General Information of Drug Transporter (DT)
DT ID DTD0500 Transporter Info
Gene Name SLCO2A1
Transporter Name Organic anion transporting polypeptide 2A1
Gene ID
6578
UniProt ID
Q92959
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

5'UTR (cg05439503)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:1.01E-14; Z-score:-1.80E+00

Methylation in Case

5.00E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg10935723)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:1.14E-12; Z-score:-3.30E+00

Methylation in Case

4.88E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg07780818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:5.70E-04; Z-score:2.67E-01

Methylation in Case

1.43E-01 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:1.45E-03; Z-score:7.94E-01

Methylation in Case

2.73E-01 (Median) Methylation in Control 2.49E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

1stExon (cg06654103)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:6.66E-16; Z-score:-9.72E+00

Methylation in Case

5.91E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg12582965)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.65E+00 Statistic Test p-value:9.31E-19; Z-score:-5.32E+00

Methylation in Case

4.53E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg23210852)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.70E+00 Statistic Test p-value:1.49E-13; Z-score:2.01E+00

Methylation in Case

4.29E-01 (Median) Methylation in Control 2.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg11666857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:3.21E-11; Z-score:-3.01E+00

Methylation in Case

5.56E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg10577586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:5.26E-08; Z-score:-2.37E+00

Methylation in Case

6.69E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg17806191)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.40E-06; Z-score:-7.68E-01

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg07562926)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:2.86E-06; Z-score:-1.14E+00

Methylation in Case

6.65E-01 (Median) Methylation in Control 7.19E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg10351795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:9.86E-06; Z-score:-1.17E+00

Methylation in Case

7.40E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:5.33E-05; Z-score:-9.24E-01

Methylation in Case

6.99E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

Body (cg22822824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:3.62E-04; Z-score:2.54E-01

Methylation in Case

8.61E-02 (Median) Methylation in Control 7.80E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLCO2A1 in hepatocellular carcinoma [ 1 ]

Location

3'UTR (cg03988700)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.07E+00 Statistic Test p-value:3.57E-19; Z-score:-5.23E+00

Methylation in Case

2.86E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

5'UTR (cg04349243)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.30E-04; Z-score:-2.62E-01

Methylation in Case

3.11E-01 (Median) Methylation in Control 3.18E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg13417268)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.92E+00 Statistic Test p-value:1.28E-05; Z-score:1.22E+00

Methylation in Case

1.78E-01 (Median) Methylation in Control 9.28E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg24040450)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.30E-04; Z-score:-7.00E-01

Methylation in Case

6.88E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS1500 (cg02260363)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:6.76E-03; Z-score:8.23E-01

Methylation in Case

3.79E-01 (Median) Methylation in Control 3.46E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg27634724)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.51E-05; Z-score:-9.62E-01

Methylation in Case

1.61E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

TSS200 (cg09962807)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.98E-03; Z-score:1.54E-01

Methylation in Case

6.19E-02 (Median) Methylation in Control 6.00E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg14474561)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:1.68E-09; Z-score:-1.30E+00

Methylation in Case

4.09E-01 (Median) Methylation in Control 4.73E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg01103582)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.14E-09; Z-score:1.93E+00

Methylation in Case

7.36E-01 (Median) Methylation in Control 6.49E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg04470085)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.02E-05; Z-score:-7.35E-01

Methylation in Case

8.46E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg16463165)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:4.86E-05; Z-score:1.23E+00

Methylation in Case

6.82E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

Body (cg09978546)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.01E-03; Z-score:8.94E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLCO2A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

3'UTR (cg20061812)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:8.16E-03; Z-score:-6.55E-01

Methylation in Case

7.57E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:2.36E-04; Z-score:-5.21E+00

Methylation in Case

1.30E-01 (Median) Methylation in Control 1.82E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg17065011)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:5.41E-12; Z-score:-1.08E+01

Methylation in Case

4.32E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.98E+00 Statistic Test p-value:7.93E-12; Z-score:-2.84E+01

Methylation in Case

3.62E-01 (Median) Methylation in Control 7.17E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg11282353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.06E+00 Statistic Test p-value:6.95E-07; Z-score:-6.62E+00

Methylation in Case

1.06E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg10577586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.81E-05; Z-score:-6.06E+00

Methylation in Case

6.03E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg16854533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:9.80E-05; Z-score:-3.53E+00

Methylation in Case

4.35E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg07562926)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.55E+00 Statistic Test p-value:1.69E-04; Z-score:-4.06E+00

Methylation in Case

3.98E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg17806191)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.59E-03; Z-score:-2.18E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg10351795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:4.39E-03; Z-score:-1.22E+00

Methylation in Case

6.75E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg17858406)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.22E-02; Z-score:-2.11E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLCO2A1 in bladder cancer [ 3 ]

Location

Body (cg20388916)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:3.63E-02; Z-score:-2.04E+00

Methylation in Case

7.12E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         14 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

TSS1500 (cg07780818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:6.23E-04; Z-score:7.96E-01

Methylation in Case

1.11E-01 (Median) Methylation in Control 9.12E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:2.17E-03; Z-score:8.16E-01

Methylation in Case

2.41E-01 (Median) Methylation in Control 2.05E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg11282353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.16E+00 Statistic Test p-value:1.65E-15; Z-score:-2.39E+00

Methylation in Case

2.06E-01 (Median) Methylation in Control 4.45E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg20388916)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:1.07E-11; Z-score:-2.31E+00

Methylation in Case

6.26E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg10577586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:9.56E-06; Z-score:-1.12E+00

Methylation in Case

6.76E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.04E-05; Z-score:-1.17E+00

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg10351795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:3.68E-04; Z-score:-8.16E-01

Methylation in Case

7.09E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg14955235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.24E-04; Z-score:-8.81E-01

Methylation in Case

6.57E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg17065011)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:8.60E-04; Z-score:-9.63E-01

Methylation in Case

4.83E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg16854533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.16E-03; Z-score:-7.57E-01

Methylation in Case

4.48E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg07708788)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:9.65E-03; Z-score:5.28E-01

Methylation in Case

7.14E-02 (Median) Methylation in Control 6.23E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg17858406)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:9.75E-03; Z-score:-3.79E-01

Methylation in Case

9.09E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg25598319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:2.08E-02; Z-score:-5.09E-01

Methylation in Case

1.04E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLCO2A1 in breast cancer [ 4 ]

Location

Body (cg07562926)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.32E-02; Z-score:3.94E-01

Methylation in Case

5.24E-01 (Median) Methylation in Control 4.86E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.54E+00 Statistic Test p-value:8.48E-06; Z-score:1.63E+00

Methylation in Case

2.03E-01 (Median) Methylation in Control 1.33E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in clear cell renal cell carcinoma [ 5 ]

Location

TSS1500 (cg07780818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:5.60E-03; Z-score:3.46E-01

Methylation in Case

4.63E-02 (Median) Methylation in Control 3.68E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg07708788)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:2.09E-02; Z-score:4.45E-01

Methylation in Case

3.22E-02 (Median) Methylation in Control 2.66E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg25598319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.19E-02; Z-score:2.95E-01

Methylation in Case

4.92E-02 (Median) Methylation in Control 4.35E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg02496728)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.47E-02; Z-score:2.07E-01

Methylation in Case

2.04E-02 (Median) Methylation in Control 1.87E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in clear cell renal cell carcinoma [ 5 ]

Location

Body (cg22822824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.52E-02; Z-score:2.55E-01

Methylation in Case

3.22E-02 (Median) Methylation in Control 3.14E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in colon adenocarcinoma [ 6 ]

Location

TSS1500 (cg23642392)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.38E+00 Statistic Test p-value:6.40E-06; Z-score:-3.90E+00

Methylation in Case

4.88E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in colon adenocarcinoma [ 6 ]

