Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0471 Transporter Info | ||||
| Gene Name | SLC7A5 | ||||
| Transporter Name | L-type amino acid transporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Hypermethylation of SLC7A5 in lung cancer | [ 1 ] | |||
|
Location |
Gene body | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes | Up regulation ofSLC7A5 | Experiment Method | Microarrays | ||
|
Studied Phenotype |
Lung cancer[ ICD-11:2C25] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SLC7A5 had increased methylation and increased expression in lung cancer. | ||||
|
Hepatocellular carcinoma |
40 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg06578117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:4.78E-11; Z-score:-2.31E+00 | ||
|
Methylation in Case |
5.07E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg04721098) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.59E+00 | Statistic Test | p-value:5.69E-19; Z-score:-3.54E+00 | ||
|
Methylation in Case |
3.24E-01 (Median) | Methylation in Control | 5.16E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg21861233) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.41E+00 | Statistic Test | p-value:4.71E-13; Z-score:-1.73E+00 | ||
|
Methylation in Case |
3.60E-01 (Median) | Methylation in Control | 5.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.26E+00 | Statistic Test | p-value:8.50E-09; Z-score:-1.70E+00 | ||
|
Methylation in Case |
5.36E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:8.67E-08; Z-score:-1.44E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:3.26E-06; Z-score:-9.95E-01 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:1.11E-02; Z-score:1.07E+00 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg13323701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:4.82E+00 | Statistic Test | p-value:4.60E-13; Z-score:7.74E+00 | ||
|
Methylation in Case |
2.58E-01 (Median) | Methylation in Control | 5.34E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg00728300) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:1.60E-07; Z-score:1.72E+00 | ||
|
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 3.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:3.76E-07; Z-score:1.72E+00 | ||
|
Methylation in Case |
5.80E-01 (Median) | Methylation in Control | 4.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg25437385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.07E+00 | Statistic Test | p-value:1.27E-11; Z-score:6.58E+00 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 7.45E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg13788959) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.66E+00 | Statistic Test | p-value:8.73E-24; Z-score:-8.84E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg00157228) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.63E+00 | Statistic Test | p-value:6.07E-20; Z-score:-4.65E+00 | ||
|
Methylation in Case |
4.65E-01 (Median) | Methylation in Control | 7.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14772660) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.45E+00 | Statistic Test | p-value:2.25E-18; Z-score:-4.48E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06708198) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.51E+00 | Statistic Test | p-value:3.05E-16; Z-score:-9.01E+00 | ||
|
Methylation in Case |
5.29E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg07358738) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.60E+00 | Statistic Test | p-value:1.18E-15; Z-score:-3.92E+00 | ||
|
Methylation in Case |
4.97E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02400308) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.74E+00 | Statistic Test | p-value:7.44E-14; Z-score:-3.96E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg14225195) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.36E+00 | Statistic Test | p-value:8.29E-11; Z-score:-1.35E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04804543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:1.95E-10; Z-score:-3.00E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg02057782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:1.18E-09; Z-score:2.41E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 3.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.46E-06; Z-score:7.81E-01 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 7.77E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.30E-06; Z-score:-1.42E+00 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg10169763) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:3.34E-04; Z-score:8.73E-01 | ||
|
Methylation in Case |
8.72E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.80E-04; Z-score:-7.65E-01 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03801429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.57E-03; Z-score:-8.04E-01 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg06867910) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.57E-03; Z-score:-4.10E-01 | ||
|
Methylation in Case |
7.70E-02 (Median) | Methylation in Control | 8.95E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.69E-03; Z-score:-2.16E-01 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:5.18E-03; Z-score:5.84E-01 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 6.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:5.69E-03; Z-score:-6.94E-01 | ||
|
Methylation in Case |
3.76E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:6.16E-03; Z-score:-5.67E-01 | ||
|
Methylation in Case |
5.54E-02 (Median) | Methylation in Control | 7.13E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:8.48E-03; Z-score:4.65E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.24E+00 | Statistic Test | p-value:2.84E-02; Z-score:-3.23E-01 | ||
|
Methylation in Case |
9.70E-02 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:2.86E-02; Z-score:6.19E-01 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 2.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:3.05E-02; Z-score:6.03E-01 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:3.13E-02; Z-score:-1.16E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.68E-02; Z-score:2.01E-01 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:4.11E-02; Z-score:2.70E-01 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.97E-04; Z-score:-5.40E-01 | ||
|
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg04481596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.66E-03; Z-score:-3.53E-01 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC7A5 in hepatocellular carcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg03486383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.17E-02; Z-score:-2.71E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma[ ICD-11:2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
31 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg18440316) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.44E+00 | Statistic Test | p-value:3.17E-04; Z-score:8.14E-01 | ||
|
Methylation in Case |
2.01E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg19431980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:1.32E-03; Z-score:-6.48E-01 | ||
|
Methylation in Case |
6.64E-02 (Median) | Methylation in Control | 8.93E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg10678459) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:4.75E-05; Z-score:-1.09E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg12572677) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.97E-03; Z-score:5.42E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg04144226) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.31E+00 | Statistic Test | p-value:2.04E-02; Z-score:-6.52E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg07751266) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.10E-02; Z-score:-3.23E-01 | ||
|
Methylation in Case |
6.22E-02 (Median) | Methylation in Control | 6.56E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg15044957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:3.16E+00 | Statistic Test | p-value:1.20E-08; Z-score:2.00E+00 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg17714025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:2.55E+00 | Statistic Test | p-value:4.79E-06; Z-score:1.53E+00 | ||
|
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg18919642) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.30E+00 | Statistic Test | p-value:1.29E-05; Z-score:-1.10E+00 | ||
|
Methylation in Case |
1.42E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg04294894) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:8.83E-04; Z-score:-7.30E-01 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg16404371) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.06E+00 | Statistic Test | p-value:3.49E-03; Z-score:2.38E-01 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 4.27E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg24598126) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:1.22E-02; Z-score:-5.10E-01 | ||
|
Methylation in Case |
1.15E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg18031850) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:3.55E-17; Z-score:2.85E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg17156227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:3.82E-13; Z-score:2.04E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (ch.3.1209178R) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:1.30E-12; Z-score:2.11E+00 | ||
|
Methylation in Case |
8.48E-02 (Median) | Methylation in Control | 5.78E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08789022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.79E+00 | Statistic Test | p-value:2.41E-09; Z-score:1.83E+00 | ||
|
Methylation in Case |
4.51E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg13890552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.33E-07; Z-score:-6.75E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.84E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg18426477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:2.57E-07; Z-score:-1.05E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 5.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg26244838) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.26E+00 | Statistic Test | p-value:1.82E-06; Z-score:1.30E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.36E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00420510) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:1.93E-06; Z-score:1.19E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 6.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg07834249) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:3.69E-06; Z-score:1.51E+00 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20307184) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.17E-05; Z-score:-8.88E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01435766) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.71E+00 | Statistic Test | p-value:3.27E-03; Z-score:-8.34E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 2.21E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg24632865) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:5.72E-03; Z-score:7.97E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg19619756) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:7.47E-03; Z-score:9.20E-01 | ||
|
Methylation in Case |
5.86E-01 (Median) | Methylation in Control | 5.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg00087735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.33E-02; Z-score:5.77E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg25600103) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:3.73E-02; Z-score:5.31E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg08293408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.23E-02; Z-score:-3.46E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg11681428) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:4.56E-02; Z-score:8.08E-01 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 3.69E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg22872508) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:4.88E-02; Z-score:9.48E-02 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC7A5 in pancretic ductal adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg18848012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:4.98E-02; Z-score:6.58E-01 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma[ ICD-11:2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
27 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.69E+00 | Statistic Test | p-value:8.52E-05; Z-score:-4.23E+00 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:1.36E-03; Z-score:-2.94E+00 | ||
|
Methylation in Case |
6.32E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg00728300) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.35E+00 | Statistic Test | p-value:2.76E-05; Z-score:-4.50E+00 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 2.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.81E+00 | Statistic Test | p-value:3.20E-04; Z-score:-3.08E+00 | ||
|
Methylation in Case |
1.69E-01 (Median) | Methylation in Control | 3.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
1stExon (cg26695445) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.40E+00 | Statistic Test | p-value:1.82E-02; Z-score:-1.33E+00 | ||
|
Methylation in Case |
7.75E-02 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:3.97E-06; Z-score:5.92E+00 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26569315) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.48E+00 | Statistic Test | p-value:5.02E-06; Z-score:-1.04E+01 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.19E+00 | Statistic Test | p-value:1.06E-05; Z-score:-5.10E+00 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:2.24E-05; Z-score:-4.04E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:2.65E-04; Z-score:-3.62E+00 | ||
|
Methylation in Case |
6.56E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:2.94E-04; Z-score:3.55E+00 | ||
|
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:4.60E-04; Z-score:2.84E+00 | ||
|
Methylation in Case |
7.25E-01 (Median) | Methylation in Control | 5.60E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.29E+00 | Statistic Test | p-value:6.90E-04; Z-score:-7.23E+00 | ||
|
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.17E-03; Z-score:2.57E+00 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.92E-03; Z-score:-3.39E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:1.97E-03; Z-score:-1.81E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.50E+00 | Statistic Test | p-value:2.82E-03; Z-score:-2.24E+00 | ||
|
Methylation in Case |
1.86E-01 (Median) | Methylation in Control | 2.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg02614661) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:2.94E-03; Z-score:2.57E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26637881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:6.13E-03; Z-score:2.43E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:7.71E-03; Z-score:1.64E+00 | ||
|
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.27E+00 | Statistic Test | p-value:1.11E-02; Z-score:-1.77E+00 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 1.84E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.36E-02; Z-score:3.69E+00 | ||
|
Methylation in Case |
9.60E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.37E-02; Z-score:2.37E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.67E-02; Z-score:-1.30E+00 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg03486383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:9.23E-04; Z-score:-2.51E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 9.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.06E-03; Z-score:-2.75E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC7A5 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.08E-02; Z-score:-7.88E-01 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer[ ICD-11:2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
30 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:1.04E-09; Z-score:2.27E+00 | ||
|
Methylation in Case |
8.46E-01 (Median) | Methylation in Control | 7.24E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:3.97E-09; Z-score:2.41E+00 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:6.05E-05; Z-score:1.57E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:7.24E-03; Z-score:5.47E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg07067659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.71E-02; Z-score:-1.03E-01 | ||
|
Methylation in Case |
1.78E-02 (Median) | Methylation in Control | 1.92E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg26695445) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:4.35E-02; Z-score:-1.92E-01 | ||
|
Methylation in Case |
6.79E-02 (Median) | Methylation in Control | 7.28E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:3.22E-11; Z-score:-2.36E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.47E+00 | Statistic Test | p-value:9.39E-11; Z-score:-2.25E+00 | ||
|
Methylation in Case |
2.46E-01 (Median) | Methylation in Control | 3.62E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:1.54E-09; Z-score:-1.94E+00 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26637881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.73E-08; Z-score:2.02E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:1.46E-06; Z-score:-9.50E-01 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26619943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.92E-06; Z-score:-8.12E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:1.77E-05; Z-score:-1.90E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:4.49E-05; Z-score:-9.35E-01 | ||
|
Methylation in Case |
7.70E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:1.61E-04; Z-score:-1.12E+00 | ||
|
Methylation in Case |
1.50E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.63E-04; Z-score:7.88E-01 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 7.45E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:2.04E-04; Z-score:-1.22E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:2.37E-04; Z-score:7.94E-01 | ||
