Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0490 Transporter Info | ||||
| Gene Name | SLC9A6 | ||||
| Transporter Name | Sodium/hydrogen exchanger 6 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-103a directly targets SLC9A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-103a | miRNA Mature ID | miR-103a-3p | ||
|
miRNA Sequence |
AGCAGCAUUGUACAGGGCUAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon2 |
miR-15a directly targets SLC9A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
|
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-15b directly targets SLC9A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
|
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-16 directly targets SLC9A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-195 directly targets SLC9A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
|
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-19a directly targets SLC9A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-19a | miRNA Mature ID | miR-19a-3p | ||
|
miRNA Sequence |
UGUGCAAAUCUAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-19b directly targets SLC9A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-19b | miRNA Mature ID | miR-19b-3p | ||
|
miRNA Sequence |
UGUGCAAAUCCAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-21 directly targets SLC9A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-21 | miRNA Mature ID | miR-21-5p | ||
|
miRNA Sequence |
UAGCUUAUCAGACUGAUGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
miR-23b directly targets SLC9A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-23b | miRNA Mature ID | miR-23b-3p | ||
|
miRNA Sequence |
AUCACAUUGCCAGGGAUUACCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon10 |
miR-31 directly targets SLC9A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-31 | miRNA Mature ID | miR-31-3p | ||
|
miRNA Sequence |
UGCUAUGCCAACAUAUUGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon11 |
miR-421 directly targets SLC9A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-421 | miRNA Mature ID | miR-421 | ||
|
miRNA Sequence |
AUCAACAGACAUUAAUUGGGCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon12 |
miR-93 directly targets SLC9A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-93 | miRNA Mature ID | miR-93-5p | ||
|
miRNA Sequence |
CAAAGUGCUGUUCGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Methylation |
|||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypomethylation of SLC9A6 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:3.43E-07; Fold-change:-0.284685061; Z-score:-2.965538813 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Pancreatic cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypomethylation of SLC9A6 in pancreatic adenocarcinoma than that in healthy individual | ||||
Studied Phenotype |
Pancreatic cancer [ICD-11:2C10] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.011015246; Fold-change:-0.316572612; Z-score:-6.864886593 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples