Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0473 Transporter Info | ||||
| Gene Name | SLC7A6 | ||||
| Transporter Name | Y+L amino acid transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-125b directly targets SLC7A6 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-125b | miRNA Mature ID | miR-125b-5p | ||
|
miRNA Sequence |
UCCCUGAGACCCUAACUUGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
miR-193b directly targets SLC7A6 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
|
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon3 |
miR-30a directly targets SLC7A6 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-3p | ||
|
miRNA Sequence |
CUUUCAGUCGGAUGUUUGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human liver hepatocellular carcinoma cell line (HepG2) | ||||
|
Epigenetic Phenomenon4 |
miR-98 directly targets SLC7A6 | [ 4 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-98 | miRNA Mature ID | miR-98-5p | ||
|
miRNA Sequence |
UGAGGUAGUAAGUUGUAUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.