Location

TSS200 (cg09710316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.08E-03; Z-score:-1.64E+00

Methylation in Case

7.31E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in colon adenocarcinoma [ 6 ]

Location

Body (cg22579691)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:9.05E-04; Z-score:1.88E+00

Methylation in Case

7.50E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in colon adenocarcinoma [ 6 ]

Location

Body (cg14122373)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:3.27E-03; Z-score:1.07E+00

Methylation in Case

6.26E-01 (Median) Methylation in Control 5.51E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:1.84E-07; Z-score:1.39E+00

Methylation in Case

3.53E-01 (Median) Methylation in Control 2.80E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

TSS1500 (cg07780818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:7.43E-05; Z-score:6.22E-01

Methylation in Case

2.06E-01 (Median) Methylation in Control 1.89E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg17065011)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:9.09E-08; Z-score:-1.73E+00

Methylation in Case

6.98E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg10577586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.41E-07; Z-score:-2.75E+00

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg16854533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:3.67E-07; Z-score:-2.08E+00

Methylation in Case

8.30E-01 (Median) Methylation in Control 8.89E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.42E-05; Z-score:-1.08E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg11282353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:1.17E-04; Z-score:-1.52E+00

Methylation in Case

2.55E-01 (Median) Methylation in Control 3.55E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg14955235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.27E-04; Z-score:-6.51E-01

Methylation in Case

8.09E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg07562926)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.03E-03; Z-score:-7.09E-01

Methylation in Case

8.49E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg25598319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.13E-03; Z-score:3.91E-01

Methylation in Case

2.32E-01 (Median) Methylation in Control 2.17E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLCO2A1 in colorectal cancer [ 7 ]

Location

Body (cg22822824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.81E-02; Z-score:4.40E-01

Methylation in Case

4.06E-02 (Median) Methylation in Control 3.76E-02 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

TSS1500 (cg07780818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.28E+00 Statistic Test p-value:5.61E-04; Z-score:1.14E+00

Methylation in Case

1.75E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg17806191)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.92E-07; Z-score:9.79E-01

Methylation in Case

9.33E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg14955235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:6.37E-07; Z-score:-2.50E+00

Methylation in Case

6.86E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg20388916)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:1.20E-05; Z-score:-2.39E+00

Methylation in Case

7.07E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg10577586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:9.59E-04; Z-score:-1.34E+00

Methylation in Case

7.09E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg02496728)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:2.45E-03; Z-score:9.98E-01

Methylation in Case

5.43E-02 (Median) Methylation in Control 3.29E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg07708788)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:4.34E-03; Z-score:8.70E-01

Methylation in Case

9.82E-02 (Median) Methylation in Control 8.09E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg07562926)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.55E-02; Z-score:-1.07E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg17065011)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.24E-02; Z-score:3.52E-01

Methylation in Case

6.21E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLCO2A1 in HIV infection [ 8 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.08E-02; Z-score:5.92E-01

Methylation in Case

6.98E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:3.22E-03; Z-score:2.39E+00

Methylation in Case

3.26E-01 (Median) Methylation in Control 2.59E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

TSS1500 (cg07780818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:8.05E-03; Z-score:2.85E+00

Methylation in Case

2.14E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

Body (cg20388916)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.98E-03; Z-score:-2.39E+00

Methylation in Case

6.68E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

Body (cg02496728)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.58E+00 Statistic Test p-value:1.17E-02; Z-score:4.81E+00

Methylation in Case

1.33E-01 (Median) Methylation in Control 5.17E-02 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

Body (cg07708788)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.54E+00 Statistic Test p-value:1.66E-02; Z-score:3.54E+00

Methylation in Case

1.57E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

Body (cg14955235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.16E-02; Z-score:-2.16E+00

Methylation in Case

6.99E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in lung adenocarcinoma [ 9 ]

Location

Body (cg25598319)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.30E+00 Statistic Test p-value:3.17E-02; Z-score:3.04E+00

Methylation in Case

2.17E-01 (Median) Methylation in Control 1.67E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg05430989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.23E+00 Statistic Test p-value:2.10E-03; Z-score:6.90E-01

Methylation in Case

1.14E-01 (Median) Methylation in Control 9.24E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in papillary thyroid cancer [ 10 ]

Location

Body (cg16854533)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:2.21E-09; Z-score:-1.49E+00

Methylation in Case

5.99E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in papillary thyroid cancer [ 10 ]

Location

Body (cg17806191)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.65E-08; Z-score:9.90E-01

Methylation in Case

7.40E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in papillary thyroid cancer [ 10 ]

Location

Body (cg14955235)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.09E-04; Z-score:1.40E+00

Methylation in Case

7.78E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in papillary thyroid cancer [ 10 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.00E-02; Z-score:1.04E+00

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in prostate cancer [ 11 ]

Location

TSS1500 (cg05483509)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.64E+00 Statistic Test p-value:2.62E-05; Z-score:8.73E+00

Methylation in Case

4.68E-01 (Median) Methylation in Control 1.77E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in prostate cancer [ 11 ]

Location

TSS200 (cg15244223)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:8.17E-03; Z-score:-2.22E+00

Methylation in Case

3.41E-02 (Median) Methylation in Control 5.01E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in prostate cancer [ 11 ]

Location

Body (cg08789022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.29E+00 Statistic Test p-value:1.16E-04; Z-score:6.58E+00

Methylation in Case

5.46E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in prostate cancer [ 11 ]

Location

Body (cg04969220)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:1.78E-02; Z-score:-2.82E+00

Methylation in Case

5.20E-01 (Median) Methylation in Control 7.30E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg02496728)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.67E-04; Z-score:7.60E-01

Methylation in Case

8.38E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:9.84E-04; Z-score:4.44E-01

Methylation in Case

1.81E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07562926)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.36E-03; Z-score:9.41E-01

Methylation in Case

8.10E-01 (Median) Methylation in Control 7.30E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07708788)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:4.91E-03; Z-score:5.83E-01

Methylation in Case

1.67E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg10351795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:1.43E-02; Z-score:7.53E-01

Methylation in Case

8.75E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg10577586)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.55E-02; Z-score:4.96E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLCO2A1 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg11282353)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.08E-02; Z-score:6.41E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in panic disorder [ 13 ]

Location

Body (cg20388916)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:4.95E-03; Z-score:3.75E-01

Methylation in Case

2.39E+00 (Median) Methylation in Control 2.23E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in panic disorder [ 13 ]

Location

Body (cg17858406)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.80E-02; Z-score:5.13E-01

Methylation in Case

3.12E+00 (Median) Methylation in Control 3.01E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLCO2A1 in systemic lupus erythematosus [ 14 ]

Location

Body (cg04900941)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.22E-03; Z-score:4.23E-01

Methylation in Case

7.36E-01 (Median) Methylation in Control 7.12E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLCO2A1 in systemic lupus erythematosus [ 14 ]

Location

Body (cg10351795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:9.34E-03; Z-score:-2.38E-01

Methylation in Case

7.32E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLCO2A1 in systemic lupus erythematosus [ 14 ]

Location

Body (cg17065011)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.04E-02; Z-score:-1.20E-01

Methylation in Case

6.56E-01 (Median) Methylation in Control 6.61E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLCO2A1 in systemic lupus erythematosus [ 14 ]

Location

Body (cg17806191)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.70E-02; Z-score:-8.64E-02

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Lymphoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLCO2A1 in lymphoma than that in healthy individual

Studied Phenotype

Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.08E-39; Fold-change:0.613891859; Z-score:10.4118041
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLCO2A1 in gastric cancer than that in adjacent tissue

Studied Phenotype

Gastric cancer [ICD-11:2B72]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:1.44E-32; Fold-change:0.204052614; Z-score:32.9721226
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-181a directly targets SLCO2A1 [ 15 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.