General Information of Drug Transporter (DT)
DT ID DTD0504 Transporter Info
Gene Name SLCO5A1
Transporter Name Organic anion transporting polypeptide 5A1
Gene ID
81796
UniProt ID
Q9H2Y9
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in prostate cancer [ 1 ]

Location

5'UTR (cg10842164)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:1.67E-02; Z-score:2.27E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 6.01E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in bladder cancer [ 2 ]

Location

TSS1500 (cg23677272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.05E+00 Statistic Test p-value:5.18E-16; Z-score:-3.19E+01

Methylation in Case

2.60E-01 (Median) Methylation in Control 5.34E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

TSS1500 (cg23677272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:5.55E-12; Z-score:-2.76E+00

Methylation in Case

4.28E-01 (Median) Methylation in Control 5.66E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

TSS1500 (cg22083639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:1.60E-02; Z-score:1.10E-02

Methylation in Case

9.19E-02 (Median) Methylation in Control 9.16E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

TSS200 (cg09962807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.49E-03; Z-score:3.13E-01

Methylation in Case

5.69E-02 (Median) Methylation in Control 5.28E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

TSS200 (cg22062659)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.12E-02; Z-score:3.41E-01

Methylation in Case

1.04E-01 (Median) Methylation in Control 9.68E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO5A1 in breast cancer [ 3 ]

Location

TSS200 (cg11996434)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.86E-02; Z-score:2.81E-01

Methylation in Case

5.34E-02 (Median) Methylation in Control 4.81E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in clear cell renal cell carcinoma [ 4 ]

Location

TSS1500 (cg23677272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:1.62E-06; Z-score:-3.11E+00

Methylation in Case

5.91E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg23677272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:6.73E-07; Z-score:-1.38E+00

Methylation in Case

6.85E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO5A1 in colorectal cancer [ 5 ]

Location

TSS1500 (cg18799048)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.65E-03; Z-score:5.72E-01

Methylation in Case

9.81E-02 (Median) Methylation in Control 9.00E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in HIV infection [ 6 ]

Location

TSS1500 (cg23677272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:2.84E-08; Z-score:3.34E+00

Methylation in Case

5.02E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO5A1 in HIV infection [ 6 ]

Location

TSS1500 (cg22083639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.40E+00 Statistic Test p-value:1.69E-06; Z-score:1.76E+00

Methylation in Case

9.65E-02 (Median) Methylation in Control 6.89E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO5A1 in HIV infection [ 6 ]

Location

TSS1500 (cg18799048)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:2.71E-03; Z-score:8.63E-01

Methylation in Case

6.32E-02 (Median) Methylation in Control 5.04E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in panic disorder [ 7 ]

Location

TSS1500 (cg23677272)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-8.70E-01 Statistic Test p-value:2.87E-03; Z-score:-5.43E-01

Methylation in Case

-1.38E+00 (Median) Methylation in Control -1.20E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in papillary thyroid cancer [ 8 ]

Location

TSS1500 (cg22083639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:1.59E-02; Z-score:-7.17E-01

Methylation in Case

6.47E-02 (Median) Methylation in Control 8.29E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in hepatocellular carcinoma [ 9 ]

Location

TSS200 (cg09962807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:7.59E-03; Z-score:-5.97E-02

Methylation in Case

6.55E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg03213352)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.87E-04; Z-score:-3.28E-01

Methylation in Case

1.34E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg25233339)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:4.67E-03; Z-score:-6.29E-01

Methylation in Case

1.16E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

TSS200 (cg02804028)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.70E-02; Z-score:-3.01E-01

Methylation in Case

9.04E-02 (Median) Methylation in Control 9.67E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO5A1 in pancretic ductal adenocarcinoma [ 10 ]

Location

Body (cg21957058)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:6.91E-03; Z-score:2.66E-01

Methylation in Case

2.41E-01 (Median) Methylation in Control 2.25E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in systemic lupus erythematosus [ 11 ]

