General Information of Drug Transporter (DT)
DT ID DTD0491 Transporter Info
Gene Name SLC9A7
Transporter Name Sodium/hydrogen exchanger 7
Gene ID
84679
UniProt ID
Q96T83
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

TSS1500 (cg26811602)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:8.39E-03; Z-score:4.07E-01

Methylation in Case

5.63E-02 (Median) Methylation in Control 5.25E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

TSS1500 (cg12373280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.24E-02; Z-score:7.22E-01

Methylation in Case

1.16E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

TSS200 (cg17639056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:Inf Statistic Test p-value:5.00E-03; Z-score:2.99E+00

Methylation in Case

3.81E-03 (Median) Methylation in Control 0.00E+00 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

TSS200 (cg04027312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:6.12E-03; Z-score:-9.72E-02

Methylation in Case

1.31E-02 (Median) Methylation in Control 1.36E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

TSS200 (cg17404000)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.85E-02; Z-score:1.18E+00

Methylation in Case

1.61E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

1stExon (cg18799866)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.03E-02; Z-score:-1.28E-01

Methylation in Case

5.41E-02 (Median) Methylation in Control 5.54E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

Body (cg23572455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.74E+00 Statistic Test p-value:1.17E-10; Z-score:-9.69E+00

Methylation in Case

2.40E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC9A7 in bladder cancer [ 1 ]

Location

Body (cg07343739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:3.24E-04; Z-score:-2.66E+00

Methylation in Case

4.42E-01 (Median) Methylation in Control 5.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in breast cancer [ 2 ]

Location

TSS1500 (cg12373280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:3.71E-05; Z-score:1.19E+00

Methylation in Case

4.10E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A7 in breast cancer [ 2 ]

Location

TSS1500 (cg26068514)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:8.16E-04; Z-score:9.95E-01

Methylation in Case

3.43E-01 (Median) Methylation in Control 2.90E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A7 in breast cancer [ 2 ]

Location

TSS1500 (cg26811602)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:3.80E-02; Z-score:5.02E-01

Methylation in Case

4.39E-01 (Median) Methylation in Control 3.92E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A7 in breast cancer [ 2 ]

Location

Body (cg23572455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:5.16E-18; Z-score:-2.48E+00

Methylation in Case

4.01E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A7 in breast cancer [ 2 ]

Location

Body (cg06128881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.14E-03; Z-score:-5.41E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC9A7 in breast cancer [ 2 ]

Location

Body (cg07343739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.81E-02; Z-score:-4.08E-01

Methylation in Case

5.15E-01 (Median) Methylation in Control 5.32E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in hepatocellular carcinoma [ 3 ]

Location

TSS1500 (cg26068514)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:6.12E-03; Z-score:-7.56E-01

Methylation in Case

1.26E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg08022012)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.17E+00 Statistic Test p-value:3.26E-10; Z-score:-4.99E+00

Methylation in Case

7.01E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A7 in hepatocellular carcinoma [ 3 ]

Location

Body (cg23572455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.45E-02; Z-score:7.50E-01

Methylation in Case

8.05E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg22245858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:1.66E-02; Z-score:6.80E-01

Methylation in Case

6.42E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A7 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg05031424)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:7.81E-08; Z-score:-1.29E+00

Methylation in Case

7.81E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC9A7 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg18065686)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:4.34E-05; Z-score:9.18E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC9A7 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg15053022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.66E-02; Z-score:-6.80E-01

Methylation in Case

3.87E-01 (Median) Methylation in Control 4.57E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC9A7 in pancretic ductal adenocarcinoma [ 4 ]

Location

3'UTR (cg19637461)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:2.16E-04; Z-score:1.22E+00

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.34E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Colorectal cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in colorectal cancer [ 5 ]

Location

Body (cg23572455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.20E-06; Z-score:-1.31E+00

Methylation in Case

6.62E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC9A7 in colorectal cancer [ 5 ]

Location

Body (cg07343739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.07E-04; Z-score:-9.06E-01

Methylation in Case

7.79E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in lung adenocarcinoma [ 6 ]

Location

Body (cg23572455)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:4.21E-02; Z-score:-1.31E+00

Methylation in Case

5.80E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Prostate cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC9A7 in prostate cancer [ 7 ]

Location

Body (cg09050775)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:5.47E-03; Z-score:2.56E+00

Methylation in Case

8.33E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

         43 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1227 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1227 miRNA Mature ID miR-1227-3p

miRNA Sequence

CGUGCCACCCUUUUCCCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-1270 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1270 miRNA Mature ID miR-1270

miRNA Sequence

CUGGAGAUAUGGAAGAGCUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1292 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1292 miRNA Mature ID miR-1292-3p

miRNA Sequence

UCGCGCCCCGGCUCCCGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-196a directly targets SLC9A7 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-196a miRNA Mature ID miR-196a-5p

miRNA Sequence

UAGGUAGUUUCAUGUUGUUGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon5

miR-196b directly targets SLC9A7 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-196b miRNA Mature ID miR-196b-5p

miRNA Sequence

UAGGUAGUUUCCUGUUGUUGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon6

miR-24 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-3180 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3180 miRNA Mature ID miR-3180

miRNA Sequence

UGGGGCGGAGCUUCCGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon8

miR-3180 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3180 miRNA Mature ID miR-3180-3p

miRNA Sequence

UGGGGCGGAGCUUCCGGAGGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-3196 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3196 miRNA Mature ID miR-3196

miRNA Sequence

CGGGGCGGCAGGGGCCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-335 directly targets SLC9A7 [ 12 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-3689d directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-4252 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

GGCCACUGAGUCAGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-4284 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4284 miRNA Mature ID miR-4284

miRNA Sequence

GGGCUCACAUCACCCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-4435 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4435 miRNA Mature ID miR-4435

miRNA Sequence

AUGGCCAGAGCUCACACAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-4438 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

CACAGGCUUAGAAAAGACAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon16

miR-4537 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4537 miRNA Mature ID miR-4537

miRNA Sequence

UGAGCCGAGCUGAGCUUAGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-455 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-5p

miRNA Sequence

UAUGUGCCUUUGGACUACAUCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon18

miR-455 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-4683 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4683 miRNA Mature ID miR-4683

miRNA Sequence

UGGAGAUCCAGUGCUCGCCCGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-4703 directly targets SLC9A7 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4703 miRNA Mature ID miR-4703-3p

miRNA Sequence

UGUAGUUGUAUUGUAUUGCCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

miR-4793 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4793 miRNA Mature ID miR-4793-3p

miRNA Sequence

UCUGCACUGUGAGUUGGCUGGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-508 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-508 miRNA Mature ID miR-508-5p

miRNA Sequence

UACUCCAGAGGGCGUCACUCAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-5186 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5186 miRNA Mature ID miR-5186

miRNA Sequence

AGAGAUUGGUAGAAAUCAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-548m directly targets SLC9A7 [ 10 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548m miRNA Mature ID miR-548m

miRNA Sequence

CAAAGGUAUUUGUGGUUUUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon25

miR-562 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-562 miRNA Mature ID miR-562

miRNA Sequence

AAAGUAGCUGUACCAUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-5697 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5697 miRNA Mature ID miR-5697

miRNA Sequence

UCAAGUAGUUUCAUGAUAAAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-6134 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

UGAGGUGGUAGGAUGUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-620 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-620 miRNA Mature ID miR-620

miRNA Sequence

AUGGAGAUAGAUAUAGAAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-6499 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-6512 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-661 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-661 miRNA Mature ID miR-661

miRNA Sequence

UGCCUGGGUCUCUGGCCUGCGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-665 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-6720 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-6814 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon35

miR-6816 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6816 miRNA Mature ID miR-6816-5p

miRNA Sequence

UGGGGCGGGGCAGGUCCCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-6840 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-6849 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-6851 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-6880 directly targets SLC9A7 [ 9 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-7151 directly targets SLC9A7 [ 8 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-766 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-7703 directly targets SLC9A7 [ 13 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7703 miRNA Mature ID miR-7703

miRNA Sequence

UUGCACUCUGGCCUUCUCCCAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-7977 directly targets SLC9A7 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

UUCCCAGCCAACGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
8 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
9 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
10 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
11 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
12 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
13 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.