Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0502 Transporter Info
Gene Name	SLCO4A1
Transporter Name	Organic anion transporting polypeptide 4A1
Gene ID	28231
UniProt ID	Q96BD0

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg00152041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:4.54E-09; Z-score:-1.48E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg01697623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:1.03E-08; Z-score:-1.46E+00
Methylation in Case	7.23E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04011829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.20E+00	Statistic Test	p-value:2.27E-08; Z-score:1.45E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg05381729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:4.66E-08; Z-score:-1.37E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg06479426)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:6.02E-08; Z-score:-1.05E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	7.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg12043732)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:3.45E-07; Z-score:-1.22E+00
Methylation in Case	3.42E-01 (Median)	Methylation in Control	4.95E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg26912312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:1.39E-05; Z-score:-1.24E+00
Methylation in Case	6.89E-01 (Median)	Methylation in Control	8.55E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg00465413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:2.59E-05; Z-score:-8.54E-01
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg03151194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:2.58E-04; Z-score:1.08E+00
Methylation in Case	5.23E-01 (Median)	Methylation in Control	4.00E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg05134013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.27E-03; Z-score:-7.13E-01
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.63E+00	Statistic Test	p-value:9.54E-03; Z-score:8.07E-01
Methylation in Case	3.69E-01 (Median)	Methylation in Control	2.26E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg10601171)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.65E-02; Z-score:-2.01E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg13162609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.32E-02; Z-score:4.49E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLCO4A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.75E+00	Statistic Test	p-value:3.65E-14; Z-score:2.28E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	4.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg05381729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.89E+00	Statistic Test	p-value:1.78E-07; Z-score:-6.43E+00
Methylation in Case	3.13E-01 (Median)	Methylation in Control	5.92E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg12043732)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.83E+00	Statistic Test	p-value:2.32E-06; Z-score:-6.73E+00
Methylation in Case	2.72E-01 (Median)	Methylation in Control	4.99E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg04011829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.42E+00	Statistic Test	p-value:1.26E-05; Z-score:-4.38E+00
Methylation in Case	2.66E-01 (Median)	Methylation in Control	3.76E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg01697623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.61E-02; Z-score:-2.07E+00
Methylation in Case	6.06E-01 (Median)	Methylation in Control	6.89E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.54E+00	Statistic Test	p-value:3.18E-06; Z-score:-6.76E+00
Methylation in Case	3.17E-01 (Median)	Methylation in Control	4.88E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg00465413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.61E+00	Statistic Test	p-value:5.63E-08; Z-score:-6.37E+00
Methylation in Case	4.95E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg10601171)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.32E+00	Statistic Test	p-value:8.51E-08; Z-score:-6.08E+00
Methylation in Case	5.27E-01 (Median)	Methylation in Control	6.98E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg13162609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.45E+00	Statistic Test	p-value:1.26E-07; Z-score:-1.63E+01
Methylation in Case	5.73E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg16405768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.17E+00	Statistic Test	p-value:8.88E-07; Z-score:-7.59E+00
Methylation in Case	6.60E-01 (Median)	Methylation in Control	7.72E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg21034324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.58E+00	Statistic Test	p-value:9.78E-07; Z-score:-6.81E+00
Methylation in Case	3.71E-01 (Median)	Methylation in Control	5.88E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:3.18E-06; Z-score:-6.37E+00
Methylation in Case	6.16E-01 (Median)	Methylation in Control	7.58E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	Body (cg05134013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:6.94E-05; Z-score:-2.91E+01
Methylation in Case	8.96E-01 (Median)	Methylation in Control	9.77E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLCO4A1 in bladder cancer			[ 2 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.87E+00	Statistic Test	p-value:2.15E-06; Z-score:-5.08E+00
Methylation in Case	4.29E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Breast cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	5'UTR (cg04011829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.33E+00	Statistic Test	p-value:2.51E-14; Z-score:2.83E+00
Methylation in Case	4.55E-01 (Median)	Methylation in Control	3.43E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	5'UTR (cg00152041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.58E+00	Statistic Test	p-value:6.09E-13; Z-score:2.72E+00
Methylation in Case	1.77E-01 (Median)	Methylation in Control	1.11E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	5'UTR (cg05381729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:5.04E-06; Z-score:-1.35E+00
Methylation in Case	5.44E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg16180531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.68E+00	Statistic Test	p-value:4.35E-09; Z-score:-1.42E+00
Methylation in Case	1.10E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg22744368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.56E+00	Statistic Test	p-value:1.28E-04; Z-score:-8.78E-01
Methylation in Case	5.17E-02 (Median)	Methylation in Control	8.05E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:5.08E-04; Z-score:-1.44E+00
Methylation in Case	3.83E-01 (Median)	Methylation in Control	4.60E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg00465413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.54E-09; Z-score:-2.01E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg13162609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:9.33E-09; Z-score:-2.00E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg10601171)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.08E+00	Statistic Test	p-value:1.43E-08; Z-score:-1.46E+00
Methylation in Case	6.82E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg16405768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.80E-08; Z-score:-1.45E+00
Methylation in Case	7.47E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:5.40E-07; Z-score:-1.13E+00
Methylation in Case	7.17E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg05134013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.37E-05; Z-score:-5.65E-01
Methylation in Case	9.68E-01 (Median)	Methylation in Control	9.78E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	Body (cg21034324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.60E-05; Z-score:-1.03E+00
Methylation in Case	5.86E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLCO4A1 in breast cancer			[ 3 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:5.94E-09; Z-score:-1.28E+00
Methylation in Case	7.02E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg00152041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.71E+00	Statistic Test	p-value:4.90E-04; Z-score:-1.68E+00
Methylation in Case	9.47E-02 (Median)	Methylation in Control	1.62E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.63E+00	Statistic Test	p-value:7.07E-17; Z-score:-5.04E+00
Methylation in Case	4.20E-01 (Median)	Methylation in Control	6.85E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg16180531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.71E+00	Statistic Test	p-value:1.88E-05; Z-score:-1.12E+00
Methylation in Case	4.24E-02 (Median)	Methylation in Control	7.26E-02 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg10601171)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:8.74E-05; Z-score:-1.70E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.99E-04; Z-score:-1.38E+00
Methylation in Case	8.60E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg16405768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:7.77E-04; Z-score:-1.84E+00
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.13E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg00465413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.01E-02; Z-score:-5.09E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg13162609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.49E-02; Z-score:-8.16E-01
Methylation in Case	9.26E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Renal cell carcinoma[ ICD-11:2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	5'UTR (cg01697623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:3.21E-02; Z-score:-4.62E-01
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.80E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg16180531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:2.39E-03; Z-score:5.89E-01
Methylation in Case	1.29E-01 (Median)	Methylation in Control	1.13E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:2.43E-10; Z-score:-2.91E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	Body (cg16405768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:2.43E-08; Z-score:-2.32E+00
Methylation in Case	8.93E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	Body (cg00465413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:6.13E-06; Z-score:-2.06E+00
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.34E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	Body (cg10601171)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:7.53E-05; Z-score:-1.02E+00
Methylation in Case	8.19E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	Body (cg13162609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.04E-04; Z-score:-2.15E+00
Methylation in Case	9.24E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	Body (cg21034324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.16E+00	Statistic Test	p-value:8.36E-03; Z-score:-9.13E-01
Methylation in Case	6.43E-01 (Median)	Methylation in Control	7.48E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in colorectal cancer			[ 5 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.21E+00	Statistic Test	p-value:6.89E-10; Z-score:-2.37E+00
Methylation in Case	7.28E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg04011829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:6.65E-05; Z-score:-2.28E+00
Methylation in Case	4.14E-01 (Median)	Methylation in Control	5.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg06479426)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:7.47E-05; Z-score:1.20E+00
Methylation in Case	8.60E-02 (Median)	Methylation in Control	6.65E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg26912312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:9.50E-05; Z-score:1.23E+00
Methylation in Case	9.02E-02 (Median)	Methylation in Control	7.46E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg05118482)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.85E+00	Statistic Test	p-value:3.56E-13; Z-score:6.14E+00
Methylation in Case	3.83E-01 (Median)	Methylation in Control	1.35E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.66E+00	Statistic Test	p-value:1.20E-08; Z-score:-3.13E+00
Methylation in Case	2.61E-01 (Median)	Methylation in Control	4.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg22744368)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.14E+00	Statistic Test	p-value:1.30E-02; Z-score:3.09E-01
