71E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.64E-02; Z-score:1.82E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
40 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.18E+00 | Statistic Test | p-value:8.48E-18; Z-score:3.35E+00 | ||
|
Methylation in Case |
4.30E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg00602502) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:3.03E-05; Z-score:1.09E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01206944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:5.52E-05; Z-score:-1.07E+00 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01364202) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.90E+00 | Statistic Test | p-value:6.21E-05; Z-score:-1.22E+00 | ||
|
Methylation in Case |
2.98E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.21E+00 | Statistic Test | p-value:6.29E-05; Z-score:1.36E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 2.42E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg01788205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:8.33E-05; Z-score:5.05E-01 | ||
|
Methylation in Case |
2.52E-01 (Median) | Methylation in Control | 2.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02107240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.16E-04; Z-score:9.18E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02208504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.22E-04; Z-score:-9.31E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02287939) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.39E-04; Z-score:6.76E-01 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02334109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:1.48E-04; Z-score:-1.32E+00 | ||
|
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg02747151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.25E-04; Z-score:-7.05E-01 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg03924551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.02E-04; Z-score:-1.07E+00 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg04218022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:6.27E-04; Z-score:-4.21E-01 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.57E-03; Z-score:-5.46E-01 | ||
|
Methylation in Case |
6.50E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg06870531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.02E-03; Z-score:-5.17E-01 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07100560) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.30E-03; Z-score:5.28E-01 | ||
|
Methylation in Case |
3.50E-01 (Median) | Methylation in Control | 3.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07318335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:3.79E-03; Z-score:5.37E-01 | ||
|
Methylation in Case |
1.45E-01 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07489029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.00E-03; Z-score:8.62E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg07986058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:5.11E-03; Z-score:6.91E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg08831522) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:8.11E-03; Z-score:5.42E-01 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 1.56E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg09958402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.26E-02; Z-score:-4.10E-01 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg09978546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.28E-02; Z-score:5.68E-01 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg10473100) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.49E+00 | Statistic Test | p-value:1.49E-02; Z-score:-5.47E-01 | ||
|
Methylation in Case |
1.00E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg10734665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.75E-02; Z-score:4.42E-01 | ||
|
Methylation in Case |
1.72E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:1.98E-02; Z-score:4.28E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11442877) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:2.25E-02; Z-score:-2.26E-01 | ||
|
Methylation in Case |
2.89E-02 (Median) | Methylation in Control | 3.62E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11557546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.30E-02; Z-score:5.04E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11817038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.52E-02; Z-score:6.77E-01 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12582965) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.84E-02; Z-score:3.79E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12860764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:3.06E-02; Z-score:-6.67E-01 | ||
|
Methylation in Case |
2.72E-01 (Median) | Methylation in Control | 3.10E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12933431) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.17E-02; Z-score:4.25E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13060434) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:3.23E-02; Z-score:6.44E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.49E-02; Z-score:3.95E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13361023) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.53E-02; Z-score:5.95E-01 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.65E-02; Z-score:3.44E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg13825334) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.90E-02; Z-score:-1.48E-01 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg14001035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.09E-02; Z-score:8.80E-02 | ||
|
Methylation in Case |
1.38E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg14216870) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:4.32E-02; Z-score:-6.34E-01 | ||
|
Methylation in Case |
1.27E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.50E-14; Z-score:-2.88E+00 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of ATP10A in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
3'UTR (cg04223222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.79E+00 | Statistic Test | p-value:2.59E-14; Z-score:2.59E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 1.94E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of ATP10A in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.10E-26; Fold-change:0.486364439; Z-score:8.669483283 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of ATP10A in gastric cancer than that in adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:4.32E-18; Fold-change:0.229351566; Z-score:19.96382269 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-335 directly targets ATP10A | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples