General Information of Drug Transporter (DT)
DT ID DTD0471 Transporter Info
Gene Name SLC7A5
Transporter Name L-type amino acid transporter 1
Gene ID
8140
UniProt ID
Q01650
Epigenetic Regulations of This DT (EGR)

Methylation

  Lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Hypermethylation of SLC7A5 in lung cancer [ 1 ]

Location

Gene body

Epigenetic Type

Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

Up regulation ofSLC7A5 Experiment Method Microarrays

Studied Phenotype

Lung cancer[ ICD-11:2C25]

Experimental Material

Patient tissue samples

Additional Notes

SLC7A5 had increased methylation and increased expression in lung cancer.

  Hepatocellular carcinoma

         40 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

5'UTR (cg06578117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:4.78E-11; Z-score:-2.31E+00

Methylation in Case

5.07E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg04721098)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:5.69E-19; Z-score:-3.54E+00

Methylation in Case

3.24E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg21861233)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.41E+00 Statistic Test p-value:4.71E-13; Z-score:-1.73E+00

Methylation in Case

3.60E-01 (Median) Methylation in Control 5.08E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.26E+00 Statistic Test p-value:8.50E-09; Z-score:-1.70E+00

Methylation in Case

5.36E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg02057598)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:8.67E-08; Z-score:-1.44E+00

Methylation in Case

6.56E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg09357483)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:3.26E-06; Z-score:-9.95E-01

Methylation in Case

5.47E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS1500 (cg12408911)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:1.11E-02; Z-score:1.07E+00

Methylation in Case

7.21E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS200 (cg13323701)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:4.82E+00 Statistic Test p-value:4.60E-13; Z-score:7.74E+00

Methylation in Case

2.58E-01 (Median) Methylation in Control 5.34E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS200 (cg00728300)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.60E-07; Z-score:1.72E+00

Methylation in Case

3.96E-01 (Median) Methylation in Control 3.06E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

TSS200 (cg08710629)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:3.76E-07; Z-score:1.72E+00

Methylation in Case

5.80E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.07E+00 Statistic Test p-value:1.27E-11; Z-score:6.58E+00

Methylation in Case

2.29E-01 (Median) Methylation in Control 7.45E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg13788959)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.66E+00 Statistic Test p-value:8.73E-24; Z-score:-8.84E+00

Methylation in Case

4.65E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg00157228)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.63E+00 Statistic Test p-value:6.07E-20; Z-score:-4.65E+00

Methylation in Case

4.65E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg14772660)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.45E+00 Statistic Test p-value:2.25E-18; Z-score:-4.48E+00

Methylation in Case

5.25E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg06708198)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.51E+00 Statistic Test p-value:3.05E-16; Z-score:-9.01E+00

Methylation in Case

5.29E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg07358738)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.60E+00 Statistic Test p-value:1.18E-15; Z-score:-3.92E+00

Methylation in Case

4.97E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg02400308)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.74E+00 Statistic Test p-value:7.44E-14; Z-score:-3.96E+00

Methylation in Case

3.83E-01 (Median) Methylation in Control 6.67E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg14225195)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:8.29E-11; Z-score:-1.35E+00

Methylation in Case

4.14E-01 (Median) Methylation in Control 5.65E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg04804543)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:1.95E-10; Z-score:-3.00E+00

Methylation in Case

6.64E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg02057782)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:1.18E-09; Z-score:2.41E+00

Methylation in Case

5.17E-01 (Median) Methylation in Control 3.89E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg06665333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.46E-06; Z-score:7.81E-01

Methylation in Case

8.46E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:4.30E-06; Z-score:-1.42E+00

Methylation in Case

6.43E-01 (Median) Methylation in Control 7.31E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg10169763)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:3.34E-04; Z-score:8.73E-01

Methylation in Case

8.72E-01 (Median) Methylation in Control 7.51E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg27555036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.80E-04; Z-score:-7.65E-01

Methylation in Case

8.40E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg03801429)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.57E-03; Z-score:-8.04E-01

Methylation in Case

7.78E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg06867910)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.57E-03; Z-score:-4.10E-01

Methylation in Case

7.70E-02 (Median) Methylation in Control 8.95E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg08617020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.69E-03; Z-score:-2.16E-01

Methylation in Case

7.47E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg03408354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:5.18E-03; Z-score:5.84E-01

Methylation in Case

7.57E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:5.69E-03; Z-score:-6.94E-01

Methylation in Case

3.76E-01 (Median) Methylation in Control 4.27E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg26982544)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:6.16E-03; Z-score:-5.67E-01

Methylation in Case

5.54E-02 (Median) Methylation in Control 7.13E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon31

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg04802238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:8.48E-03; Z-score:4.65E-01

Methylation in Case

8.28E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon32

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg08401758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:2.84E-02; Z-score:-3.23E-01

Methylation in Case

9.70E-02 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon33

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg26907768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:2.86E-02; Z-score:6.19E-01

Methylation in Case

2.93E-01 (Median) Methylation in Control 2.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon34

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg05393733)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:3.05E-02; Z-score:6.03E-01

Methylation in Case

8.51E-01 (Median) Methylation in Control 7.63E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon35

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg09285525)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:3.13E-02; Z-score:-1.16E-01

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon36

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.68E-02; Z-score:2.01E-01

Methylation in Case

7.67E-01 (Median) Methylation in Control 7.36E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon37

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:4.11E-02; Z-score:2.70E-01

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.06E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon38

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

3'UTR (cg09618385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.97E-04; Z-score:-5.40E-01

Methylation in Case

6.99E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon39

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

3'UTR (cg04481596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.66E-03; Z-score:-3.53E-01

Methylation in Case

8.90E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon40

Methylation of SLC7A5 in hepatocellular carcinoma [ 2 ]

Location

3'UTR (cg03486383)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.17E-02; Z-score:-2.71E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

         31 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

5'UTR (cg18440316)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.44E+00 Statistic Test p-value:3.17E-04; Z-score:8.14E-01

Methylation in Case

2.01E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

5'UTR (cg19431980)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:1.32E-03; Z-score:-6.48E-01

Methylation in Case

6.64E-02 (Median) Methylation in Control 8.93E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS1500 (cg10678459)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:4.75E-05; Z-score:-1.09E+00

Methylation in Case

5.21E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS1500 (cg12572677)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.97E-03; Z-score:5.42E-01

Methylation in Case

8.73E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS1500 (cg04144226)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:2.04E-02; Z-score:-6.52E-01

Methylation in Case

1.03E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS1500 (cg07751266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.10E-02; Z-score:-3.23E-01

Methylation in Case

6.22E-02 (Median) Methylation in Control 6.56E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS200 (cg15044957)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:3.16E+00 Statistic Test p-value:1.20E-08; Z-score:2.00E+00

Methylation in Case

4.53E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS200 (cg17714025)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.55E+00 Statistic Test p-value:4.79E-06; Z-score:1.53E+00

Methylation in Case

4.12E-01 (Median) Methylation in Control 1.62E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS200 (cg18919642)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.30E+00 Statistic Test p-value:1.29E-05; Z-score:-1.10E+00

Methylation in Case

1.42E-01 (Median) Methylation in Control 1.85E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS200 (cg04294894)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:8.83E-04; Z-score:-7.30E-01

Methylation in Case

7.45E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS200 (cg16404371)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:3.49E-03; Z-score:2.38E-01

Methylation in Case

4.54E-01 (Median) Methylation in Control 4.27E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

TSS200 (cg24598126)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.22E-02; Z-score:-5.10E-01

Methylation in Case

1.15E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg18031850)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:3.55E-17; Z-score:2.85E+00

Methylation in Case

4.13E-01 (Median) Methylation in Control 2.85E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg17156227)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:3.82E-13; Z-score:2.04E+00

Methylation in Case

7.93E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (ch.3.1209178R)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.47E+00 Statistic Test p-value:1.30E-12; Z-score:2.11E+00

Methylation in Case

8.48E-02 (Median) Methylation in Control 5.78E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg08789022)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.79E+00 Statistic Test p-value:2.41E-09; Z-score:1.83E+00

Methylation in Case

4.51E-01 (Median) Methylation in Control 2.52E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg13890552)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.33E-07; Z-score:-6.75E-01

Methylation in Case

8.70E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg18426477)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:2.57E-07; Z-score:-1.05E+00

Methylation in Case

4.93E-01 (Median) Methylation in Control 5.61E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg26244838)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.26E+00 Statistic Test p-value:1.82E-06; Z-score:1.30E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 5.36E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg00420510)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:1.93E-06; Z-score:1.19E+00

Methylation in Case

7.63E-01 (Median) Methylation in Control 6.62E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg07834249)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:3.69E-06; Z-score:1.51E+00

Methylation in Case

8.51E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg20307184)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.17E-05; Z-score:-8.88E-01

Methylation in Case

7.32E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg01435766)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.71E+00 Statistic Test p-value:3.27E-03; Z-score:-8.34E-01

Methylation in Case

1.29E-01 (Median) Methylation in Control 2.21E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg24632865)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:5.72E-03; Z-score:7.97E-01

Methylation in Case

8.31E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg19619756)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:7.47E-03; Z-score:9.20E-01

Methylation in Case

5.86E-01 (Median) Methylation in Control 5.32E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg00087735)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.33E-02; Z-score:5.77E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg25600103)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:3.73E-02; Z-score:5.31E-01

Methylation in Case

7.41E-01 (Median) Methylation in Control 7.22E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg08293408)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.23E-02; Z-score:-3.46E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg11681428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:4.56E-02; Z-score:8.08E-01

Methylation in Case

4.31E-01 (Median) Methylation in Control 3.69E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg22872508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:4.88E-02; Z-score:9.48E-02

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon31

Methylation of SLC7A5 in pancretic ductal adenocarcinoma [ 3 ]

Location

Body (cg18848012)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:4.98E-02; Z-score:6.58E-01

Methylation in Case

8.99E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         27 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.69E+00 Statistic Test p-value:8.52E-05; Z-score:-4.23E+00

Methylation in Case

4.53E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

TSS1500 (cg02057598)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:1.36E-03; Z-score:-2.94E+00

Methylation in Case

6.32E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

TSS200 (cg00728300)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.35E+00 Statistic Test p-value:2.76E-05; Z-score:-4.50E+00

Methylation in Case

1.54E-01 (Median) Methylation in Control 2.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

TSS200 (cg08710629)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.81E+00 Statistic Test p-value:3.20E-04; Z-score:-3.08E+00

Methylation in Case

1.69E-01 (Median) Methylation in Control 3.07E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

1stExon (cg26695445)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.40E+00 Statistic Test p-value:1.82E-02; Z-score:-1.33E+00

Methylation in Case

7.75E-02 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:3.97E-06; Z-score:5.92E+00

Methylation in Case

9.25E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg26569315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.48E+00 Statistic Test p-value:5.02E-06; Z-score:-1.04E+01

Methylation in Case

3.98E-01 (Median) Methylation in Control 5.90E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg27560818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.19E+00 Statistic Test p-value:1.06E-05; Z-score:-5.10E+00

Methylation in Case

7.21E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg09285525)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.24E-05; Z-score:-4.04E+00

Methylation in Case

7.75E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:2.65E-04; Z-score:-3.62E+00

Methylation in Case

6.56E-01 (Median) Methylation in Control 7.37E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg08860287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:2.94E-04; Z-score:3.55E+00

Methylation in Case

7.25E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg06372223)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:4.60E-04; Z-score:2.84E+00

Methylation in Case

7.25E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg26529851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.29E+00 Statistic Test p-value:6.90E-04; Z-score:-7.23E+00

Methylation in Case

3.66E-01 (Median) Methylation in Control 4.71E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg03553613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.17E-03; Z-score:2.57E+00

Methylation in Case

8.56E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg27555036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.92E-03; Z-score:-3.39E+00

Methylation in Case

7.87E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.97E-03; Z-score:-1.81E+00

Methylation in Case

7.34E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.50E+00 Statistic Test p-value:2.82E-03; Z-score:-2.24E+00

Methylation in Case

1.86E-01 (Median) Methylation in Control 2.80E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg02614661)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:2.94E-03; Z-score:2.57E+00

Methylation in Case

8.97E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg26637881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:6.13E-03; Z-score:2.43E+00

Methylation in Case

8.11E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg03408354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:7.71E-03; Z-score:1.64E+00

Methylation in Case

7.97E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg26907768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.27E+00 Statistic Test p-value:1.11E-02; Z-score:-1.77E+00

Methylation in Case

1.46E-01 (Median) Methylation in Control 1.84E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg07021906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.36E-02; Z-score:3.69E+00

Methylation in Case

9.60E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.37E-02; Z-score:2.37E+00

Methylation in Case

7.34E-01 (Median) Methylation in Control 6.47E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

Body (cg04802238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.67E-02; Z-score:-1.30E+00

Methylation in Case

8.18E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

3'UTR (cg03486383)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.23E-04; Z-score:-2.51E+00

Methylation in Case

8.94E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

3'UTR (cg00653312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.06E-03; Z-score:-2.75E+00

Methylation in Case

8.25E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC7A5 in bladder cancer [ 4 ]

Location

3'UTR (cg06071246)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.08E-02; Z-score:-7.88E-01

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         30 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

TSS1500 (cg02057598)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.04E-09; Z-score:2.27E+00

Methylation in Case

8.46E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

TSS1500 (cg12408911)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:3.97E-09; Z-score:2.41E+00

Methylation in Case

6.33E-01 (Median) Methylation in Control 5.49E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:6.05E-05; Z-score:1.57E+00

Methylation in Case

7.47E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

TSS1500 (cg09357483)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:7.24E-03; Z-score:5.47E-01

Methylation in Case

7.70E-01 (Median) Methylation in Control 6.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

1stExon (cg07067659)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.71E-02; Z-score:-1.03E-01

Methylation in Case

1.78E-02 (Median) Methylation in Control 1.92E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

1stExon (cg26695445)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.35E-02; Z-score:-1.92E-01

Methylation in Case

6.79E-02 (Median) Methylation in Control 7.28E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg06372223)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:3.22E-11; Z-score:-2.36E+00

Methylation in Case

5.37E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.47E+00 Statistic Test p-value:9.39E-11; Z-score:-2.25E+00

Methylation in Case

2.46E-01 (Median) Methylation in Control 3.62E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg27555036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.54E-09; Z-score:-1.94E+00

Methylation in Case

8.18E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg26637881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.73E-08; Z-score:2.02E+00

Methylation in Case

7.66E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg05834639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:1.46E-06; Z-score:-9.50E-01

Methylation in Case

6.27E-01 (Median) Methylation in Control 6.71E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg26619943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.92E-06; Z-score:-8.12E-01

Methylation in Case

8.21E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:1.77E-05; Z-score:-1.90E+00

Methylation in Case

6.00E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg02203067)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.49E-05; Z-score:-9.35E-01

Methylation in Case

7.70E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg26907768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:1.61E-04; Z-score:-1.12E+00

Methylation in Case

1.50E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.63E-04; Z-score:7.88E-01

Methylation in Case

8.10E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg07558761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:2.04E-04; Z-score:-1.22E+00

Methylation in Case

7.63E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg06665333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.37E-04; Z-score:7.94E-01

Methylation in Case

8.62E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg26529851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:4.27E-04; Z-score:1.67E+00

Methylation in Case

5.63E-01 (Median) Methylation in Control 4.74E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg02454636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:8.55E-04; Z-score:-1.17E+00

Methylation in Case

6.33E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg07021906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:2.61E-03; Z-score:-8.38E-01

Methylation in Case

8.84E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg01856752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.35E-02; Z-score:-4.66E-01

Methylation in Case

6.29E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:1.41E-02; Z-score:7.43E-01

Methylation in Case

7.48E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.87E-02; Z-score:-1.50E-01

Methylation in Case

7.32E-01 (Median) Methylation in Control 7.39E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

Body (cg06727993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.99E-02; Z-score:-2.49E-01

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

3'UTR (cg09618385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.43E-07; Z-score:1.06E+00

Methylation in Case

7.07E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

3'UTR (cg00653312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.06E-05; Z-score:-9.66E-01

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

3'UTR (cg06770731)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:4.09E-04; Z-score:-7.64E-01

Methylation in Case

9.43E-01 (Median) Methylation in Control 9.67E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

3'UTR (cg06071246)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.81E-03; Z-score:-4.94E-01

Methylation in Case

8.44E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC7A5 in breast cancer [ 5 ]

Location

3'UTR (cg08094280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.20E-02; Z-score:-5.10E-01

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in clear cell renal cell carcinoma [ 6 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:7.30E-04; Z-score:-1.77E+00

Methylation in Case

5.74E-01 (Median) Methylation in Control 6.65E-01 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in clear cell renal cell carcinoma [ 6 ]

Location

1stExon (cg07067659)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.83E-02; Z-score:1.49E-01

Methylation in Case

1.81E-02 (Median) Methylation in Control 1.74E-02 (Median)

Studied Phenotype

Renal cell carcinoma[ ICD-11:2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

         25 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.28E+00 Statistic Test p-value:4.57E-11; Z-score:-2.33E+00

Methylation in Case

6.63E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

TSS1500 (cg02057598)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.00E-09; Z-score:-2.13E+00

Methylation in Case

7.83E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

TSS1500 (cg12408911)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.24E-02; Z-score:-4.20E-01

Methylation in Case

8.28E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

TSS1500 (cg09357483)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.44E+00 Statistic Test p-value:4.26E-02; Z-score:-9.61E-01

Methylation in Case

4.89E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

TSS200 (cg00728300)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.83E+00 Statistic Test p-value:2.03E-08; Z-score:-1.80E+00

Methylation in Case

1.93E-01 (Median) Methylation in Control 3.54E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

TSS200 (cg08710629)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.87E+00 Statistic Test p-value:2.28E-06; Z-score:-1.64E+00

Methylation in Case

9.50E-02 (Median) Methylation in Control 2.73E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.62E+00 Statistic Test p-value:5.25E-08; Z-score:-1.85E+00

Methylation in Case

3.36E-01 (Median) Methylation in Control 5.43E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:7.57E-07; Z-score:-1.01E+00

Methylation in Case

8.99E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg05393733)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.34E-04; Z-score:-6.58E-01

Methylation in Case

9.14E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:5.25E-04; Z-score:-4.84E-01

Methylation in Case

9.03E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg05834639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.00E-03; Z-score:-1.12E+00

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg27560818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.24E-03; Z-score:-3.62E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.52E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:5.20E-03; Z-score:-6.82E-01

Methylation in Case

8.98E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg03553613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.61E-03; Z-score:-7.29E-01

Methylation in Case

9.06E-01 (Median) Methylation in Control 9.38E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg06727993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:8.84E-03; Z-score:-1.78E-01

Methylation in Case

9.31E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg04802238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:1.06E-02; Z-score:1.12E-01

Methylation in Case

9.40E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg08617020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.08E-02; Z-score:-6.72E-01

Methylation in Case

8.07E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg02203067)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.96E-02; Z-score:-3.61E-01

Methylation in Case

8.97E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg02614661)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:2.20E-02; Z-score:-1.10E-01

Methylation in Case

8.97E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg26907768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:2.76E-02; Z-score:-3.72E-01

Methylation in Case

2.22E-01 (Median) Methylation in Control 2.36E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

Body (cg03408354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:5.00E-02; Z-score:-5.97E-02

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

3'UTR (cg00653312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.22E-04; Z-score:-9.76E-01

Methylation in Case

8.53E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

3'UTR (cg09618385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:5.22E-03; Z-score:-1.94E-01

Methylation in Case

8.74E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

3'UTR (cg27135163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:7.91E-03; Z-score:5.93E-01

Methylation in Case

9.50E-01 (Median) Methylation in Control 9.38E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in colorectal cancer [ 7 ]

Location

3'UTR (cg08094280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:1.57E-02; Z-score:-2.69E-01

Methylation in Case

9.28E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  HIV infection

         24 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

TSS1500 (cg02057598)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.18E+00 Statistic Test p-value:1.40E-19; Z-score:2.73E+00

Methylation in Case

8.74E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.47E+00 Statistic Test p-value:1.82E-12; Z-score:3.99E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 5.11E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

TSS1500 (cg09357483)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:2.20E-06; Z-score:6.78E-01

Methylation in Case

9.57E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

TSS1500 (cg12408911)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:1.32E-04; Z-score:1.13E+00

Methylation in Case

7.11E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg07021906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.24E+00 Statistic Test p-value:1.20E-18; Z-score:3.23E+00

Methylation in Case

8.52E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg02203067)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.25E+00 Statistic Test p-value:6.66E-14; Z-score:2.68E+00

Methylation in Case

7.14E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg26569315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.58E-13; Z-score:1.33E+00

Methylation in Case

9.89E-01 (Median) Methylation in Control 9.70E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg26529851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:7.38E-12; Z-score:1.06E+00

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg07558761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:8.41E-11; Z-score:1.73E+00

Methylation in Case

8.03E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:3.48E-10; Z-score:1.29E+00

Methylation in Case

8.85E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:6.24E-06; Z-score:9.73E-01

Methylation in Case

9.15E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg08860287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.16E-05; Z-score:1.16E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg26637881)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:7.55E-05; Z-score:1.02E+00

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg03408354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.50E-04; Z-score:4.00E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.19E+00 Statistic Test p-value:1.17E-03; Z-score:1.31E+00

Methylation in Case

1.80E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg27555036)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.07E-03; Z-score:-8.35E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg08401758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:2.02E-02; Z-score:7.62E-01

Methylation in Case

1.71E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg04802238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:2.22E-02; Z-score:1.51E-01

Methylation in Case

8.52E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg06727993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:3.01E-02; Z-score:5.40E-01

Methylation in Case

8.59E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg26982544)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:3.53E-02; Z-score:8.21E-01

Methylation in Case

1.40E-01 (Median) Methylation in Control 9.64E-02 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:4.24E-02; Z-score:4.81E-01

Methylation in Case

8.48E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

3'UTR (cg00653312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.83E-02; Z-score:-7.63E-01

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

3'UTR (cg08094280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.61E-02; Z-score:6.14E-01

Methylation in Case

8.47E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in HIV infection [ 8 ]

Location

3'UTR (cg06770731)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.25E-02; Z-score:-5.72E-01

Methylation in Case

9.65E-01 (Median) Methylation in Control 9.73E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in panic disorder [ 9 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-5.56E-01 Statistic Test p-value:3.09E-02; Z-score:-4.22E-01

Methylation in Case

-4.15E-01 (Median) Methylation in Control -2.31E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in panic disorder [ 9 ]

Location

Body (cg07021906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:2.53E-03; Z-score:-4.45E-01

Methylation in Case

7.24E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in panic disorder [ 9 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:9.00E-03; Z-score:5.16E-01

Methylation in Case

2.02E+00 (Median) Methylation in Control 1.84E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in panic disorder [ 9 ]

Location

Body (cg00069417)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.96E-02; Z-score:4.78E-01

Methylation in Case

3.05E+00 (Median) Methylation in Control 2.81E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

         26 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

TSS1500 (cg00858400)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:1.46E-12; Z-score:-2.26E+00

Methylation in Case

8.85E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

TSS200 (cg08710629)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:2.51E-07; Z-score:1.71E+00

Methylation in Case

2.76E-01 (Median) Methylation in Control 2.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.85E+00 Statistic Test p-value:1.03E-21; Z-score:-3.31E+00

Methylation in Case

1.75E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg08617020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:7.70E-13; Z-score:-2.46E+00

Methylation in Case

6.63E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg06665333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:3.83E-11; Z-score:1.41E+00

Methylation in Case

8.30E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg10099957)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:7.21E-08; Z-score:1.11E+00

Methylation in Case

9.41E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg07558761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.03E-07; Z-score:-1.32E+00

Methylation in Case

8.77E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.15E+00 Statistic Test p-value:6.32E-07; Z-score:1.35E+00

Methylation in Case

6.66E-01 (Median) Methylation in Control 5.79E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg08401758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.34E+00 Statistic Test p-value:6.93E-07; Z-score:-7.40E-01

Methylation in Case

7.79E-02 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg26569315)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:3.50E-06; Z-score:-1.39E+00

Methylation in Case

5.94E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg02203067)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:4.22E-05; Z-score:-7.72E-01

Methylation in Case

9.01E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg03801429)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:6.87E-05; Z-score:-7.39E-01

Methylation in Case

8.31E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg27560818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:7.89E-05; Z-score:-7.80E-01

Methylation in Case

9.47E-01 (Median) Methylation in Control 9.55E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:9.56E-05; Z-score:1.14E+00

Methylation in Case

8.15E-01 (Median) Methylation in Control 7.75E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg07021906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:2.13E-04; Z-score:-8.86E-01

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg26619943)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.21E-03; Z-score:-8.41E-01

Methylation in Case

9.19E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg26982544)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.42E+00 Statistic Test p-value:6.00E-03; Z-score:-6.47E-01

Methylation in Case

4.53E-02 (Median) Methylation in Control 6.43E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg06727993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.54E-02; Z-score:-6.40E-01

Methylation in Case

9.09E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg05834639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.61E-02; Z-score:5.45E-01

Methylation in Case

7.21E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:2.00E-02; Z-score:-6.30E-01

Methylation in Case

7.90E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg03408354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.29E-02; Z-score:6.06E-01

Methylation in Case

7.85E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.31E-02; Z-score:-4.32E-01

Methylation in Case

8.45E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

Body (cg04802238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.35E-02; Z-score:-5.80E-01

Methylation in Case

8.93E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

3'UTR (cg06770731)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.12E+00 Statistic Test p-value:9.46E-04; Z-score:1.00E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

3'UTR (cg06071246)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.16E+00 Statistic Test p-value:2.38E-03; Z-score:8.82E-01

Methylation in Case

7.04E-01 (Median) Methylation in Control 6.05E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC7A5 in papillary thyroid cancer [ 10 ]

Location

3'UTR (cg00653312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:2.76E-02; Z-score:6.51E-01

Methylation in Case

6.59E-01 (Median) Methylation in Control 6.12E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Prostate cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

TSS1500 (cg11123744)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.44E+00 Statistic Test p-value:4.26E-02; Z-score:-1.57E+00

Methylation in Case

2.79E-01 (Median) Methylation in Control 4.02E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

TSS200 (cg13438631)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.54E+00 Statistic Test p-value:2.27E-02; Z-score:-1.85E+00

Methylation in Case

2.01E-02 (Median) Methylation in Control 3.10E-02 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

Body (cg06888094)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.91E+00 Statistic Test p-value:3.15E-04; Z-score:6.54E+00

Methylation in Case

4.98E-01 (Median) Methylation in Control 2.61E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

Body (cg02606369)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.20E+00 Statistic Test p-value:2.98E-02; Z-score:6.59E+00

Methylation in Case

6.05E-01 (Median) Methylation in Control 5.04E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