Methylation in Case	5.28E-02 (Median)	Methylation in Control	4.62E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg14796370)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.72E+00	Statistic Test	p-value:6.37E-06; Z-score:1.57E+00
Methylation in Case	4.10E-02 (Median)	Methylation in Control	2.38E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg26065534)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.49E+00	Statistic Test	p-value:3.17E-17; Z-score:-3.61E+00
Methylation in Case	5.30E-01 (Median)	Methylation in Control	7.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg18145189)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:6.45E-11; Z-score:-6.18E+00
Methylation in Case	7.27E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg00966749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:1.87E-10; Z-score:-8.61E+00
Methylation in Case	6.50E-01 (Median)	Methylation in Control	8.29E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg05134013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:1.24E-08; Z-score:-4.48E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	9.79E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLCO4A1 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13162609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:1.11E-05; Z-score:-1.01E+00
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	5'UTR (cg05381729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:8.39E-06; Z-score:-1.07E+00
Methylation in Case	6.87E-01 (Median)	Methylation in Control	7.25E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	5'UTR (cg00152041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.23E-02; Z-score:6.03E-01
Methylation in Case	2.03E-01 (Median)	Methylation in Control	1.80E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	5'UTR (cg26912312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.24E-02; Z-score:3.41E-01
Methylation in Case	7.15E-02 (Median)	Methylation in Control	6.71E-02 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:2.94E-05; Z-score:1.62E+00
Methylation in Case	3.02E-01 (Median)	Methylation in Control	2.36E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.24E-05; Z-score:6.74E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	Body (cg10601171)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.26E-03; Z-score:-1.05E+00
Methylation in Case	7.49E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	Body (cg00465413)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.01E+00	Statistic Test	p-value:1.83E-02; Z-score:4.22E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	Body (cg21034324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.84E-02; Z-score:-4.78E-01
Methylation in Case	7.74E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in HIV infection			[ 7 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.76E+00	Statistic Test	p-value:1.10E-10; Z-score:3.33E+00
Methylation in Case	6.99E-01 (Median)	Methylation in Control	3.98E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg01697623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:5.55E-04; Z-score:1.72E+00
Methylation in Case	8.26E-01 (Median)	Methylation in Control	7.67E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg12043732)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:5.67E-03; Z-score:4.35E+00
Methylation in Case	6.91E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg05381729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:3.55E-02; Z-score:-1.07E+00
Methylation in Case	6.34E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:1.91E-02; Z-score:-1.53E+00
Methylation in Case	4.59E-01 (Median)	Methylation in Control	5.74E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in lung adenocarcinoma			[ 8 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.93E-02; Z-score:-1.15E+00
Methylation in Case	7.39E-01 (Median)	Methylation in Control	7.69E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg16897885)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.16E+00	Statistic Test	p-value:2.93E-10; Z-score:9.23E-01
Methylation in Case	6.05E-02 (Median)	Methylation in Control	5.21E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg02505749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.99E+00	Statistic Test	p-value:1.89E-15; Z-score:3.19E+00
Methylation in Case	5.25E-01 (Median)	Methylation in Control	1.76E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg21442626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:5.51E-09; Z-score:-1.73E+00
Methylation in Case	3.64E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg22764341)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.22E+00	Statistic Test	p-value:3.92E-02; Z-score:5.86E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	8.72E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg10068408)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.08E-06; Z-score:-1.01E+00
Methylation in Case	6.36E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg25580254)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.74E+00	Statistic Test	p-value:1.70E-05; Z-score:-8.77E-01
Methylation in Case	8.78E-02 (Median)	Methylation in Control	1.52E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg17958577)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:9.59E-09; Z-score:1.47E+00
Methylation in Case	7.73E-01 (Median)	Methylation in Control	7.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in papillary thyroid cancer			[ 10 ]
Location	5'UTR (cg04011829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.28E+00	Statistic Test	p-value:1.84E-06; Z-score:1.40E+00
Methylation in Case	4.75E-01 (Median)	Methylation in Control	3.71E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in papillary thyroid cancer			[ 10 ]
Location	5'UTR (cg05381729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:5.20E-03; Z-score:-3.53E-01
Methylation in Case	7.65E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg09210315)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.14E+00	Statistic Test	p-value:1.73E-07; Z-score:-1.19E+00
Methylation in Case	5.64E-01 (Median)	Methylation in Control	6.43E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in papillary thyroid cancer			[ 10 ]
Location	Body (cg09183468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:4.34E-03; Z-score:4.61E-01
Methylation in Case	8.41E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in papillary thyroid cancer			[ 10 ]
Location	3'UTR (cg05327789)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.52E-02; Z-score:-8.83E-01
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in systemic lupus erythematosus			[ 11 ]
Location	5'UTR (cg04011829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:3.03E-03; Z-score:-2.83E-01
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in systemic lupus erythematosus			[ 11 ]
Location	5'UTR (cg00152041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:6.86E-03; Z-score:-1.67E-01
Methylation in Case	2.95E-01 (Median)	Methylation in Control	3.04E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in systemic lupus erythematosus			[ 11 ]
Location	5'UTR (cg26912312)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:9.74E-03; Z-score:-2.23E-01
Methylation in Case	8.84E-02 (Median)	Methylation in Control	9.18E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg21034324)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.99E-03; Z-score:-2.59E-01
Methylation in Case	7.81E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in celiac disease			[ 12 ]
Location	TSS1500 (cg16180531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.69E+00	Statistic Test	p-value:3.83E-02; Z-score:1.47E+00
Methylation in Case	6.10E-02 (Median)	Methylation in Control	3.60E-02 (Median)
Studied Phenotype	Celiac disease[ ICD-11:DA95]
Experimental Material	Patient tissue samples
Colon cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	TSS1500 (cg18624900)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.08E+00	Statistic Test	p-value:1.67E-10; Z-score:3.85E+00
Methylation in Case	5.30E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	TSS1500 (cg14161359)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.34E+00	Statistic Test	p-value:2.94E-05; Z-score:1.93E+00
Methylation in Case	5.02E-01 (Median)	Methylation in Control	3.74E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	TSS1500 (cg03699904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:1.15E-04; Z-score:-2.46E+00
Methylation in Case	2.69E-01 (Median)	Methylation in Control	3.59E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	TSS1500 (cg13800769)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.28E+00	Statistic Test	p-value:1.54E-04; Z-score:-1.39E+00
Methylation in Case	3.97E-01 (Median)	Methylation in Control	5.10E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	TSS1500 (cg07827943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.47E+00	Statistic Test	p-value:2.93E-03; Z-score:4.65E+00
Methylation in Case	2.99E-01 (Median)	Methylation in Control	2.04E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	TSS200 (cg18158438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.23E+00	Statistic Test	p-value:1.33E-04; Z-score:-7.63E-01
Methylation in Case	2.62E-01 (Median)	Methylation in Control	3.23E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in colon adenocarcinoma			[ 13 ]
Location	Body (cg23368787)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.09E+00	Statistic Test	p-value:1.18E-05; Z-score:1.51E+00
Methylation in Case	6.20E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Colon cancer[ ICD-11:2B90]
Experimental Material	Patient tissue samples
Prostate cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	TSS1500 (cg24325996)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.25E+00	Statistic Test	p-value:1.29E-03; Z-score:4.09E+00
Methylation in Case	6.76E-01 (Median)	Methylation in Control	5.40E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	TSS1500 (cg05331214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.78E+00	Statistic Test	p-value:4.00E-02; Z-score:-9.33E+00
Methylation in Case	4.40E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	TSS1500 (cg15490596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.15E-02; Z-score:3.59E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	8.24E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	1stExon (cg14736210)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:1.31E-02; Z-score:2.65E+00
Methylation in Case	9.31E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	Body (cg12204395)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:9.51E-03; Z-score:2.45E+00
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	Body (cg02557110)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.10E+00	Statistic Test	p-value:3.12E-02; Z-score:2.94E+00
Methylation in Case	8.69E-01 (Median)	Methylation in Control	7.91E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	Body (cg10872847)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.05E+00	Statistic Test	p-value:3.67E-02; Z-score:2.57E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	Body (cg16738646)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.34E+00	Statistic Test	p-value:3.79E-02; Z-score:-1.82E+00
Methylation in Case	3.43E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLCO4A1 in prostate cancer			[ 14 ]
Location	3'UTR (cg19086001)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.08E+00	Statistic Test	p-value:4.28E-02; Z-score:1.73E+00
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLCO4A1 in panic disorder			[ 15 ]
Location	TSS200 (cg25222263)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:9.78E-01	Statistic Test	p-value:6.04E-03; Z-score:6.64E-01
Methylation in Case	-5.86E+00 (Median)	Methylation in Control	-5.99E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	let-7e directly targets SLCO4A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	let-7e	miRNA Mature ID	let-7e-5p
miRNA Sequence	UGAGGUAGGAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	miR-335 directly targets SLCO4A1			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-92b directly targets SLCO4A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-92b	miRNA Mature ID	miR-92b-3p
miRNA Sequence	UAUUGCACUCGUCCCGGCCUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
13	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
17	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence