Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0483 Transporter Info | ||||
| Gene Name | SLC9A3 | ||||
| Transporter Name | Sodium/hydrogen exchanger 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
46 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg08360771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:2.19E-05; Z-score:-4.05E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg04882188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:9.77E-05; Z-score:-9.03E-01 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg12164612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:1.19E-04; Z-score:1.56E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 3.56E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg20064848) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.16E-04; Z-score:-1.96E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg14019757) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:6.45E-04; Z-score:-6.86E-01 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg06652199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.04E+00 | Statistic Test | p-value:2.07E-07; Z-score:5.56E+00 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 1.41E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg03616221) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.69E+00 | Statistic Test | p-value:1.73E-06; Z-score:5.30E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg27162435) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.48E-05; Z-score:1.15E+00 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg05330297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.52E+00 | Statistic Test | p-value:3.32E-04; Z-score:5.27E+00 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 5.39E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg15773379) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.34E+00 | Statistic Test | p-value:4.18E-03; Z-score:1.40E+00 | ||
|
Methylation in Case |
4.48E-02 (Median) | Methylation in Control | 3.34E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg15026150) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.60E+00 | Statistic Test | p-value:2.44E-06; Z-score:6.60E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 1.59E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg13377102) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:3.23E-05; Z-score:1.09E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg10717290) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.71E+00 | Statistic Test | p-value:9.98E-05; Z-score:5.05E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 1.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg10387551) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:6.51E-04; Z-score:8.38E-01 | ||
|
Methylation in Case |
4.36E-01 (Median) | Methylation in Control | 3.49E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg01663603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:4.12E-03; Z-score:1.15E+00 | ||
|
Methylation in Case |
2.08E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg00289429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:4.68E-03; Z-score:1.38E+00 | ||
|
Methylation in Case |
2.05E-01 (Median) | Methylation in Control | 1.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg26664737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.78E-08; Z-score:-3.10E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19521693) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.62E+00 | Statistic Test | p-value:4.95E-08; Z-score:-3.77E+00 | ||
|
Methylation in Case |
2.77E-01 (Median) | Methylation in Control | 4.47E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24149278) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:8.74E-08; Z-score:-4.59E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 6.19E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15704872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.97E+00 | Statistic Test | p-value:5.34E-07; Z-score:4.94E+00 | ||
|
Methylation in Case |
4.56E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg05418487) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:5.42E-07; Z-score:-1.66E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 2.70E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15572436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:6.48E-07; Z-score:-2.92E+00 | ||
|
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 5.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg26327804) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:8.26E-07; Z-score:4.32E+00 | ||
|
Methylation in Case |
5.61E-01 (Median) | Methylation in Control | 4.24E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13356455) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:8.49E-07; Z-score:-3.80E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg22032364) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:1.65E-06; Z-score:-2.29E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg14404146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.72E-06; Z-score:-2.70E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:4.25E-06; Z-score:-2.16E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02609144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:9.03E-06; Z-score:-1.43E+00 | ||
|
Methylation in Case |
7.72E-02 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19631651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:9.51E-06; Z-score:-2.98E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13110283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:3.20E-05; Z-score:-1.44E+00 | ||
|
Methylation in Case |
3.39E-01 (Median) | Methylation in Control | 4.44E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg25618198) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:1.21E-04; Z-score:-3.52E+00 | ||
|
Methylation in Case |
5.61E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg25910803) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.75E-04; Z-score:3.34E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 5.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg18892212) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.95E-04; Z-score:1.03E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 5.94E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:2.75E-04; Z-score:-2.60E+00 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg07071839) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.40E-04; Z-score:-2.55E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24114651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:3.64E-04; Z-score:-3.46E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00820961) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:5.99E-04; Z-score:-1.42E+00 | ||
|
Methylation in Case |
4.96E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg14561295) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:6.10E-04; Z-score:-2.54E+00 | ||
|
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg06622573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:6.11E-04; Z-score:-2.85E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09407223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:9.58E-04; Z-score:-1.15E+00 | ||
|
Methylation in Case |
5.32E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg22172143) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:1.74E-03; Z-score:-7.43E-01 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 3.48E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg09119043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:2.09E-03; Z-score:-1.02E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11480762) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.51E-03; Z-score:-9.53E-01 | ||
|
Methylation in Case |
4.32E-01 (Median) | Methylation in Control | 4.95E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg07187808) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.90E-03; Z-score:1.02E+00 | ||
|
Methylation in Case |
7.10E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg21318380) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:1.01E-09; Z-score:-2.29E+00 | ||
|
Methylation in Case |
2.32E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of SLC9A3 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg11324504) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.23E-04; Z-score:-1.32E+00 | ||
|
Methylation in Case |
6.31E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
78 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg08180566) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:6.83E-10; Z-score:-4.17E+00 | ||
|
Methylation in Case |
5.70E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg08830672) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.64E-10; Z-score:1.57E+00 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg07052880) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:2.17E-10; Z-score:-7.63E+00 | ||
|
Methylation in Case |
7.00E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg23036025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:8.68E-10; Z-score:-2.00E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg04934807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.90E+00 | Statistic Test | p-value:8.84E-10; Z-score:4.80E+00 | ||
|
Methylation in Case |
2.15E-01 (Median) | Methylation in Control | 1.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg01398050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.60E+00 | Statistic Test | p-value:9.03E-10; Z-score:7.92E+00 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 3.88E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:8.36E-08; Z-score:-3.13E+00 | ||
|
Methylation in Case |
4.27E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg17691545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:2.50E-16; Z-score:-8.48E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.38E+00 | Statistic Test | p-value:1.10E-03; Z-score:7.34E-01 | ||
|
Methylation in Case |
4.90E-02 (Median) | Methylation in Control | 3.55E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.46E-03; Z-score:2.23E-01 | ||
|
Methylation in Case |
5.65E-02 (Median) | Methylation in Control | 5.09E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg01416043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:2.46E-12; Z-score:-7.61E+00 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 9.29E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg12204395) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.06E+00 | Statistic Test | p-value:2.66E-22; Z-score:-8.28E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg07276388) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.84E+00 | Statistic Test | p-value:3.47E-20; Z-score:-3.59E+00 | ||
|
Methylation in Case |
3.31E-01 (Median) | Methylation in Control | 6.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16867817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:1.12E-17; Z-score:-2.70E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01421830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:1.47E-16; Z-score:-4.54E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25202943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.53E+00 | Statistic Test | p-value:3.23E-15; Z-score:-2.95E+00 | ||
|
Methylation in Case |
3.69E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02595575) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.83E+00 | Statistic Test | p-value:1.29E-14; Z-score:2.37E+00 | ||
|
Methylation in Case |
4.56E-01 (Median) | Methylation in Control | 2.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02902412) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:2.56E-14; Z-score:1.56E+00 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13678205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:8.83E-14; Z-score:-3.02E+00 | ||
|
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05686323) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:1.48E-11; Z-score:-1.88E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 5.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15022049) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:3.18E-11; Z-score:-5.68E+00 | ||
|
Methylation in Case |
6.98E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05626764) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.85E+00 | Statistic Test | p-value:1.02E-10; Z-score:7.18E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 3.59E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01746503) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:2.71E-10; Z-score:-3.91E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18101022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.00E+00 | Statistic Test | p-value:1.32E-09; Z-score:3.14E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 1.23E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg22179256) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:1.46E-09; Z-score:-5.62E+00 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.71E-09; Z-score:-5.61E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 9.46E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:2.54E-09; Z-score:-2.33E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.40E-09; Z-score:-4.25E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00190355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:4.87E-09; Z-score:-1.78E+00 | ||
|
Methylation in Case |
2.38E-01 (Median) | Methylation in Control | 3.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:5.53E-09; Z-score:-3.09E+00 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 8.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18666982) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:8.20E-09; Z-score:-1.70E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:1.31E-08; Z-score:-2.83E+00 | ||
|
Methylation in Case |
6.93E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:1.33E-08; Z-score:-2.46E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.27E-08; Z-score:-3.80E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:3.12E-08; Z-score:-2.06E+00 | ||
|
Methylation in Case |
4.29E-01 (Median) | Methylation in Control | 5.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04181066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.56E-08; Z-score:-1.61E+00 | ||
|
Methylation in Case |
4.49E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.56E+00 | Statistic Test | p-value:4.89E-08; Z-score:-2.26E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.04E-07; Z-score:-2.29E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06019590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:1.25E-07; Z-score:-2.14E+00 | ||
|
Methylation in Case |
3.72E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.83E-07; Z-score:-3.28E+00 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.86E-07; Z-score:-6.90E-01 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:3.62E-07; Z-score:-1.94E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:4.28E-07; Z-score:-1.08E+00 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08909608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.35E-07; Z-score:-1.55E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.12E-06; Z-score:-2.02E+00 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg12437197) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.61E-06; Z-score:-1.99E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.72E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.17E+00 | Statistic Test | p-value:1.79E-06; Z-score:-1.74E+00 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 4.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:3.14E-06; Z-score:-1.33E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15640734) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.02E-06; Z-score:-1.72E+00 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.70E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.14E-05; Z-score:-1.54E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.48E-05; Z-score:-9.32E-01 | ||
|
Methylation in Case |
5.43E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.05E-05; Z-score:-7.03E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg25084851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:5.44E-05; Z-score:-1.26E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:5.67E-05; Z-score:-9.30E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg15084390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:6.88E-05; Z-score:4.40E-01 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21625146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.75E-04; Z-score:-1.43E+00 | ||
|
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.39E-04; Z-score:-7.57E-01 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.53E-04; Z-score:-5.17E-01 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.05E-04; Z-score:-1.23E+00 | ||
|
Methylation in Case |
3.79E-01 (Median) | Methylation in Control | 4.79E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:3.52E-04; Z-score:-1.21E+00 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.63E-04; Z-score:-6.93E-01 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13013644) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:5.46E-04; Z-score:-8.16E-01 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:6.01E-04; Z-score:-1.33E+00 | ||
|
Methylation in Case |
5.20E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:7.07E-04; Z-score:-5.26E-01 | ||
|
Methylation in Case |
6.52E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg09434603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:7.79E-04; Z-score:-1.05E+00 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:8.58E-04; Z-score:-7.29E-01 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02689506) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.05E-03; Z-score:2.54E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.39E-03; Z-score:-3.92E-01 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon69 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:3.12E-03; Z-score:-8.84E-01 | ||
|
Methylation in Case |
6.35E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon70 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.73E-03; Z-score:-9.21E-01 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon71 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.32E-03; Z-score:-2.56E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon72 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.02E-02; Z-score:-1.66E-01 | ||
|
Methylation in Case |
1.57E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon73 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.53E-02; Z-score:-3.38E-01 | ||
|
Methylation in Case |
4.40E-02 (Median) | Methylation in Control | 5.12E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon74 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.84E-02; Z-score:5.25E-01 | ||
|
Methylation in Case |
5.16E-01 (Median) | Methylation in Control | 4.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon75 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg18140071) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.30E-02; Z-score:-6.21E-02 | ||
|
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon76 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg03954999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:2.14E-17; Z-score:-5.84E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon77 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg14022794) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.61E+00 | Statistic Test | p-value:3.72E-16; Z-score:-3.34E+00 | ||
|
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 2.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon78 |
Methylation of SLC9A3 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg21880222) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.37E-10; Z-score:-4.13E+00 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
62 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg11964564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.55E+00 | Statistic Test | p-value:3.80E-17; Z-score:1.68E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 7.53E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg04529938) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:4.39E-10; Z-score:-1.49E+00 | ||
|
Methylation in Case |
3.39E-01 (Median) | Methylation in Control | 4.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg23370213) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:6.83E-06; Z-score:7.18E-01 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg09012125) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:1.76E-05; Z-score:1.51E+00 | ||
|
Methylation in Case |
6.65E-01 (Median) | Methylation in Control | 4.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg16314862) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.99E-05; Z-score:-7.81E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg11913615) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:6.76E-04; Z-score:-9.66E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg10328297) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:6.70E-03; Z-score:7.09E-01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg00394021) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:1.95E-02; Z-score:-5.41E-01 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 1.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg16380351) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.38E-02; Z-score:2.75E-01 | ||
|
Methylation in Case |
5.24E-02 (Median) | Methylation in Control | 4.97E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg01879556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.25E-02; Z-score:3.86E-01 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 7.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg25611254) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:4.65E-16; Z-score:-2.59E+00 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 3.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg18624900) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.83E+00 | Statistic Test | p-value:2.13E-15; Z-score:2.13E+00 | ||
|
Methylation in Case |
2.18E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg24924779) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.98E+00 | Statistic Test | p-value:7.84E-13; Z-score:2.63E+00 | ||
|
Methylation in Case |
3.07E-01 (Median) | Methylation in Control | 1.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.96E-09; Z-score:2.05E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 4.23E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg16105558) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:7.32E-08; Z-score:4.30E-01 | ||
|
Methylation in Case |
9.54E-02 (Median) | Methylation in Control | 8.42E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.43E+00 | Statistic Test | p-value:1.28E-07; Z-score:1.00E+00 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 7.76E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg06594281) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.81E+00 | Statistic Test | p-value:1.36E-06; Z-score:-1.68E+00 | ||
|
Methylation in Case |
1.06E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg26263477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.27E-03; Z-score:-4.69E-01 | ||
|
Methylation in Case |
1.06E-01 (Median) | Methylation in Control | 1.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg13411038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.37E-02; Z-score:-4.54E-01 | ||
|
Methylation in Case |
3.55E-02 (Median) | Methylation in Control | 4.01E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg08944080) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.60E-02; Z-score:-5.51E-01 | ||
|
Methylation in Case |
5.28E-02 (Median) | Methylation in Control | 5.78E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg10615414) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:5.49E+00 | Statistic Test | p-value:1.46E-13; Z-score:2.66E+00 | ||
|
Methylation in Case |
3.51E-01 (Median) | Methylation in Control | 6.38E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg03790908) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.53E+00 | Statistic Test | p-value:4.73E-13; Z-score:1.86E+00 | ||
|
Methylation in Case |
8.50E-02 (Median) | Methylation in Control | 5.57E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg06979771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.02E-07; Z-score:1.46E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg13188098) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.37E+00 | Statistic Test | p-value:8.86E-07; Z-score:8.67E-01 | ||
|
Methylation in Case |
3.90E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg03892045) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.26E+00 | Statistic Test | p-value:1.06E-05; Z-score:-1.35E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 3.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg04963424) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:2.37E-04; Z-score:9.38E-01 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 3.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg01050423) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.66E-03; Z-score:-3.76E-01 | ||
|
Methylation in Case |
9.42E-02 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg00917899) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:2.42E-03; Z-score:-7.41E-01 | ||
|
Methylation in Case |
3.19E-02 (Median) | Methylation in Control | 4.19E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg15488402) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:6.40E-03; Z-score:-5.14E-01 | ||
|
Methylation in Case |
7.78E-02 (Median) | Methylation in Control | 8.55E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg22049569) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.85E+00 | Statistic Test | p-value:1.47E-08; Z-score:1.93E+00 | ||
|
Methylation in Case |
2.55E-01 (Median) | Methylation in Control | 5.26E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg08209133) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:6.60E-07; Z-score:5.47E-01 | ||
|
Methylation in Case |
3.16E-01 (Median) | Methylation in Control | 2.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
1stExon (cg13348944) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:7.10E-07; Z-score:1.85E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23475112) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.35E-34; Z-score:-7.50E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20663852) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-4.70E+00 | Statistic Test | p-value:8.65E-16; Z-score:-3.47E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01650904) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.79E+00 | Statistic Test | p-value:1.86E-14; Z-score:2.39E+00 | ||
|
Methylation in Case |
3.90E-01 (Median) | Methylation in Control | 2.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17403817) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.72E-13; Z-score:-1.93E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg26247525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.47E+00 | Statistic Test | p-value:1.06E-10; Z-score:2.04E+00 | ||
|
Methylation in Case |
2.52E-01 (Median) | Methylation in Control | 1.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg04424119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:9.29E-09; Z-score:-1.11E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 5.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09699039) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.82E+00 | Statistic Test | p-value:1.21E-08; Z-score:1.89E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.01E+00 | Statistic Test | p-value:2.03E-08; Z-score:-1.64E+00 | ||
|
Methylation in Case |
2.26E-01 (Median) | Methylation in Control | 4.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08854366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.12E-08; Z-score:1.56E+00 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg05960911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:3.84E-08; Z-score:1.79E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 5.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:3.41E-06; Z-score:-1.28E+00 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg12619347) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:4.52E-06; Z-score:1.38E+00 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 5.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00783525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.17E-05; Z-score:-7.65E-01 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg16194319) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.36E-05; Z-score:4.27E-01 | ||
|
Methylation in Case |
4.84E-02 (Median) | Methylation in Control | 4.52E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg02793415) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.72E-05; Z-score:1.22E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg13720865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.19E-05; Z-score:1.22E+00 | ||
|
Methylation in Case |
6.10E-01 (Median) | Methylation in Control | 5.70E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17493839) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.15E-05; Z-score:-5.89E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg07196069) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:7.58E-05; Z-score:-1.12E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg15284635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.60E-04; Z-score:6.07E-01 | ||
|
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 4.74E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg09226986) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:2.31E-04; Z-score:1.18E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 5.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19631651) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:5.69E-04; Z-score:-6.12E-01 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 7.16E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg21534940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:7.94E-04; Z-score:-5.32E-01 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 6.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14140691) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:8.84E-04; Z-score:-1.08E+00 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23221540) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.84E-03; Z-score:4.77E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg05654361) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:5.24E-03; Z-score:9.25E-01 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg23719549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:6.84E-03; Z-score:-4.21E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg25165501) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.10E-02; Z-score:5.50E-02 | ||
|
Methylation in Case |
7.44E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20049422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.45E-02; Z-score:-7.02E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg02902915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.26E-07; Z-score:-1.32E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of SLC9A3 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg01574364) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:2.47E-02; Z-score:8.58E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
24 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
5'UTR (cg26119806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.61E+00 | Statistic Test | p-value:5.61E-04; Z-score:-4.46E+00 | ||
|
Methylation in Case |
4.22E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
5'UTR (cg00546005) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.08E+00 | Statistic Test | p-value:3.60E-03; Z-score:4.05E+00 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 2.81E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
5'UTR (cg21154627) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.22E+00 | Statistic Test | p-value:2.16E-02; Z-score:4.38E+00 | ||
|
Methylation in Case |
1.81E-01 (Median) | Methylation in Control | 8.15E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg13202751) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.31E+00 | Statistic Test | p-value:7.57E-05; Z-score:7.94E+00 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 2.82E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg04433322) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:3.70E-03; Z-score:-4.67E+00 | ||
|
Methylation in Case |
4.28E-01 (Median) | Methylation in Control | 5.62E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg14778169) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:3.20E-02; Z-score:-1.55E+00 | ||
|
Methylation in Case |
1.84E-01 (Median) | Methylation in Control | 2.41E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg01183122) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.52E-02; Z-score:3.76E+00 | ||
|
Methylation in Case |
9.26E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg18646365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:4.34E-02; Z-score:2.46E+00 | ||
|
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 3.28E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg17933226) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:4.63E-02; Z-score:-1.82E+00 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
TSS200 (cg13272818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.93E+00 | Statistic Test | p-value:1.53E-02; Z-score:9.41E+00 | ||
|
Methylation in Case |
4.94E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
1stExon (cg25014117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.93E-02; Z-score:2.11E+00 | ||
|
Methylation in Case |
6.91E-02 (Median) | Methylation in Control | 5.79E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg14453449) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:4.83E-04; Z-score:4.89E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg05031424) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:1.42E-03; Z-score:3.40E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg15668533) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.22E+00 | Statistic Test | p-value:9.60E-03; Z-score:1.43E+01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 2.77E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg12146829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.41E+00 | Statistic Test | p-value:2.06E-02; Z-score:3.19E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 5.64E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg00240734) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.63E+00 | Statistic Test | p-value:2.39E-02; Z-score:5.20E+00 | ||
|
Methylation in Case |
1.82E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg19117051) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:2.62E-02; Z-score:-2.35E+00 | ||
|
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 4.44E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg18317999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.36E-02; Z-score:1.51E+00 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg17133183) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.16E+00 | Statistic Test | p-value:3.91E-02; Z-score:-1.67E+00 | ||
|
Methylation in Case |
7.71E-02 (Median) | Methylation in Control | 1.66E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg15527515) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.95E-02; Z-score:2.27E+00 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg10594510) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:4.57E-02; Z-score:1.58E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg15531450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.51E+00 | Statistic Test | p-value:4.81E-02; Z-score:2.99E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in prostate cancer | [ 4 ] | |||
|
Location |
Body (cg17044311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:4.89E-02; Z-score:1.55E+00 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
89 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:2.97E-04; Z-score:6.03E+00 | ||
|
Methylation in Case |
2.62E-01 (Median) | Methylation in Control | 1.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:1.07E-03; Z-score:-2.28E+00 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.88E+00 | Statistic Test | p-value:1.78E-03; Z-score:3.68E+00 | ||
|
Methylation in Case |
8.67E-02 (Median) | Methylation in Control | 3.01E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.76E+00 | Statistic Test | p-value:2.17E-03; Z-score:1.68E+00 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 5.85E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.24E+00 | Statistic Test | p-value:4.56E-08; Z-score:1.72E+01 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10430011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.03E+00 | Statistic Test | p-value:1.04E-14; Z-score:-4.22E+01 | ||
|
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg23326234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.94E+00 | Statistic Test | p-value:2.07E-13; Z-score:-1.55E+01 | ||
|
Methylation in Case |
4.04E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg13641012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:5.69E-13; Z-score:-1.56E+01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19640581) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.26E+00 | Statistic Test | p-value:1.09E-12; Z-score:-1.39E+01 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg00190355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.58E+00 | Statistic Test | p-value:8.62E-12; Z-score:-1.41E+01 | ||
|
Methylation in Case |
2.00E-01 (Median) | Methylation in Control | 5.15E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.79E+00 | Statistic Test | p-value:1.10E-11; Z-score:-1.20E+01 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 4.63E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.55E+00 | Statistic Test | p-value:2.25E-11; Z-score:-9.18E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22572362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.92E+00 | Statistic Test | p-value:2.66E-11; Z-score:-1.40E+01 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:4.97E-11; Z-score:-9.10E+00 | ||
|
Methylation in Case |
4.84E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.09E+00 | Statistic Test | p-value:1.35E-10; Z-score:-9.18E+00 | ||
|
Methylation in Case |
3.02E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:2.46E-10; Z-score:-9.42E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 6.06E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19969104) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:4.81E-10; Z-score:-9.19E+00 | ||
|
Methylation in Case |
4.01E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14533753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.07E+00 | Statistic Test | p-value:6.87E-10; Z-score:-8.52E+00 | ||
|
Methylation in Case |
3.11E-01 (Median) | Methylation in Control | 6.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.68E+00 | Statistic Test | p-value:7.98E-10; Z-score:-1.67E+01 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg13004635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.98E+00 | Statistic Test | p-value:1.38E-09; Z-score:-7.80E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.34E+00 | Statistic Test | p-value:1.97E-09; Z-score:-8.20E+00 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 3.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01982873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:3.54E-09; Z-score:-1.59E+01 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:7.41E-09; Z-score:-1.07E+01 | ||
|
Methylation in Case |
5.66E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.52E+00 | Statistic Test | p-value:1.61E-08; Z-score:-1.75E+01 | ||
|
Methylation in Case |
5.89E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:1.98E-08; Z-score:-8.85E+00 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 6.28E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg09647867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:3.66E-08; Z-score:-7.07E+00 | ||
|
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 6.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06925438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:4.56E-08; Z-score:-9.96E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.38E+00 | Statistic Test | p-value:1.06E-07; Z-score:-1.02E+01 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14491776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:1.09E-07; Z-score:-2.98E+01 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18666982) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:1.30E-07; Z-score:-7.69E+00 | ||
|
Methylation in Case |
6.14E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.93E+00 | Statistic Test | p-value:1.40E-07; Z-score:-6.42E+00 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 5.81E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:3.39E-07; Z-score:-6.87E+00 | ||
|
Methylation in Case |
3.14E-01 (Median) | Methylation in Control | 5.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.62E+00 | Statistic Test | p-value:3.62E-07; Z-score:-9.50E+00 | ||
|
Methylation in Case |
4.29E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg04764584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:4.44E-07; Z-score:-5.16E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 3.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.10E+00 | Statistic Test | p-value:4.94E-07; Z-score:-7.00E+00 | ||
|
Methylation in Case |
2.64E-01 (Median) | Methylation in Control | 5.54E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:7.94E-07; Z-score:-5.37E+00 | ||
|
Methylation in Case |
2.57E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+01 | Statistic Test | p-value:1.09E-06; Z-score:2.85E+01 | ||
|
Methylation in Case |
3.13E-01 (Median) | Methylation in Control | 2.42E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg17778888) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.97E+00 | Statistic Test | p-value:1.84E-06; Z-score:-5.03E+00 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:2.11E-06; Z-score:-1.20E+01 | ||
|
Methylation in Case |
7.36E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg25346936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.72E+00 | Statistic Test | p-value:2.26E-06; Z-score:-1.42E+01 | ||
|
Methylation in Case |
2.43E-01 (Median) | Methylation in Control | 4.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.35E-06; Z-score:-6.96E+00 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg24632646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:2.85E-06; Z-score:-4.39E+00 | ||
|
Methylation in Case |
3.17E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:3.08E-06; Z-score:-6.36E+00 | ||
|
Methylation in Case |
6.24E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg14137381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.87E+00 | Statistic Test | p-value:4.67E-06; Z-score:5.21E+00 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18140071) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:4.83E-06; Z-score:-3.80E+00 | ||
|
Methylation in Case |
4.40E-01 (Median) | Methylation in Control | 6.21E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:6.12E-06; Z-score:-7.85E+00 | ||
|
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg26710738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:6.23E-06; Z-score:-8.33E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg04181066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:1.29E-05; Z-score:-3.33E+00 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.44E-05; Z-score:-3.62E+00 | ||
|
Methylation in Case |
7.31E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg05981741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.64E-05; Z-score:-4.36E+00 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:1.88E-05; Z-score:-5.14E+00 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19426594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:2.51E-05; Z-score:-5.02E+00 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.82E+00 | Statistic Test | p-value:2.52E-05; Z-score:-4.79E+00 | ||
|
Methylation in Case |
2.43E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.79E-05; Z-score:-3.48E+00 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21625146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.65E+00 | Statistic Test | p-value:5.27E-05; Z-score:-4.09E+00 | ||
|
Methylation in Case |
3.30E-01 (Median) | Methylation in Control | 5.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:5.69E-05; Z-score:-4.31E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:6.50E-05; Z-score:-4.55E+00 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:7.46E-05; Z-score:-1.24E+01 | ||
|
Methylation in Case |
8.26E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:9.64E-05; Z-score:-1.79E+01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.02E-04; Z-score:-3.52E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.37E+00 | Statistic Test | p-value:1.17E-04; Z-score:-5.39E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.46E+00 | Statistic Test | p-value:1.43E-04; Z-score:-2.99E+00 | ||
|
Methylation in Case |
3.65E-01 (Median) | Methylation in Control | 5.33E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.51E-04; Z-score:-3.51E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:1.65E-04; Z-score:-4.89E+00 | ||
|
Methylation in Case |
4.72E-01 (Median) | Methylation in Control | 6.13E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:2.07E-04; Z-score:-3.38E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:2.92E-04; Z-score:-3.21E+00 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.30E-04; Z-score:-2.72E+00 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:3.70E-04; Z-score:-4.61E+00 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon69 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:7.69E-04; Z-score:-3.95E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon70 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01377305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:8.05E-04; Z-score:6.60E+00 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 7.22E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon71 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg06019590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:1.43E-03; Z-score:-2.96E+00 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 3.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon72 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:3.40E-03; Z-score:-2.87E+00 | ||
|
Methylation in Case |
6.81E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon73 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.25E+00 | Statistic Test | p-value:3.51E-03; Z-score:-2.31E+00 | ||
|
Methylation in Case |
3.73E-01 (Median) | Methylation in Control | 4.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon74 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08909608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.73E-03; Z-score:-2.03E+00 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon75 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:3.90E-03; Z-score:-2.41E+00 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon76 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:4.38E-03; Z-score:-2.03E+00 | ||
|
Methylation in Case |
6.10E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon77 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.10E-03; Z-score:-2.54E+00 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon78 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg12437197) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.26E-03; Z-score:-1.61E+00 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon79 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:7.28E-03; Z-score:3.01E+00 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon80 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg08894629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:7.87E-03; Z-score:1.09E+00 | ||
|
Methylation in Case |
1.12E-01 (Median) | Methylation in Control | 9.91E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon81 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:7.89E-03; Z-score:-2.36E+00 | ||
|
Methylation in Case |
4.74E-01 (Median) | Methylation in Control | 5.39E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon82 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.72E+00 | Statistic Test | p-value:9.35E-03; Z-score:-2.21E+00 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 2.95E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon83 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.91E-02; Z-score:-1.98E+00 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.57E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon84 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18096398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.00E-02; Z-score:-2.55E+00 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.68E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon85 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:2.63E-02; Z-score:-1.64E+00 | ||
|
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon86 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg15124303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.78E-02; Z-score:1.81E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon87 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:3.02E-02; Z-score:-2.25E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon88 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.35E-02; Z-score:-6.63E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon89 |
Methylation of SLC9A3 in bladder cancer | [ 5 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:4.46E-02; Z-score:2.56E+00 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 3.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
79 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.09E+00 | Statistic Test | p-value:1.07E-20; Z-score:5.44E+00 | ||
|
Methylation in Case |
3.37E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg23061578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:1.11E-06; Z-score:1.21E+00 | ||
|
Methylation in Case |
1.85E-01 (Median) | Methylation in Control | 1.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.16E+00 | Statistic Test | p-value:2.50E-09; Z-score:1.80E+00 | ||
|
Methylation in Case |
9.81E-02 (Median) | Methylation in Control | 4.53E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.72E+00 | Statistic Test | p-value:8.25E-09; Z-score:2.23E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 4.31E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.81E+00 | Statistic Test | p-value:5.98E-21; Z-score:4.60E+00 | ||
|
Methylation in Case |
3.09E-01 (Median) | Methylation in Control | 1.71E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:3.15E-14; Z-score:-2.39E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:3.00E-12; Z-score:-2.23E+00 | ||
|
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14533753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:2.18E-11; Z-score:-2.34E+00 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 5.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:3.74E-11; Z-score:-2.78E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:6.25E-11; Z-score:-1.84E+00 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15124303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:1.41E-10; Z-score:2.47E+00 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:3.02E-10; Z-score:2.41E+00 | ||
|
Methylation in Case |
5.35E-01 (Median) | Methylation in Control | 3.77E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.39E+00 | Statistic Test | p-value:1.87E-09; Z-score:1.74E+00 | ||
|
Methylation in Case |
4.57E-01 (Median) | Methylation in Control | 3.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:3.16E-09; Z-score:-1.63E+00 | ||
|
Methylation in Case |
4.88E-01 (Median) | Methylation in Control | 6.01E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.32E+00 | Statistic Test | p-value:8.75E-09; Z-score:1.89E+00 | ||
|
Methylation in Case |
5.44E-01 (Median) | Methylation in Control | 4.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:2.17E-08; Z-score:-1.75E+00 | ||
|
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:2.83E-08; Z-score:2.86E+00 | ||
|
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.92E-08; Z-score:-1.89E+00 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.76E+00 | Statistic Test | p-value:3.94E-08; Z-score:1.87E+00 | ||
|
Methylation in Case |
5.07E-02 (Median) | Methylation in Control | 1.35E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01982873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:4.40E-08; Z-score:-1.59E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13641012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:7.29E-08; Z-score:-1.70E+00 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.20E+00 | Statistic Test | p-value:3.51E-07; Z-score:-1.61E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:4.46E-07; Z-score:1.81E+00 | ||
|
Methylation in Case |
6.36E-01 (Median) | Methylation in Control | 4.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.76E-07; Z-score:-1.32E+00 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:5.57E-07; Z-score:-1.15E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:7.19E-07; Z-score:-1.68E+00 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.21E-06; Z-score:-1.31E+00 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06925438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.53E-06; Z-score:-1.64E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg04181066) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.65E-06; Z-score:-1.28E+00 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 6.93E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg19980199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:3.94E-06; Z-score:1.79E+00 | ||
|
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 5.69E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.30E+00 | Statistic Test | p-value:5.91E-06; Z-score:1.43E+00 | ||
|
Methylation in Case |
3.95E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.18E-05; Z-score:-1.26E+00 | ||
|
Methylation in Case |
6.94E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16149930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.60E-05; Z-score:-5.87E-01 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15084390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:1.79E-05; Z-score:7.00E-01 | ||
|
Methylation in Case |
8.89E-02 (Median) | Methylation in Control | 7.69E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.89E-05; Z-score:-1.15E+00 | ||
|
Methylation in Case |
4.88E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14137381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.40E+00 | Statistic Test | p-value:2.13E-05; Z-score:1.06E+00 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 2.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:2.56E-05; Z-score:-1.40E+00 | ||
|
Methylation in Case |
4.75E-01 (Median) | Methylation in Control | 6.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.83E-05; Z-score:-1.34E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg05981741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:3.49E-05; Z-score:-1.19E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:4.14E-05; Z-score:1.47E+00 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:4.27E-05; Z-score:1.10E+00 | ||
|
Methylation in Case |
1.78E-01 (Median) | Methylation in Control | 1.46E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:5.35E-05; Z-score:1.52E+00 | ||
|
Methylation in Case |
6.60E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:9.30E-05; Z-score:-1.05E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg04764584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:9.76E-05; Z-score:-7.40E-01 | ||
|
Methylation in Case |
2.96E-01 (Median) | Methylation in Control | 3.28E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:1.09E-04; Z-score:2.99E-01 | ||
|
Methylation in Case |
1.16E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.48E-04; Z-score:-8.18E-01 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.21E+00 | Statistic Test | p-value:2.00E-04; Z-score:3.45E-01 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01377305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:2.29E-04; Z-score:7.12E-01 | ||
|
Methylation in Case |
8.65E-02 (Median) | Methylation in Control | 7.06E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.90E-04; Z-score:-1.14E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg25346936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:3.84E-04; Z-score:1.27E+00 | ||
|
Methylation in Case |
4.60E-01 (Median) | Methylation in Control | 3.76E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon51 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.10E-04; Z-score:-7.20E-01 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon52 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.42E-04; Z-score:-5.89E-01 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon53 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg08894629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:5.13E-04; Z-score:8.06E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon54 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.27E-04; Z-score:-6.05E-01 | ||
|
Methylation in Case |
6.23E-01 (Median) | Methylation in Control | 6.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon55 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:7.95E-04; Z-score:8.68E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon56 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22572362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.07E-03; Z-score:5.50E-01 | ||
|
Methylation in Case |
2.82E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon57 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.08E-03; Z-score:-4.39E-01 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon58 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg00190355) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.23E+00 | Statistic Test | p-value:1.15E-03; Z-score:-1.06E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon59 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.82E-03; Z-score:-7.62E-01 | ||
|
Methylation in Case |
5.13E-01 (Median) | Methylation in Control | 5.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon60 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13004635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.18E-03; Z-score:9.96E-01 | ||
|
Methylation in Case |
6.62E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon61 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg09647867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.27E-03; Z-score:-8.91E-01 | ||
|
Methylation in Case |
5.60E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon62 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg23326234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.62E-03; Z-score:-6.12E-01 | ||
|
Methylation in Case |
5.55E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon63 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:3.97E-03; Z-score:-9.28E-01 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon64 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg08758174) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:4.40E-03; Z-score:1.20E+00 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 7.23E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon65 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.82E-03; Z-score:-4.85E-01 | ||
|
Methylation in Case |
4.63E-01 (Median) | Methylation in Control | 4.92E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon66 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg02689506) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:6.93E-03; Z-score:2.41E-01 | ||
|
Methylation in Case |
9.64E-02 (Median) | Methylation in Control | 9.16E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon67 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:8.48E-03; Z-score:-8.78E-01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon68 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:1.10E-02; Z-score:-9.60E-01 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon69 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg14491776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:1.24E-02; Z-score:-9.66E-01 | ||
|
Methylation in Case |
6.08E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon70 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg18096398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:1.76E-02; Z-score:-8.33E-01 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 9.50E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon71 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg24632646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.02E-02; Z-score:-2.24E-01 | ||
|
Methylation in Case |
4.39E-01 (Median) | Methylation in Control | 4.54E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon72 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.08E-02; Z-score:-2.53E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon73 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg10430011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:2.12E-02; Z-score:-1.12E+00 | ||
|
Methylation in Case |
4.82E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon74 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.23E-02; Z-score:-6.06E-01 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon75 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg17778888) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:4.22E-02; Z-score:7.83E-01 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 4.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon76 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg13013644) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:4.41E-02; Z-score:-7.26E-01 | ||
|
Methylation in Case |
4.85E-01 (Median) | Methylation in Control | 5.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon77 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:4.79E-02; Z-score:4.61E-01 | ||
|
Methylation in Case |
3.65E-01 (Median) | Methylation in Control | 3.36E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon78 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg15640734) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.92E-02; Z-score:-2.75E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon79 |
Methylation of SLC9A3 in breast cancer | [ 6 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:4.93E-02; Z-score:-6.14E-01 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
50 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.84E+00 | Statistic Test | p-value:2.48E-07; Z-score:1.94E+00 | ||
|
Methylation in Case |
2.19E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.60E+00 | Statistic Test | p-value:4.12E-07; Z-score:1.79E+00 | ||
|
Methylation in Case |
1.99E-01 (Median) | Methylation in Control | 1.25E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:4.38E-15; Z-score:2.99E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 7.38E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg27624327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.48E+00 | Statistic Test | p-value:2.88E-10; Z-score:4.34E+00 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:6.68E-10; Z-score:-2.44E+00 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.37E+00 | Statistic Test | p-value:2.06E-09; Z-score:-3.97E+00 | ||
|
Methylation in Case |
4.64E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.65E-08; Z-score:3.80E+00 | ||
|
Methylation in Case |
6.30E-01 (Median) | Methylation in Control | 4.90E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.43E-07; Z-score:2.93E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 6.36E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.67E-07; Z-score:-2.04E+00 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:3.62E-07; Z-score:3.99E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 4.98E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.42E-06; Z-score:-2.60E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.43E-06; Z-score:2.66E+00 | ||
|
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.47E-06; Z-score:-2.08E+00 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.20E-06; Z-score:6.76E-01 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg08894629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.77E+00 | Statistic Test | p-value:5.39E-06; Z-score:2.16E+00 | ||
|
Methylation in Case |
6.43E-02 (Median) | Methylation in Control | 3.63E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.30E-05; Z-score:-2.09E+00 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.42E+00 | Statistic Test | p-value:1.49E-05; Z-score:1.48E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.31E-05; Z-score:-1.33E+00 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01377305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:1.07E-04; Z-score:1.52E+00 | ||
|
Methylation in Case |
3.63E-02 (Median) | Methylation in Control | 2.51E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:1.08E-04; Z-score:-1.47E+00 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22572362) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.39E+00 | Statistic Test | p-value:1.17E-04; Z-score:1.31E+00 | ||
|
Methylation in Case |
2.53E-01 (Median) | Methylation in Control | 1.81E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg25518170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:4.09E-04; Z-score:3.26E+00 | ||
|
Methylation in Case |
8.34E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01103582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.18E-04; Z-score:-1.43E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg17778888) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:5.24E-04; Z-score:1.61E+00 | ||
|
Methylation in Case |
9.66E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:5.47E-04; Z-score:7.20E-01 | ||
|
Methylation in Case |
4.52E-02 (Median) | Methylation in Control | 3.64E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg06925438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:8.87E-04; Z-score:-1.12E+00 | ||
|
Methylation in Case |
9.23E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:9.87E-04; Z-score:1.16E+00 | ||
|
Methylation in Case |
3.03E-01 (Median) | Methylation in Control | 2.42E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.53E-03; Z-score:-4.53E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.78E-03; Z-score:3.28E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:1.84E-03; Z-score:5.01E-01 | ||
|
Methylation in Case |
7.74E-02 (Median) | Methylation in Control | 6.28E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg01982873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.88E-03; Z-score:-5.54E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.97E-03; Z-score:-5.43E-01 | ||
|
Methylation in Case |
9.74E-01 (Median) | Methylation in Control | 9.76E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg19969104) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.06E-03; Z-score:2.66E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.66E+00 | Statistic Test | p-value:3.67E-03; Z-score:9.13E-01 | ||
|
Methylation in Case |
2.37E-02 (Median) | Methylation in Control | 1.43E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:3.80E-03; Z-score:1.68E+00 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:3.83E-03; Z-score:-1.39E+00 | ||
|
Methylation in Case |
2.99E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:4.02E-03; Z-score:1.33E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16235679) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.06E-03; Z-score:-1.18E+00 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:6.02E-03; Z-score:1.59E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 4.39E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.16E-02; Z-score:-1.14E+00 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.60E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg23361356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.37E-02; Z-score:-8.97E-01 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.79E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.72E-02; Z-score:-1.26E+00 | ||
|
Methylation in Case |
9.60E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg21625146) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:2.69E-02; Z-score:-1.20E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:2.78E-02; Z-score:1.76E+00 | ||
|
Methylation in Case |
7.99E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon45 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.81E-02; Z-score:-6.25E-01 | ||
|
Methylation in Case |
9.30E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon46 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.23E-02; Z-score:-4.97E-02 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon47 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg04764584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:3.48E-02; Z-score:-1.48E+00 | ||
|
Methylation in Case |
3.49E-01 (Median) | Methylation in Control | 4.04E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon48 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.01E-02; Z-score:-2.49E-01 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 6.07E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon49 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.04E-02; Z-score:1.53E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 7.19E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon50 |
Methylation of SLC9A3 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg15084390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:4.58E-02; Z-score:-1.28E+00 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 3.55E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
45 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:3.20E-07; Z-score:1.85E+00 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.23E+00 | Statistic Test | p-value:9.58E-04; Z-score:5.62E-01 | ||
|
Methylation in Case |
3.42E-01 (Median) | Methylation in Control | 2.78E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.28E+00 | Statistic Test | p-value:2.10E-02; Z-score:1.14E-01 | ||
|
Methylation in Case |
6.24E-02 (Median) | Methylation in Control | 4.86E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.27E+00 | Statistic Test | p-value:3.59E-04; Z-score:8.55E-01 | ||
|
Methylation in Case |
4.25E-01 (Median) | Methylation in Control | 3.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg05981741) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.62E-07; Z-score:-2.05E+00 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:2.85E-06; Z-score:-1.52E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:7.97E-06; Z-score:-1.94E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23326234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.47E-05; Z-score:-1.39E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:2.71E-05; Z-score:-1.61E+00 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:5.20E-05; Z-score:1.24E+00 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.43E+00 | Statistic Test | p-value:5.32E-05; Z-score:1.56E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 5.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23551873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.19E-04; Z-score:-9.90E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.40E-04; Z-score:-5.99E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.03E-04; Z-score:9.99E-01 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 3.72E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06019590) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.35E+00 | Statistic Test | p-value:3.03E-04; Z-score:1.15E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 4.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26710738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.22E+00 | Statistic Test | p-value:4.40E-04; Z-score:-1.00E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.45E+00 | Statistic Test | p-value:5.07E-04; Z-score:6.98E-01 | ||
|
Methylation in Case |
7.23E-02 (Median) | Methylation in Control | 2.95E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.27E-04; Z-score:-1.10E+00 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06852942) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.38E+00 | Statistic Test | p-value:6.66E-04; Z-score:1.55E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:6.82E-04; Z-score:9.85E-01 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 5.72E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.00E-03; Z-score:-4.23E-01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.29E-03; Z-score:-1.60E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg25925473) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.58E-03; Z-score:-4.27E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:1.74E-03; Z-score:1.17E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 4.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg22985016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.46E+00 | Statistic Test | p-value:1.87E-03; Z-score:1.06E+00 | ||
|
Methylation in Case |
5.88E-01 (Median) | Methylation in Control | 4.04E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.32E-03; Z-score:-5.17E-01 | ||
|
Methylation in Case |
8.95E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg27624327) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.13E-03; Z-score:-8.10E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.66E-03; Z-score:-4.06E-01 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.56E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg05169099) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.69E-03; Z-score:-5.44E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg18140071) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.92E-03; Z-score:-6.60E-01 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:6.51E-03; Z-score:-5.69E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16555556) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:6.78E-03; Z-score:1.12E+00 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 5.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg25346936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.31E+00 | Statistic Test | p-value:9.48E-03; Z-score:1.20E+00 | ||
|
Methylation in Case |
5.67E-01 (Median) | Methylation in Control | 4.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg22800242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.11E-02; Z-score:2.46E-03 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.15E-02; Z-score:-4.40E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg21159260) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.24E-02; Z-score:7.34E-01 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 5.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.34E-02; Z-score:-7.11E-01 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg09647867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.38E-02; Z-score:-5.79E-01 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.52E+00 | Statistic Test | p-value:1.40E-02; Z-score:1.28E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 4.99E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.49E-02; Z-score:-7.42E-03 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg10634702) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.92E-02; Z-score:-2.81E-01 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg08909608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.47E-02; Z-score:-4.68E-01 | ||
|
Methylation in Case |
9.16E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon43 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg16329782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:4.00E-02; Z-score:9.16E-01 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon44 |
Methylation of SLC9A3 in colorectal cancer | [ 8 ] | |||
|
Location |
Body (cg11360755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.37E-02; Z-score:5.97E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.59E+00 | Statistic Test | p-value:5.35E-03; Z-score:4.52E+00 | ||
|
Methylation in Case |
3.53E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.02E+00 | Statistic Test | p-value:3.75E-02; Z-score:3.41E+00 | ||
|
Methylation in Case |
1.53E-01 (Median) | Methylation in Control | 7.58E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg25861340) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.65E+00 | Statistic Test | p-value:4.06E-02; Z-score:3.10E+00 | ||
|
Methylation in Case |
1.79E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
1stExon (cg02748539) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.69E+00 | Statistic Test | p-value:1.67E-03; Z-score:4.15E+00 | ||
|
Methylation in Case |
3.89E-01 (Median) | Methylation in Control | 2.30E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg19301897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.59E+00 | Statistic Test | p-value:7.53E-04; Z-score:1.48E+00 | ||
|
Methylation in Case |
4.06E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg02354563) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:9.11E-04; Z-score:2.40E+00 | ||
|
Methylation in Case |
4.72E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.15E+00 | Statistic Test | p-value:2.36E-03; Z-score:-6.66E+00 | ||
|
Methylation in Case |
6.12E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg11083715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.85E-03; Z-score:-2.23E+00 | ||
|
Methylation in Case |
6.53E-01 (Median) | Methylation in Control | 7.14E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:6.70E-03; Z-score:-2.13E+00 | ||
|
Methylation in Case |
8.22E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg13340126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:7.10E-03; Z-score:1.78E+00 | ||
|
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 3.86E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg01181940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:7.50E-03; Z-score:-1.46E+00 | ||
|
Methylation in Case |