Body (cg22689016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.58E+00 Statistic Test p-value:3.11E-02; Z-score:-4.61E+00

Methylation in Case

3.45E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

Body (cg14224786)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:3.63E-02; Z-score:5.06E+00

Methylation in Case

7.01E-01 (Median) Methylation in Control 5.77E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in prostate cancer [ 11 ]

Location

3'UTR (cg19991086)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.02E-02; Z-score:1.59E+00

Methylation in Case

8.96E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

         42 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

1stExon (cg07067659)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.57E+00 Statistic Test p-value:2.23E-21; Z-score:3.12E+00

Methylation in Case

7.62E-01 (Median) Methylation in Control 4.85E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

1stExon (cg26695445)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:5.93E-16; Z-score:-3.34E+00

Methylation in Case

8.24E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg00069417)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.61E-05; Z-score:-1.04E+00

Methylation in Case

7.21E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:8.94E-05; Z-score:9.16E-01

Methylation in Case

7.57E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg01856752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:9.06E-05; Z-score:-8.04E-01

Methylation in Case

7.71E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg02203067)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:1.22E-04; Z-score:1.09E+00

Methylation in Case

8.36E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg02454636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.63E-04; Z-score:8.92E-01

Methylation in Case

9.14E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg02614661)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.86E-04; Z-score:-5.38E-01

Methylation in Case

8.74E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg03408354)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:3.26E-04; Z-score:1.18E+00

Methylation in Case

8.40E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg03553613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:3.67E-04; Z-score:1.07E+00

Methylation in Case

7.41E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg03801429)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.33E-04; Z-score:-6.40E-01

Methylation in Case

7.81E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.14E+00 Statistic Test p-value:4.41E-04; Z-score:-9.18E-01

Methylation in Case

6.80E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg03879320)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.14E+00 Statistic Test p-value:4.52E-04; Z-score:8.35E-01

Methylation in Case

6.37E-01 (Median) Methylation in Control 5.58E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:5.92E-04; Z-score:1.13E+00

Methylation in Case

6.88E-01 (Median) Methylation in Control 5.88E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04264781)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.33E+00 Statistic Test p-value:6.57E-04; Z-score:6.25E-01

Methylation in Case

3.03E-01 (Median) Methylation in Control 2.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04802238)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.29E+00 Statistic Test p-value:9.54E-04; Z-score:-5.36E-01

Methylation in Case

5.63E-02 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04963199)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.68E+00 Statistic Test p-value:1.03E-03; Z-score:-8.06E-01

Methylation in Case

1.82E-01 (Median) Methylation in Control 3.05E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05393733)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.08E+00 Statistic Test p-value:1.42E-03; Z-score:5.20E-01

Methylation in Case

8.80E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05834639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:1.69E-03; Z-score:-8.13E-01

Methylation in Case

6.27E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:1.81E-03; Z-score:-6.89E-01

Methylation in Case

9.03E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06372223)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:2.44E-03; Z-score:8.14E-01

Methylation in Case

8.81E-01 (Median) Methylation in Control 8.37E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon22

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06492111)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.48E-03; Z-score:-5.39E-01

Methylation in Case

7.73E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon23

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06665333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:2.79E-03; Z-score:5.64E-01

Methylation in Case

2.78E-01 (Median) Methylation in Control 2.15E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon24

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06727993)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.91E-03; Z-score:4.48E-01

Methylation in Case

1.08E-01 (Median) Methylation in Control 9.73E-02 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon25

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06867910)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:2.99E-03; Z-score:-7.92E-01

Methylation in Case

6.17E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon26

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07021906)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.24E-03; Z-score:-3.61E-01

Methylation in Case

6.80E-01 (Median) Methylation in Control 7.15E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon27

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07558761)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:4.29E-03; Z-score:-5.41E-01

Methylation in Case

8.13E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon28

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg08401758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.18E+00 Statistic Test p-value:6.12E-03; Z-score:-6.96E-01

Methylation in Case

1.03E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon29

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg08617020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-3.26E+00 Statistic Test p-value:7.64E-03; Z-score:-5.74E-01

Methylation in Case

3.42E-02 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon30

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg08860287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:8.54E-03; Z-score:6.60E-01

Methylation in Case

8.81E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon31

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg09285525)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:9.77E-03; Z-score:-3.02E-01

Methylation in Case

6.70E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon32

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg10099957)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.08E+00 Statistic Test p-value:1.36E-02; Z-score:-3.01E-01

Methylation in Case

4.99E-01 (Median) Methylation in Control 5.37E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon33

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg10169763)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.40E-02; Z-score:-2.60E-01

Methylation in Case

8.52E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon34

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg00653312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:1.19E-15; Z-score:-3.65E+00

Methylation in Case

8.42E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon35

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg03486383)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.78E+00 Statistic Test p-value:1.18E-14; Z-score:-2.59E+00

Methylation in Case

2.13E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon36

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg04481596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.86E-14; Z-score:-3.09E+00

Methylation in Case

8.23E-01 (Median) Methylation in Control 9.34E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon37

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg06071246)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.41E+00 Statistic Test p-value:6.17E-14; Z-score:2.20E+00

Methylation in Case

7.37E-01 (Median) Methylation in Control 5.21E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon38

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg06770731)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.82E+00 Statistic Test p-value:1.73E-13; Z-score:-2.34E+00

Methylation in Case

3.38E-01 (Median) Methylation in Control 6.14E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon39

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg08094280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.93E+00 Statistic Test p-value:3.78E-13; Z-score:-1.95E+00

Methylation in Case

3.00E-01 (Median) Methylation in Control 5.78E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon40

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg09618385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.62E+00 Statistic Test p-value:1.41E-12; Z-score:-1.95E+00

Methylation in Case

3.59E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon41

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg10034481)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.33E+00 Statistic Test p-value:2.06E-12; Z-score:-2.00E+00

Methylation in Case

6.02E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon42

Methylation of SLC7A5 in atypical teratoid rhabdoid tumor [ 12 ]

Location

3'UTR (cg27135163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:3.32E-09; Z-score:-1.59E+00

Methylation in Case

7.50E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Celiac disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in celiac disease [ 13 ]

Location

Body (cg05834639)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:4.43E-02; Z-score:-3.71E-01

Methylation in Case

7.20E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Celiac disease[ ICD-11:DA95]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in colon adenocarcinoma [ 14 ]

Location

Body (cg16925177)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.21E+00 Statistic Test p-value:1.51E-04; Z-score:-3.72E+00

Methylation in Case

6.90E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Colon cancer[ ICD-11:2B90]

Experimental Material

Patient tissue samples

  Depression

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in depression [ 15 ]

Location

Body (cg10169763)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:2.33E-02; Z-score:3.88E-01

Methylation in Case

8.67E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in depression [ 15 ]

Location

Body (cg05393733)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:3.66E-02; Z-score:-5.58E-01

Methylation in Case

8.98E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Depression[ ICD-11:6A8Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

         21 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg01829163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:2.52E-04; Z-score:2.43E+00

Methylation in Case

9.06E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg05911082)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:4.52E-04; Z-score:2.00E+00

Methylation in Case

8.27E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg06665333)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:6.60E-04; Z-score:2.21E+00

Methylation in Case

9.14E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg06372223)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:7.37E-04; Z-score:-3.56E+00

Methylation in Case

6.87E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg03553613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.09E+00 Statistic Test p-value:1.02E-03; Z-score:1.55E+00

Methylation in Case

8.44E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg10099957)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.10E-03; Z-score:2.88E+00

Methylation in Case

9.34E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg00069417)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:1.35E-03; Z-score:1.75E+00

Methylation in Case

8.84E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg08860287)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.44E-03; Z-score:1.78E+00

Methylation in Case

7.42E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg26907768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.16E+00 Statistic Test p-value:3.05E-03; Z-score:-1.95E+00

Methylation in Case

1.79E-01 (Median) Methylation in Control 2.07E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg03850117)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.32E+00 Statistic Test p-value:3.90E-03; Z-score:-5.21E+00

Methylation in Case

3.40E-01 (Median) Methylation in Control 4.50E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg04171052)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:7.26E-03; Z-score:8.44E-01

Methylation in Case

8.06E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg02454636)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:8.67E-03; Z-score:1.16E+00

Methylation in Case

7.35E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg26529851)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.22E+00 Statistic Test p-value:1.54E-02; Z-score:4.05E+00

Methylation in Case

7.11E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg26982544)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.45E+00 Statistic Test p-value:1.96E-02; Z-score:2.84E+00

Methylation in Case

1.50E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg05393733)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.01E+00 Statistic Test p-value:1.97E-02; Z-score:8.46E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg08401758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:3.96E-02; Z-score:1.95E+00

Methylation in Case

1.87E-01 (Median) Methylation in Control 1.37E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

Body (cg01856752)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.05E+00 Statistic Test p-value:4.85E-02; Z-score:1.07E+00

Methylation in Case

8.12E-01 (Median) Methylation in Control 7.71E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon18

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

3'UTR (cg09618385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:8.68E-04; Z-score:1.85E+00

Methylation in Case

7.44E-01 (Median) Methylation in Control 6.72E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon19

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

3'UTR (cg04481596)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:2.89E-02; Z-score:7.18E-01

Methylation in Case

9.02E-01 (Median) Methylation in Control 8.82E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon20

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

3'UTR (cg08094280)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:3.36E-02; Z-score:7.30E-01

Methylation in Case

8.58E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon21

Methylation of SLC7A5 in lung adenocarcinoma [ 16 ]

Location

3'UTR (cg06770731)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.67E-02; Z-score:-2.69E+00

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.59E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg26907768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.96E-04; Z-score:-2.74E-01

Methylation in Case

1.90E-01 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg09285525)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:2.07E-03; Z-score:-2.35E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg06867910)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.10E+00 Statistic Test p-value:2.74E-03; Z-score:2.33E-01

Methylation in Case

1.62E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg06372223)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.04E-03; Z-score:-2.32E-01

Methylation in Case

6.74E-01 (Median) Methylation in Control 6.97E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg08401758)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.09E-02; Z-score:2.64E-01

Methylation in Case

2.35E-01 (Median) Methylation in Control 2.09E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg27560818)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:2.54E-02; Z-score:-9.08E-02

Methylation in Case

9.37E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg08617020)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:3.00E-02; Z-score:-2.78E-01

Methylation in Case

7.96E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

Body (cg03553613)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:4.91E-02; Z-score:-1.63E-01

Methylation in Case

9.01E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A5 in systemic lupus erythematosus [ 17 ]

Location

3'UTR (cg27135163)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.00E+00 Statistic Test p-value:4.26E-04; Z-score:9.39E-03

Methylation in Case

9.21E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

microRNA

  Small cell lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-126 in small cell lung cancer [ 18 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC7A5 Experiment Method Western Blot

miRNA Stemloop ID

miR-126 miRNA Mature ID miR-126-3p

miRNA Sequence

UCGUACCGUGAGUAAUAAUGCG

miRNA Target Type

Direct

Studied Phenotype

Small cell lung cancer[ ICD-11:2C25.1]

Experimental Material

Multiple cell lines of human

Additional Notes

Overexpression of miR-126 suppresses SLC7A5 expression at both the RNA and the protein level.

  Gastric cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Lower expression of miR-126 in small gastric cancer [ 19 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC7A5 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-126 miRNA Mature ID miR-126-3p

miRNA Sequence

UCGUACCGUGAGUAAUAAUGCG

miRNA Target Type

Direct

Studied Phenotype

Gastric cancer[ ICD-11:2B72]

Experimental Material

Multiple cell lines of human

Additional Notes

miR-126 was down-regulated in gastric cancer and regulated SLC7A5 expression via binding to the SLC7A5 mRNA.

  Thyroid cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-193a-3p regulates SLC7A5 in thyroid carcinoma [ 20 ]

Epigenetic Type

microRNA Experiment Method Dual-luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC7A5 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-193a miRNA Mature ID miR-193a-3p

miRNA Sequence

AACUGGCCUACAAAGUCCCAGU

miRNA Target Type

Direct

Studied Phenotype

Thyroid cancer[ ICD-11:2D10]

Experimental Material

Multiple cell lines of human

Additional Notes

miR-193a-3p regulates SLC7A5 expression via binding to the SLC7A5 mRNA.

  Unclear Phenotype

       256 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-122 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon2

miR-1224 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-1226 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1226 miRNA Mature ID miR-1226-5p

miRNA Sequence

GUGAGGGCAUGCAGGCCUGGAUGGGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon4

miR-1227 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1227 miRNA Mature ID miR-1227-5p

miRNA Sequence

GUGGGGCCAGGCGGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-1237 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1237 miRNA Mature ID miR-1237-5p

miRNA Sequence

CGGGGGCGGGGCCGAAGCGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon6

miR-1249 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1249 miRNA Mature ID miR-1249-5p

miRNA Sequence

AGGAGGGAGGAGAUGGGCCAAGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon7

miR-1255a directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1255a miRNA Mature ID miR-1255a

miRNA Sequence

AGGAUGAGCAAAGAAAGUAGAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon8

miR-1255b directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1255b miRNA Mature ID miR-1255b-5p

miRNA Sequence

CGGAUGAGCAAAGAAAGUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon9

miR-1260a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1260a miRNA Mature ID miR-1260a

miRNA Sequence

AUCCCACCUCUGCCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-1260b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

AUCCCACCACUGCCACCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon11

miR-1264 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1264 miRNA Mature ID miR-1264

miRNA Sequence

CAAGUCUUAUUUGAGCACCUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-1273h directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1273h miRNA Mature ID miR-1273h-5p

miRNA Sequence

CUGGGAGGUCAAGGCUGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon13

miR-1285 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1285 miRNA Mature ID miR-1285-3p

miRNA Sequence

UCUGGGCAACAAAGUGAGACCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-1292 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1292 miRNA Mature ID miR-1292-5p

miRNA Sequence

UGGGAACGGGUUCCGGCAGACGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon15

miR-1295a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1295a miRNA Mature ID miR-1295a

miRNA Sequence

UUAGGCCGCAGAUCUGGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-132 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-132 miRNA Mature ID miR-132-5p

miRNA Sequence

ACCGUGGCUUUCGAUUGUUACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon17

miR-140 directly targets SLC7A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-140 miRNA Mature ID miR-140-3p

miRNA Sequence

UACCACAGGGUAGAACCACGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-149 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-1539 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1539 miRNA Mature ID miR-1539

miRNA Sequence

UCCUGCGCGUCCCAGAUGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon20

miR-15a directly targets SLC7A5 [ 25 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon21

miR-15b directly targets SLC7A5 [ 25 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-16 directly targets SLC7A5 [ 25 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-184 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-184 miRNA Mature ID miR-184

miRNA Sequence

UGGACGGAGAACUGAUAAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-185 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-185 miRNA Mature ID miR-185-3p

miRNA Sequence

AGGGGCUGGCUUUCCUCUGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-186 directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-1908 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1908 miRNA Mature ID miR-1908-5p

miRNA Sequence

CGGCGGGGACGGCGAUUGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon27

miR-193a directly targets SLC7A5 [ 20 ]

Epigenetic Type

microRNA Experiment Method Immunoflourescence//Luciferase reporter assay//qRT-PCR//Western blot

miRNA Stemloop ID

miR-193a miRNA Mature ID miR-193a-3p

miRNA Sequence

AACUGGCCUACAAAGUCCCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon28

miR-193b directly targets SLC7A5 [ 27 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-194 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-194 miRNA Mature ID miR-194-3p

miRNA Sequence

CCAGUGGGGCUGCUGUUAUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-195 directly targets SLC7A5 [ 25 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-205 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-205 miRNA Mature ID miR-205-3p

miRNA Sequence

GAUUUCAGUGGAGUGAAGUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-214 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-214 miRNA Mature ID miR-214-3p

miRNA Sequence

ACAGCAGGCACAGACAGGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-219b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-219b miRNA Mature ID miR-219b-5p

miRNA Sequence

AGAUGUCCAGCCACAAUUCUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-22 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-22 miRNA Mature ID miR-22-3p

miRNA Sequence

AAGCUGCCAGUUGAAGAACUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon35

miR-223 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-223 miRNA Mature ID miR-223-3p

miRNA Sequence

UGUCAGUUUGUCAAAUACCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon36

miR-24-1 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-24-1 miRNA Mature ID miR-24-1-5p

miRNA Sequence

UGCCUACUGAGCUGAUAUCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon37

miR-24-2 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-24-2 miRNA Mature ID miR-24-2-5p

miRNA Sequence

UGCCUACUGAGCUGAAACACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon38

miR-28 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-28 miRNA Mature ID miR-28-5p

miRNA Sequence

AAGGAGCUCACAGUCUAUUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon39

miR-296 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-296 miRNA Mature ID miR-296-5p

miRNA Sequence

AGGGCCCCCCCUCAAUCCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon40

miR-296 directly targets SLC7A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-296 miRNA Mature ID miR-296-3p

miRNA Sequence

GAGGGUUGGGUGGAGGCUCUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon41

miR-3065 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3065 miRNA Mature ID miR-3065-3p

miRNA Sequence

UCAGCACCAGGAUAUUGUUGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon42

miR-30a directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-30b directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-5p

miRNA Sequence

UGUAAACAUCCUACACUCAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-30b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-3p

miRNA Sequence

CUGGGAGGUGGAUGUUUACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon45

miR-30c directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30c miRNA Mature ID miR-30c-5p

miRNA Sequence

UGUAAACAUCCUACACUCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon46

miR-30d directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30d miRNA Mature ID miR-30d-5p

miRNA Sequence

UGUAAACAUCCCCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon47

miR-30e directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-30e miRNA Mature ID miR-30e-5p

miRNA Sequence

UGUAAACAUCCUUGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-3126 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3126 miRNA Mature ID miR-3126-5p

miRNA Sequence

UGAGGGACAGAUGCCAGAAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon49

miR-3133 directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3133 miRNA Mature ID miR-3133

miRNA Sequence

UAAAGAACUCUUAAAACCCAAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon50

miR-3135a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3135a miRNA Mature ID miR-3135a

miRNA Sequence

UGCCUAGGCUGAGACUGCAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-3136 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3136 miRNA Mature ID miR-3136-3p

miRNA Sequence

UGGCCCAACCUAUUCAGUUAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-3139 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3139 miRNA Mature ID miR-3139

miRNA Sequence

UAGGAGCUCAACAGAUGCCUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon53

miR-3148 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3148 miRNA Mature ID miR-3148

miRNA Sequence

UGGAAAAAACUGGUGUGUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon54

miR-3154 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3154 miRNA Mature ID miR-3154

miRNA Sequence

CAGAAGGGGAGUUGGGAGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon55

miR-3155a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3155a miRNA Mature ID miR-3155a

miRNA Sequence

CCAGGCUCUGCAGUGGGAACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon56

miR-3155b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3155b miRNA Mature ID miR-3155b

miRNA Sequence

CCAGGCUCUGCAGUGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon57

miR-3173 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3173 miRNA Mature ID miR-3173-3p

miRNA Sequence

AAAGGAGGAAAUAGGCAGGCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon58

miR-3179 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3179 miRNA Mature ID miR-3179

miRNA Sequence

AGAAGGGGUGAAAUUUAAACGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-3180 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3180 miRNA Mature ID miR-3180

miRNA Sequence

UGGGGCGGAGCUUCCGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon60

miR-3180 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3180 miRNA Mature ID miR-3180-3p

miRNA Sequence

UGGGGCGGAGCUUCCGGAGGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-3187 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-3p

miRNA Sequence

UUGGCCAUGGGGCUGCGCGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-3187 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3187 miRNA Mature ID miR-3187-5p

miRNA Sequence

CCUGGGCAGCGUGUGGCUGAAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-3189 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3189 miRNA Mature ID miR-3189-3p

miRNA Sequence

CCCUUGGGUCUGAUGGGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-3192 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3192 miRNA Mature ID miR-3192-5p

miRNA Sequence

UCUGGGAGGUUGUAGCAGUGGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon65

miR-3196 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3196 miRNA Mature ID miR-3196

miRNA Sequence

CGGGGCGGCAGGGGCCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-3199 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3199 miRNA Mature ID miR-3199

miRNA Sequence

AGGGACUGCCUUAGGAGAAAGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon67

miR-3202 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3202 miRNA Mature ID miR-3202

miRNA Sequence

UGGAAGGGAGAAGAGCUUUAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-338 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-338 miRNA Mature ID miR-338-3p

miRNA Sequence

UCCAGCAUCAGUGAUUUUGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon69

miR-33a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-33a miRNA Mature ID miR-33a-5p

miRNA Sequence

GUGCAUUGUAGUUGCAUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon70

miR-33b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-33b miRNA Mature ID miR-33b-5p

miRNA Sequence

GUGCAUUGCUGUUGCAUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon71

miR-3611 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3611 miRNA Mature ID miR-3611

miRNA Sequence

UUGUGAAGAAAGAAAUUCUUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon72

miR-3612 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3612 miRNA Mature ID miR-3612

miRNA Sequence

AGGAGGCAUCUUGAGAAAUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon73

miR-3619 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3619 miRNA Mature ID miR-3619-5p

miRNA Sequence

UCAGCAGGCAGGCUGGUGCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon74

miR-3661 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3661 miRNA Mature ID miR-3661

miRNA Sequence

UGACCUGGGACUCGGACAGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon75

miR-3664 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3664 miRNA Mature ID miR-3664-3p

miRNA Sequence

UCUCAGGAGUAAAGACAGAGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon76

miR-3689a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689a miRNA Mature ID miR-3689a-3p

miRNA Sequence

CUGGGAGGUGUGAUAUCGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon77

miR-3689b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689b miRNA Mature ID miR-3689b-3p

miRNA Sequence

CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon78

miR-3689c directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689c miRNA Mature ID miR-3689c

miRNA Sequence

CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon79

miR-3689d directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon80

miR-383 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-383 miRNA Mature ID miR-383-3p

miRNA Sequence

ACAGCACUGCCUGGUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon81

miR-3911 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3911 miRNA Mature ID miR-3911

miRNA Sequence

UGUGUGGAUCCUGGAGGAGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon82

miR-3929 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon83

miR-3934 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3934 miRNA Mature ID miR-3934-3p

miRNA Sequence

UGCUCAGGUUGCACAGCUGGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon84

miR-3937 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3937 miRNA Mature ID miR-3937

miRNA Sequence

ACAGGCGGCUGUAGCAAUGGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon85

miR-4260 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4260 miRNA Mature ID miR-4260

miRNA Sequence

CUUGGGGCAUGGAGUCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon86

miR-4264 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4264 miRNA Mature ID miR-4264

miRNA Sequence

ACUCAGUCAUGGUCAUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon87

miR-4267 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4267 miRNA Mature ID miR-4267

miRNA Sequence

UCCAGCUCGGUGGCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon88

miR-4270 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4270 miRNA Mature ID miR-4270

miRNA Sequence

UCAGGGAGUCAGGGGAGGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon89

miR-4271 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4271 miRNA Mature ID miR-4271

miRNA Sequence

GGGGGAAGAAAAGGUGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon90

miR-4285 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4285 miRNA Mature ID miR-4285

miRNA Sequence

GCGGCGAGUCCGACUCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon91

miR-4302 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4302 miRNA Mature ID miR-4302

miRNA Sequence

CCAGUGUGGCUCAGCGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon92

miR-4434 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4434 miRNA Mature ID miR-4434

miRNA Sequence

AGGAGAAGUAAAGUAGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon93

miR-4435 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4435 miRNA Mature ID miR-4435

miRNA Sequence

AUGGCCAGAGCUCACACAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon94

miR-4436a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4436a miRNA Mature ID miR-4436a

miRNA Sequence

GCAGGACAGGCAGAAGUGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon95

miR-4441 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4441 miRNA Mature ID miR-4441

miRNA Sequence

ACAGGGAGGAGAUUGUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon96

miR-4443 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4443 miRNA Mature ID miR-4443

miRNA Sequence

UUGGAGGCGUGGGUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon97

miR-4471 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4471 miRNA Mature ID miR-4471

miRNA Sequence

UGGGAACUUAGUAGAGGUUUAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon98

miR-4475 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4475 miRNA Mature ID miR-4475

miRNA Sequence

CAAGGGACCAAGCAUUCAUUAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon99

miR-4476 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4476 miRNA Mature ID miR-4476

miRNA Sequence

CAGGAAGGAUUUAGGGACAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon100

miR-4478 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

GAGGCUGAGCUGAGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon101

miR-4481 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4481 miRNA Mature ID miR-4481

miRNA Sequence

GGAGUGGGCUGGUGGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon102

miR-4488 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4488 miRNA Mature ID miR-4488

miRNA Sequence

AGGGGGCGGGCUCCGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon103

miR-449b directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-449b miRNA Mature ID miR-449b-3p

miRNA Sequence

CAGCCACAACUACCCUGCCACU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon104

miR-4510 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4510 miRNA Mature ID miR-4510

miRNA Sequence

UGAGGGAGUAGGAUGUAUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon105

miR-4515 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4515 miRNA Mature ID miR-4515

miRNA Sequence

AGGACUGGACUCCCGGCAGCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon106

miR-4516 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4516 miRNA Mature ID miR-4516

miRNA Sequence

GGGAGAAGGGUCGGGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon107

miR-4530 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4530 miRNA Mature ID miR-4530

miRNA Sequence

CCCAGCAGGACGGGAGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon108

miR-4531 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4531 miRNA Mature ID miR-4531

miRNA Sequence

AUGGAGAAGGCUUCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon109

miR-4650 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4650 miRNA Mature ID miR-4650-5p

miRNA Sequence

UCAGGCCUCUUUCUACCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon110

miR-4663 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4663 miRNA Mature ID miR-4663

miRNA Sequence

AGCUGAGCUCCAUGGACGUGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon111

miR-4668 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4668 miRNA Mature ID miR-4668-5p

miRNA Sequence

AGGGAAAAAAAAAAGGAUUUGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon112

miR-4690 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4690 miRNA Mature ID miR-4690-5p

miRNA Sequence

GAGCAGGCGAGGCUGGGCUGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon113

miR-4691 directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4691 miRNA Mature ID miR-4691-3p

miRNA Sequence

CCAGCCACGGACUGAGAGUGCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon114

miR-4697 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4697 miRNA Mature ID miR-4697-3p

miRNA Sequence

UGUCAGUGACUCCUGCCCCUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon115

miR-4697 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4697 miRNA Mature ID miR-4697-5p

miRNA Sequence

AGGGGGCGCAGUCACUGACGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon116

miR-4700 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4700 miRNA Mature ID miR-4700-3p

miRNA Sequence

CACAGGACUGACUCCUCACCCCAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon117

miR-4701 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4701 miRNA Mature ID miR-4701-5p

miRNA Sequence

UUGGCCACCACACCUACCCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon118

miR-4704 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4704 miRNA Mature ID miR-4704-3p

miRNA Sequence

UCAGUCACAUAUCUAGUGUCUA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon119

miR-4706 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4706 miRNA Mature ID miR-4706

miRNA Sequence

AGCGGGGAGGAAGUGGGCGCUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon120

miR-4711 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4711 miRNA Mature ID miR-4711-5p

miRNA Sequence

UGCAUCAGGCCAGAAGACAUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon121

miR-4716 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4716 miRNA Mature ID miR-4716-3p

miRNA Sequence

AAGGGGGAAGGAAACAUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon122

miR-4722 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon123

miR-4723 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4723 miRNA Mature ID miR-4723-5p

miRNA Sequence

UGGGGGAGCCAUGAGAUAAGAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon124

miR-4725 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4725 miRNA Mature ID miR-4725-3p

miRNA Sequence

UGGGGAAGGCGUCAGUGUCGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon125

miR-4728 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon126

miR-4734 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4734 miRNA Mature ID miR-4734

miRNA Sequence

GCUGCGGGCUGCGGUCAGGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon127

miR-4745 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4745 miRNA Mature ID miR-4745-5p

miRNA Sequence

UGAGUGGGGCUCCCGGGACGGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon128

miR-4747 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4747 miRNA Mature ID miR-4747-5p

miRNA Sequence

AGGGAAGGAGGCUUGGUCUUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon129

miR-4749 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4749 miRNA Mature ID miR-4749-5p

miRNA Sequence

UGCGGGGACAGGCCAGGGCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon130

miR-4755 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon131

miR-4779 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4779 miRNA Mature ID miR-4779

miRNA Sequence

UAGGAGGGAAUAGUAAAAGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon132

miR-4781 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4781 miRNA Mature ID miR-4781-5p

miRNA Sequence

UAGCGGGGAUUCCAAUAUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon133

miR-4796 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4796 miRNA Mature ID miR-4796-3p

miRNA Sequence

UAAAGUGGCAGAGUAUAGACAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon134

miR-4797 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4797 miRNA Mature ID miR-4797-5p

miRNA Sequence

GACAGAGUGCCACUUACUGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon135

miR-484 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-484 miRNA Mature ID miR-484

miRNA Sequence

UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon136

miR-485 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon137

miR-493 directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-493 miRNA Mature ID miR-493-3p

miRNA Sequence

UGAAGGUCUACUGUGUGCCAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon138

miR-5000 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5000 miRNA Mature ID miR-5000-3p

miRNA Sequence

UCAGGACACUUCUGAACUUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon139

miR-5008 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5008 miRNA Mature ID miR-5008-5p

miRNA Sequence

UGAGGCCCUUGGGGCACAGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon140

miR-504 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon141

miR-513b directly targets SLC7A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-513b miRNA Mature ID miR-513b-3p

miRNA Sequence

AAAUGUCACCUUUUUGAGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon142

miR-5186 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5186 miRNA Mature ID miR-5186

miRNA Sequence

AGAGAUUGGUAGAAAUCAGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon143

miR-5187 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5187 miRNA Mature ID miR-5187-5p

miRNA Sequence

UGGGAUGAGGGAUUGAAGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon144

miR-5189 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5189 miRNA Mature ID miR-5189-5p

miRNA Sequence

UCUGGGCACAGGCGGAUGGACAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon145

miR-5195 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5195 miRNA Mature ID miR-5195-5p

miRNA Sequence

AACCCCUAAGGCAACUGGAUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon146

miR-5196 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5196 miRNA Mature ID miR-5196-5p

miRNA Sequence

AGGGAAGGGGACGAGGGUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon147

miR-5197 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5197 miRNA Mature ID miR-5197-3p

miRNA Sequence

AAGAAGAGACUGAGUCAUCGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon148

miR-532 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-532 miRNA Mature ID miR-532-3p

miRNA Sequence

CCUCCCACACCCAAGGCUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon149

miR-542 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-542 miRNA Mature ID miR-542-3p

miRNA Sequence

UGUGACAGAUUGAUAACUGAAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon150

miR-548ag directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548ag miRNA Mature ID miR-548ag

miRNA Sequence

AAAGGUAAUUGUGGUUUCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon151

miR-548ai directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548ai miRNA Mature ID miR-548ai

miRNA Sequence

AAAGGUAAUUGCAGUUUUUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon152

miR-548ba directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548ba miRNA Mature ID miR-548ba

miRNA Sequence

AAAGGUAACUGUGAUUUUUGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon153

miR-548c directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548c miRNA Mature ID miR-548c-3p

miRNA Sequence

CAAAAAUCUCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon154

miR-548s directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548s miRNA Mature ID miR-548s

miRNA Sequence

AUGGCCAAAACUGCAGUUAUUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon155

miR-551b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-551b miRNA Mature ID miR-551b-5p

miRNA Sequence

GAAAUCAAGCGUGGGUGAGACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon156

miR-5584 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5584 miRNA Mature ID miR-5584-5p

miRNA Sequence

CAGGGAAAUGGGAAGAACUAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon157

miR-5693 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5693 miRNA Mature ID miR-5693

miRNA Sequence

GCAGUGGCUCUGAAAUGAACUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon158

miR-5698 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon159

miR-570 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-570 miRNA Mature ID miR-570-5p

miRNA Sequence

AAAGGUAAUUGCAGUUUUUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon160

miR-5700 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5700 miRNA Mature ID miR-5700

miRNA Sequence

UAAUGCAUUAAAUUAUUGAAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon161

miR-5703 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5703 miRNA Mature ID miR-5703

miRNA Sequence

AGGAGAAGUCGGGAAGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon162

miR-574 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-574 miRNA Mature ID miR-574-5p

miRNA Sequence

UGAGUGUGUGUGUGUGAGUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon163

miR-586 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-586 miRNA Mature ID miR-586

miRNA Sequence

UAUGCAUUGUAUUUUUAGGUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon164

miR-588 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-588 miRNA Mature ID miR-588

miRNA Sequence

UUGGCCACAAUGGGUUAGAAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon165

miR-598 directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-598 miRNA Mature ID miR-598-3p

miRNA Sequence

UACGUCAUCGUUGUCAUCGUCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon166

miR-604 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-604 miRNA Mature ID miR-604

miRNA Sequence

AGGCUGCGGAAUUCAGGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon167

miR-6085 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6085 miRNA Mature ID miR-6085

miRNA Sequence

AAGGGGCUGGGGGAGCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon168

miR-612 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-612 miRNA Mature ID miR-612

miRNA Sequence

GCUGGGCAGGGCUUCUGAGCUCCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon169

miR-6127 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6127 miRNA Mature ID miR-6127

miRNA Sequence

UGAGGGAGUGGGUGGGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon170

miR-6129 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6129 miRNA Mature ID miR-6129

miRNA Sequence

UGAGGGAGUUGGGUGUAUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon171

miR-6130 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6130 miRNA Mature ID miR-6130

miRNA Sequence

UGAGGGAGUGGAUUGUAUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon172

miR-6133 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6133 miRNA Mature ID miR-6133

miRNA Sequence

UGAGGGAGGAGGUUGGGUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon173

miR-6165 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6165 miRNA Mature ID miR-6165

miRNA Sequence

CAGCAGGAGGUGAGGGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon174

miR-619 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon175

miR-625 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-625 miRNA Mature ID miR-625-5p

miRNA Sequence

AGGGGGAAAGUUCUAUAGUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon176

miR-631 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-631 miRNA Mature ID miR-631

miRNA Sequence

AGACCUGGCCCAGACCUCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon177

miR-647 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-647 miRNA Mature ID miR-647

miRNA Sequence

GUGGCUGCACUCACUUCCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon178

miR-6499 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon179

miR-650 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-650 miRNA Mature ID miR-650

miRNA Sequence

AGGAGGCAGCGCUCUCAGGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon180

miR-6506 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon181

miR-6509 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6509 miRNA Mature ID miR-6509-3p

miRNA Sequence

UUCCACUGCCACUACCUAAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon182

miR-6512 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon183

miR-6515 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6515 miRNA Mature ID miR-6515-5p

miRNA Sequence

UUGGAGGGUGUGGAAGACAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon184

miR-658 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-658 miRNA Mature ID miR-658

miRNA Sequence

GGCGGAGGGAAGUAGGUCCGUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon185

miR-663a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-663a miRNA Mature ID miR-663a

miRNA Sequence

AGGCGGGGCGCCGCGGGACCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon186

miR-665 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-665 miRNA Mature ID miR-665

miRNA Sequence

ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon187

miR-671 directly targets SLC7A5 [ 28 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-671 miRNA Mature ID miR-671-5p

miRNA Sequence

AGGAAGCCCUGGAGGGGCUGGAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon188

miR-6720 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon189

miR-6721 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6721 miRNA Mature ID miR-6721-5p

miRNA Sequence

UGGGCAGGGGCUUAUUGUAGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon190

miR-6724 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6724 miRNA Mature ID miR-6724-5p

miRNA Sequence

CUGGGCCCGCGGCGGGCGUGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon191

miR-6728 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6728 miRNA Mature ID miR-6728-5p

miRNA Sequence

UUGGGAUGGUAGGACCAGAGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon192

miR-6731 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6731 miRNA Mature ID miR-6731-5p

miRNA Sequence

UGGGAGAGCAGGGUAUUGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon193

miR-6734 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6734 miRNA Mature ID miR-6734-5p

miRNA Sequence

UUGAGGGGAGAAUGAGGUGGAGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon194

miR-6754 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6754 miRNA Mature ID miR-6754-5p

miRNA Sequence

CCAGGGAGGCUGGUUUGGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon195

miR-6755 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6755 miRNA Mature ID miR-6755-5p

miRNA Sequence

UAGGGUAGACACUGACAACGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon196

miR-6757 directly targets SLC7A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6757 miRNA Mature ID miR-6757-5p

miRNA Sequence

UAGGGAUGGGAGGCCAGGAUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon197

miR-6760 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6760 miRNA Mature ID miR-6760-5p

miRNA Sequence

CAGGGAGAAGGUGGAAGUGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon198

miR-6762 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6762 miRNA Mature ID miR-6762-3p

miRNA Sequence

UGGCUGCUUCCCUUGGUCUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon199

miR-6773 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6773 miRNA Mature ID miR-6773-5p

miRNA Sequence

UUGGGCCCAGGAGUAAACAGGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon200

miR-6777 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6777 miRNA Mature ID miR-6777-5p

miRNA Sequence

ACGGGGAGUCAGGCAGUGGUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon201

miR-6778 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

UGCCUCCCUGACAUUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon202

miR-6779 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6779 miRNA Mature ID miR-6779-5p

miRNA Sequence

CUGGGAGGGGCUGGGUUUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon203

miR-6780a directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6780a miRNA Mature ID miR-6780a-5p

miRNA Sequence

UUGGGAGGGAAGACAGCUGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon204

miR-6781 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6781 miRNA Mature ID miR-6781-5p

miRNA Sequence

CGGGCCGGAGGUCAAGGGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon205

miR-6785 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon206

miR-6786 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6786 miRNA Mature ID miR-6786-3p

miRNA Sequence

UGACGCCCCUUCUGAUUCUGCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon207

miR-6787 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6787 miRNA Mature ID miR-6787-5p

miRNA Sequence

UGGCGGGGGUAGAGCUGGCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon208

miR-6791 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon209

miR-6794 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6794 miRNA Mature ID miR-6794-5p

miRNA Sequence

CAGGGGGACUGGGGGUGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon210

miR-6797 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6797 miRNA Mature ID miR-6797-5p

miRNA Sequence

AGGAGGGAAGGGGCUGAGAACAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon211

miR-6799 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon212

miR-6813 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6813 miRNA Mature ID miR-6813-5p

miRNA Sequence

CAGGGGCUGGGGUUUCAGGUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon213

miR-6816 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6816 miRNA Mature ID miR-6816-5p

miRNA Sequence

UGGGGCGGGGCAGGUCCCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon214

miR-6820 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6820 miRNA Mature ID miR-6820-5p

miRNA Sequence

UGCGGCAGAGCUGGGGUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon215

miR-6821 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6821 miRNA Mature ID miR-6821-5p

miRNA Sequence

GUGCGUGGUGGCUCGAGGCGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon216

miR-6823 directly targets SLC7A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6823 miRNA Mature ID miR-6823-5p

miRNA Sequence

UCAGGGUUGGUAGGGGUUGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon217

miR-6825 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6825 miRNA Mature ID miR-6825-5p

miRNA Sequence

UGGGGAGGUGUGGAGUCAGCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon218

miR-6828 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6828 miRNA Mature ID miR-6828-5p

miRNA Sequence

AGGAAGCAAGAGAACCCUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon219

miR-6829 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon220

miR-6829 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6829 miRNA Mature ID miR-6829-5p

miRNA Sequence

UGGGCUGCUGAGAAGGGGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon221

miR-6834 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6834 miRNA Mature ID miR-6834-5p

miRNA Sequence

GUGAGGGACUGGGAUUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon222

miR-6836 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6836 miRNA Mature ID miR-6836-3p

miRNA Sequence

AUGCCUCCCCCGGCCCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon223

miR-6846 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6846 miRNA Mature ID miR-6846-3p

miRNA Sequence

UGACCCCUUCUGUCUCCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon224

miR-6851 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon225

miR-6853 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6853 miRNA Mature ID miR-6853-5p

miRNA Sequence

AGCGUGGGAUGUCCAUGAAGUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon226

miR-6854 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6854 miRNA Mature ID miR-6854-5p

miRNA Sequence

AAGCUCAGGUUUGAGAACUGCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon227

miR-6860 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6860 miRNA Mature ID miR-6860

miRNA Sequence

ACUGGGCAGGGCUGUGGUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon228

miR-6870 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6870 miRNA Mature ID miR-6870-5p

miRNA Sequence

UGGGGGAGAUGGGGGUUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon229

miR-6875 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6875 miRNA Mature ID miR-6875-5p

miRNA Sequence

UGAGGGACCCAGGACAGGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon230

miR-6876 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6876 miRNA Mature ID miR-6876-5p

miRNA Sequence

CAGGAAGGAGACAGGCAGUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon231

miR-6877 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6877 miRNA Mature ID miR-6877-5p

miRNA Sequence

AGGGCCGAAGGGUGGAAGCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon232

miR-6882 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6882 miRNA Mature ID miR-6882-3p

miRNA Sequence

UGCUGCCUCUCCUCUUGCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon233

miR-6883 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon234

miR-6884 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon235

miR-6889 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6889 miRNA Mature ID miR-6889-5p

miRNA Sequence

UCGGGGAGUCUGGGGUCCGGAAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon236

miR-6890 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

CCACUGCCUAUGCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon237

miR-6891 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6891 miRNA Mature ID miR-6891-5p

miRNA Sequence

UAAGGAGGGGGAUGAGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon238

miR-708 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-708 miRNA Mature ID miR-708-5p

miRNA Sequence

AAGGAGCUUACAAUCUAGCUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon239

miR-7106 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon240

miR-7111 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7111 miRNA Mature ID miR-7111-5p

miRNA Sequence

UGGGGGAGGAAGGACAGGCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon241

miR-7155 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7155 miRNA Mature ID miR-7155-3p

miRNA Sequence

UGGCCCAAGACCUCAGACC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon242

miR-7160 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7160 miRNA Mature ID miR-7160-3p

miRNA Sequence

CAGGGCCCUGGCUUUAGCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon243

miR-7160 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon244

miR-7515 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7515 miRNA Mature ID miR-7515

miRNA Sequence

AGAAGGGAAGAUGGUGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon245

miR-761 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-761 miRNA Mature ID miR-761

miRNA Sequence

GCAGCAGGGUGAAACUGACACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon246

miR-765 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-765 miRNA Mature ID miR-765

miRNA Sequence

UGGAGGAGAAGGAAGGUGAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon247

miR-769 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-769 miRNA Mature ID miR-769-5p

miRNA Sequence

UGAGACCUCUGGGUUCUGAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon248

miR-7847 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon249

miR-7851 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7851 miRNA Mature ID miR-7851-3p

miRNA Sequence

UACCUGGGAGACUGAGGUUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon250

miR-7977 directly targets SLC7A5 [ 26 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

UUCCCAGCCAACGCACCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon251

miR-8052 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8052 miRNA Mature ID miR-8052

miRNA Sequence

CGGGACUGUAGAGGGCAUGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon252

miR-8059 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8059 miRNA Mature ID miR-8059

miRNA Sequence

GGGGAACUGUAGAUGAAAAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon253

miR-8085 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-8085 miRNA Mature ID miR-8085

miRNA Sequence

UGGGAGAGAGGACUGUGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon254

miR-873 directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-873 miRNA Mature ID miR-873-5p

miRNA Sequence

GCAGGAACUUGUGAGUCUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon255

miR-92b directly targets SLC7A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-92b miRNA Mature ID miR-92b-5p

miRNA Sequence

AGGGACGGGACGCGGUGCAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon256

miR-9500 directly targets SLC7A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-9500 miRNA Mature ID miR-9500

miRNA Sequence

AAGGGAAGAUGGUGACCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome Wide Methylome Alterations in Lung Cancer. PLoS One. 2015 Dec 18;10(12):e0143826.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4 DNA Methylation Dynamics in Urological Tumors.
5 Genome-wide Scan for Methylation Profiles in Breast Cancer
6 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
16 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
17 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18 miR-126 inhibits proliferation of small cell lung cancer cells by targeting SLC7A5. FEBS Lett. 2011 Apr 20;585(8):1191-6.
19 MicroRNA-126 inhibits cell proliferation in gastric cancer by targeting LAT-1. Biomed Pharmacother. 2015 May;72:66-73.
20 XB130, a new adaptor protein, regulates expression of tumor suppressive microRNAs in cancer cells. PLoS One. 2013;8(3):e59057.
21 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
22 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
23 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
24 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
25 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
26 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
27 MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 2010 May;176(5):2520-9.
28 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.