General Information of Drug Transporter (DT)
DT ID DTD0501 Transporter Info
Gene Name SLCO3A1
Transporter Name Organic anion transporting polypeptide 3A1
Gene ID
28232
UniProt ID
Q9UIG8
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg18841298)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.43E+00 Statistic Test p-value:7.84E-13; Z-score:-3.70E+00

Methylation in Case

4.50E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO3A1 in hepatocellular carcinoma [ 1 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.08E-03; Z-score:-3.08E-01

Methylation in Case

7.61E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Prostate cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in prostate cancer [ 2 ]

Location

Body (cg19604369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.17E-02; Z-score:1.63E+00

Methylation in Case

9.39E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in atypical teratoid rhabdoid tumor [ 3 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:6.63E-11; Z-score:-1.95E+00

Methylation in Case

7.31E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in bladder cancer [ 4 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:1.46E-06; Z-score:-5.84E+00

Methylation in Case

5.50E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in breast cancer [ 5 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.73E-09; Z-score:-1.68E+00

Methylation in Case

6.70E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in colorectal cancer [ 6 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.05E-05; Z-score:-1.40E+00

Methylation in Case

8.62E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in HIV infection [ 7 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.62E-04; Z-score:-9.74E-01

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO3A1 in lung adenocarcinoma [ 8 ]

Location

3'UTR (cg15841533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.09E-02; Z-score:-1.31E+00

Methylation in Case

7.72E-01 (Median) Methylation in Control 8.05E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Prostate cancer metastasis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypomethylation of SLCO3A1 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.020323556; Fold-change:-0.350823086; Z-score:-19.45993038
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

microRNA

  Unclear Phenotype

         58 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

let-7e directly targets SLCO3A1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-103a directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-107 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-107 miRNA Mature ID miR-107

miRNA Sequence

AGCAGCAUUGUACAGGGCUAUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1224 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-1470 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1470 miRNA Mature ID miR-1470

miRNA Sequence

GCCCUCCGCCCGUGCACCCCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-149 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-149 miRNA Mature ID miR-149-5p

miRNA Sequence

UCUGGCUCCGUGUCUUCACUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-15a directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-15b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-16 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-181b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-181b miRNA Mature ID miR-181b-3p

miRNA Sequence

CUCACUGAACAAUGAAUGCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-192 directly targets SLCO3A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-195 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-1972 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-210 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-210 miRNA Mature ID miR-210-3p

miRNA Sequence

CUGUGCGUGUGACAGCGGCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-215 directly targets SLCO3A1 [ 11 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-218-1 directly targets SLCO3A1 [ 9 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-218-1 miRNA Mature ID miR-218-1-3p

miRNA Sequence

AUGGUUCCGUCAAGCACCAUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon17

miR-3150b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3150b miRNA Mature ID miR-3150b-3p

miRNA Sequence

UGAGGAGAUCGUCGAGGUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-330 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-370 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-370 miRNA Mature ID miR-370-5p

miRNA Sequence

CAGGUCACGUCUCUGCAGUUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-371a directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

ACUCAAACUGUGGGGGCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-371b directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-372 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-373 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-374b directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-374b miRNA Mature ID miR-374b-3p

miRNA Sequence

CUUAGCAGGUUGUAUUAUCAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-3907 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3907 miRNA Mature ID miR-3907

miRNA Sequence

AGGUGCUCCAGGCUGGCUCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon26

miR-3919 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3919 miRNA Mature ID miR-3919

miRNA Sequence

GCAGAGAACAAAGGACUCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-3974 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3974 miRNA Mature ID miR-3974

miRNA Sequence

AAAGGUCAUUGUAAGGUUAAUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-424 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-424 miRNA Mature ID miR-424-5p

miRNA Sequence

CAGCAGCAAUUCAUGUUUUGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-4264 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4264 miRNA Mature ID miR-4264

miRNA Sequence

ACUCAGUCAUGGUCAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-4420 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4420 miRNA Mature ID miR-4420

miRNA Sequence

GUCACUGAUGUCUGUAGCUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-4635 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4635 miRNA Mature ID miR-4635

miRNA Sequence

UCUUGAAGUCAGAACCCGCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-4650 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4650 miRNA Mature ID miR-4650-5p

miRNA Sequence

UCAGGCCUCUUUCUACCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-4689 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4689 miRNA Mature ID miR-4689

miRNA Sequence

UUGAGGAGACAUGGUGGGGGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-4756 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4756 miRNA Mature ID miR-4756-3p

miRNA Sequence

CCAGAGAUGGUUGCCUUCCUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-4768 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-4784 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4784 miRNA Mature ID miR-4784

miRNA Sequence

UGAGGAGAUGCUGGGACUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-497 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-497 miRNA Mature ID miR-497-5p

miRNA Sequence

CAGCAGCACACUGUGGUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-548ae directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548ae miRNA Mature ID miR-548ae-3p

miRNA Sequence

CAAAAACUGCAAUUACUUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-548ah directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548ah miRNA Mature ID miR-548ah-3p

miRNA Sequence

CAAAAACUGCAGUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-548aj directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548aj miRNA Mature ID miR-548aj-3p

miRNA Sequence

UAAAAACUGCAAUUACUUUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-548am directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548am miRNA Mature ID miR-548am-3p

miRNA Sequence

CAAAAACUGCAGUUACUUUUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-548aq directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548aq miRNA Mature ID miR-548aq-3p

miRNA Sequence

CAAAAACUGCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-548j directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548j miRNA Mature ID miR-548j-3p

miRNA Sequence

CAAAAACUGCAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-548x directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-548x miRNA Mature ID miR-548x-3p

miRNA Sequence

UAAAAACUGCAAUUACUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-5582 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5582 miRNA Mature ID miR-5582-3p

miRNA Sequence

UAAAACUUUAAGUGUGCCUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-616 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-622 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-622 miRNA Mature ID miR-622

miRNA Sequence

ACAGUCUGCUGAGGUUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-6758 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6758 miRNA Mature ID miR-6758-5p

miRNA Sequence

UAGAGAGGGGAAGGAUGUGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-6765 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6765 miRNA Mature ID miR-6765-3p

miRNA Sequence

UCACCUGGCUGGCCCGCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-6809 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6809 miRNA Mature ID miR-6809-3p

miRNA Sequence

CUUCUCUUCUCUCCUUCCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-6833 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-6838 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6838 miRNA Mature ID miR-6838-5p

miRNA Sequence

AAGCAGCAGUGGCAAGACUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-6856 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6856 miRNA Mature ID miR-6856-5p

miRNA Sequence

AAGAGAGGAGCAGUGGUGCUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-6858 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6858 miRNA Mature ID miR-6858-5p

miRNA Sequence

GUGAGGAGGGGCUGGCAGGGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-6873 directly targets SLCO3A1 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-6887 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-874 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-874 miRNA Mature ID miR-874-5p

miRNA Sequence

CGGCCCCACGCACCAGGGUAAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-933 directly targets SLCO3A1 [ 10 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-933 miRNA Mature ID miR-933

miRNA Sequence

UGUGCGCAGGGAGACCUCUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
4 DNA Methylation Dynamics in Urological Tumors.
5 Genome-wide Scan for Methylation Profiles in Breast Cancer
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
10 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
11 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.