4.68E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg13004635) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.01E-02; Z-score:4.80E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.34E+00 | Statistic Test | p-value:1.20E-02; Z-score:4.62E+00 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 6.60E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg13641012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.32E-02; Z-score:-3.39E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16034787) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.55E-02; Z-score:-1.58E+00 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg20402284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:2.45E-02; Z-score:1.90E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 6.27E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg19107578) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:2.95E-02; Z-score:2.34E+00 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.16E-02; Z-score:2.48E+00 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:3.89E-02; Z-score:-6.44E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:4.07E-02; Z-score:1.75E+00 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg12833872) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:4.11E-02; Z-score:1.41E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 5.98E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.56E-02; Z-score:-2.48E+00 | ||
|
Methylation in Case |
9.54E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg14491776) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:4.65E-02; Z-score:-2.79E+00 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg08904373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:4.67E-02; Z-score:1.65E+00 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg18096398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.68E-02; Z-score:-5.37E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.62E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.90E-02; Z-score:-2.08E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.95E-02; Z-score:-7.13E-01 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
28 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg09822697) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.32E-02; Z-score:2.29E-01 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS200 (cg12628145) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:1.63E-02; Z-score:5.07E-01 | ||
|
Methylation in Case |
7.62E-02 (Median) | Methylation in Control | 6.88E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.56E-12; Z-score:-1.97E+00 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16535035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.44E-12; Z-score:-2.16E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg21620524) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:4.29E-12; Z-score:-1.88E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06483795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:7.18E-10; Z-score:-1.56E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05859929) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.07E-08; Z-score:-1.66E+00 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01316792) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.23E-07; Z-score:-9.13E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16651552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:4.06E-06; Z-score:-1.12E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg21271026) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.34E-04; Z-score:-8.36E-01 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg25084851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:2.58E-04; Z-score:1.21E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg18447419) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:2.66E-04; Z-score:8.24E-01 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 4.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg23251141) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.71E-04; Z-score:8.60E-01 | ||
|
Methylation in Case |
2.87E-01 (Median) | Methylation in Control | 2.47E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg22025206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:7.12E-04; Z-score:-1.29E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 4.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg10690829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.79E-03; Z-score:9.41E-01 | ||
|
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg12507879) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.85E-03; Z-score:-4.01E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg18274791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:6.38E-03; Z-score:-3.82E-01 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg20558230) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:7.93E-03; Z-score:-3.76E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg15420634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.78E-03; Z-score:-3.39E-01 | ||
|
Methylation in Case |
6.47E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01228410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.72E-02; Z-score:-5.79E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06866655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.99E-02; Z-score:-2.18E-01 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06058576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.17E-02; Z-score:3.16E-01 | ||
|
Methylation in Case |
9.33E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg17958577) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.18E-02; Z-score:-7.76E-01 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.70E-02; Z-score:-3.62E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26086288) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.60E-02; Z-score:-6.20E-01 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26541920) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:3.65E-02; Z-score:3.01E-01 | ||
|
Methylation in Case |
5.34E-02 (Median) | Methylation in Control | 4.97E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg19426594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.25E-02; Z-score:-1.62E-01 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC9A3 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.86E-02; Z-score:-3.69E-01 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in celiac disease | [ 11 ] | |||
|
Location |
Body (cg21743597) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.35E+00 | Statistic Test | p-value:2.29E-02; Z-score:5.21E-01 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 8.80E-02 (Median) | ||
|
Studied Phenotype |
Celiac disease[ ICD-11:DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC9A3 in panic disorder | [ 12 ] | |||
|
Location |
Body (cg16264495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.64E-02; Z-score:4.15E-01 | ||
|
Methylation in Case |
3.38E+00 (Median) | Methylation in Control | 3.17E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC9A3 in panic disorder | [ 12 ] | |||
|
Location |
Body (cg10430011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.21E-02; Z-score:3.60E-01 | ||
|
Methylation in Case |
3.15E+00 (Median) | Methylation in Control | 2.96E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC9A3 in panic disorder | [ 12 ] | |||
|
Location |
Body (cg01295188) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:3.22E-02; Z-score:5.75E-01 | ||
|
Methylation in Case |
1.92E+00 (Median) | Methylation in Control | 1.67E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Arterial aneurysm |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Moderate hypermethylation of SLC9A3 in arterial aneurysm than that in healthy individual | ||||
Studied Phenotype |
Arterial aneurysm [ICD-11:BD51] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:0.027442308; Fold-change:0.217233019; Z-score:2.044728151 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC9A3 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value:7.63E-37; Fold-change:0.560293742; Z-score:3.117586583 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
| ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Significant hypermethylation of SLC9A3 in gastric cancer than that in adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value:1.12E-94; Fold-change:0.546083755; Z-score:143.1369704 | ||||
| DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
microRNA |
|||||
|
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-1199 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1199 | miRNA Mature ID | miR-1199-3p | ||
|
miRNA Sequence |
UGCGGCCGGUGCUCAACCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1228 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1228 | miRNA Mature ID | miR-1228-5p | ||
|
miRNA Sequence |
GUGGGCGGGGGCAGGUGUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-1302 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1302 | miRNA Mature ID | miR-1302 | ||
|
miRNA Sequence |
UUGGGACAUACUUAUGCUAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon4 |
miR-132 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-132 | miRNA Mature ID | miR-132-5p | ||
|
miRNA Sequence |
ACCGUGGCUUUCGAUUGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-2277 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2277 | miRNA Mature ID | miR-2277-5p | ||
|
miRNA Sequence |
AGCGCGGGCUGAGCGCUGCCAGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-2277 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2277 | miRNA Mature ID | miR-2277-3p | ||
|
miRNA Sequence |
UGACAGCGCCCUGCCUGGCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-3191 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3191 | miRNA Mature ID | miR-3191-3p | ||
|
miRNA Sequence |
UGGGGACGUAGCUGGCCAGACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon8 |
miR-3960 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3960 | miRNA Mature ID | miR-3960 | ||
|
miRNA Sequence |
GGCGGCGGCGGAGGCGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon9 |
miR-4298 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4298 | miRNA Mature ID | miR-4298 | ||
|
miRNA Sequence |
CUGGGACAGGAGGAGGAGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-4467 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4467 | miRNA Mature ID | miR-4467 | ||
|
miRNA Sequence |
UGGCGGCGGUAGUUAUGGGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-4634 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4634 | miRNA Mature ID | miR-4634 | ||
|
miRNA Sequence |
CGGCGCGACCGGCCCGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-4706 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4706 | miRNA Mature ID | miR-4706 | ||
|
miRNA Sequence |
AGCGGGGAGGAAGUGGGCGCUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-4749 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4749 | miRNA Mature ID | miR-4749-5p | ||
|
miRNA Sequence |
UGCGGGGACAGGCCAGGGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-541 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-541 | miRNA Mature ID | miR-541-3p | ||
|
miRNA Sequence |
UGGUGGGCACAGAAUCUGGACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-654 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-654 | miRNA Mature ID | miR-654-5p | ||
|
miRNA Sequence |
UGGUGGGCCGCAGAACAUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-6786 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6786 | miRNA Mature ID | miR-6786-5p | ||
|
miRNA Sequence |
GCGGUGGGGCCGGAGGGGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-8072 directly targets SLC9A3 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8072 | miRNA Mature ID | miR-8072 | ||
|
miRNA Sequence |
GGCGGCGGGGAGGUAGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.