Location

TSS200 (cg09962807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.05E-02; Z-score:-1.47E-01

Methylation in Case

6.99E-02 (Median) Methylation in Control 7.30E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO5A1 in colon adenocarcinoma [ 12 ]

Location

Body (cg12109968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:1.97E-06; Z-score:-1.19E+00

Methylation in Case

1.26E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLCO5A1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.000153584; Fold-change:-0.258677329; Z-score:-1.386842543
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         36 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-106a directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-106b directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1276 directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1276 miRNA Mature ID miR-1276

miRNA Sequence

UAAAGAGCCCUGUGGAGACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-17 directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-192 directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-3p

miRNA Sequence

CUGCCAAUUCCAUAGGUCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-20a directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-20b directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3183 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3183 miRNA Mature ID miR-3183

miRNA Sequence

GCCUCUCUCGGAGUCGCUCGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-3190 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3190 miRNA Mature ID miR-3190-5p

miRNA Sequence

UCUGGCCAGCUACGUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-320e directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-320e miRNA Mature ID miR-320e

miRNA Sequence

AAAGCUGGGUUGAGAAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-3926 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-4511 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4511 miRNA Mature ID miR-4511

miRNA Sequence

GAAGAACUGUUGCAUUUGCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-4684 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4684 miRNA Mature ID miR-4684-5p

miRNA Sequence

CUCUCUACUGACUUGCAACAUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4723 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-3p

miRNA Sequence

CCCUCUCUGGCUCCUCCCCAAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4731 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4731 miRNA Mature ID miR-4731-3p

miRNA Sequence

CACACAAGUGGCCCCCAACACU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon16

miR-4801 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4801 miRNA Mature ID miR-4801

miRNA Sequence

UACACAAGAAAACCAAGGCUCA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon17

miR-519a directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-519a miRNA Mature ID miR-519a-3p

miRNA Sequence

AAAGUGCAUCCUUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-519b directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-519b miRNA Mature ID miR-519b-3p

miRNA Sequence

AAAGUGCAUCCUUUUAGAGGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-519c directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-519c miRNA Mature ID miR-519c-3p

miRNA Sequence

AAAGUGCAUCUUUUUAGAGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-519d directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-526b directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-548az directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548az miRNA Mature ID miR-548az-5p

miRNA Sequence

CAAAAGUGAUUGUGGUUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-548b directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548b miRNA Mature ID miR-548b-3p

miRNA Sequence

CAAGAACCUCAGUUGCUUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-548s directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548s miRNA Mature ID miR-548s

miRNA Sequence

AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-548t directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548t miRNA Mature ID miR-548t-5p

miRNA Sequence

CAAAAGUGAUCGUGGUUUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-603 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-603 miRNA Mature ID miR-603

miRNA Sequence

CACACACUGCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon27

miR-6128 directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6128 miRNA Mature ID miR-6128

miRNA Sequence

ACUGGAAUUGGAGUCAAAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-6769b directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6769b miRNA Mature ID miR-6769b-3p

miRNA Sequence

CCCUCUCUGUCCCACCCAUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-6817 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6817 miRNA Mature ID miR-6817-3p

miRNA Sequence

UCUCUCUGACUCCAUGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-6849 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-6873 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-6892 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6892 miRNA Mature ID miR-6892-3p

miRNA Sequence

UCCCUCUCCCACCCCUUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-7110 directly targets SLCO5A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7110 miRNA Mature ID miR-7110-3p

miRNA Sequence

UCUCUCUCCCACUUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-767 directly targets SLCO5A1 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-767 miRNA Mature ID miR-767-5p

miRNA Sequence

UGCACCAUGGUUGUCUGAGCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-8485 directly targets SLCO5A1 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

CACACACACACACACACGUAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon36

miR-93 directly targets SLCO5A1 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
14 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.