|
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:4.27E-04; Z-score:1.67E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 4.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg02454636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.09E+00 | Statistic Test | p-value:8.55E-04; Z-score:-1.17E+00 | ||
|
Methylation in Case |
6.33E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.07E+00 | Statistic Test | p-value:2.61E-03; Z-score:-8.38E-01 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 9.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.35E-02; Z-score:-4.66E-01 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 6.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:1.41E-02; Z-score:7.43E-01 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.27E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.87E-02; Z-score:-1.50E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 7.39E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.99E-02; Z-score:-2.49E-01 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.43E-07; Z-score:1.06E+00 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:1.06E-05; Z-score:-9.66E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:4.09E-04; Z-score:-7.64E-01 | ||
|
Methylation in Case |
9.43E-01 (Median) | Methylation in Control | 9.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.81E-03; Z-score:-4.94E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC7A5 in breast cancer | [ 5 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.20E-02; Z-score:-5.10E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer[ ICD-11:2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in clear cell renal cell carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:7.30E-04; Z-score:-1.77E+00 | ||
|
Methylation in Case |
5.74E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in clear cell renal cell carcinoma | [ 6 ] | |||
|
Location |
1stExon (cg07067659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.83E-02; Z-score:1.49E-01 | ||
|
Methylation in Case |
1.81E-02 (Median) | Methylation in Control | 1.74E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma[ ICD-11:2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
25 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.28E+00 | Statistic Test | p-value:4.57E-11; Z-score:-2.33E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 8.46E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.00E-09; Z-score:-2.13E+00 | ||
|
Methylation in Case |
7.83E-01 (Median) | Methylation in Control | 9.06E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.24E-02; Z-score:-4.20E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:4.26E-02; Z-score:-9.61E-01 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg00728300) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.83E+00 | Statistic Test | p-value:2.03E-08; Z-score:-1.80E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 3.54E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.87E+00 | Statistic Test | p-value:2.28E-06; Z-score:-1.64E+00 | ||
|
Methylation in Case |
9.50E-02 (Median) | Methylation in Control | 2.73E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.62E+00 | Statistic Test | p-value:5.25E-08; Z-score:-1.85E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 5.43E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:7.57E-07; Z-score:-1.01E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:2.34E-04; Z-score:-6.58E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:5.25E-04; Z-score:-4.84E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.00E-03; Z-score:-1.12E+00 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.24E-03; Z-score:-3.62E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:5.20E-03; Z-score:-6.82E-01 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.14E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:5.61E-03; Z-score:-7.29E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:8.84E-03; Z-score:-1.78E-01 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:1.06E-02; Z-score:1.12E-01 | ||
|
Methylation in Case |
9.40E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.08E-02; Z-score:-6.72E-01 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.96E-02; Z-score:-3.61E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg02614661) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.20E-02; Z-score:-1.10E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:2.76E-02; Z-score:-3.72E-01 | ||
|
Methylation in Case |
2.22E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:5.00E-02; Z-score:-5.97E-02 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.22E-04; Z-score:-9.76E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:5.22E-03; Z-score:-1.94E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg27135163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:7.91E-03; Z-score:5.93E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:1.57E-02; Z-score:-2.69E-01 | ||
|
Methylation in Case |
9.28E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer[ ICD-11:2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
24 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg02057598) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.18E+00 | Statistic Test | p-value:1.40E-19; Z-score:2.73E+00 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 7.43E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.47E+00 | Statistic Test | p-value:1.82E-12; Z-score:3.99E+00 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg09357483) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:2.20E-06; Z-score:6.78E-01 | ||
|
Methylation in Case |
9.57E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg12408911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.07E+00 | Statistic Test | p-value:1.32E-04; Z-score:1.13E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.24E+00 | Statistic Test | p-value:1.20E-18; Z-score:3.23E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.25E+00 | Statistic Test | p-value:6.66E-14; Z-score:2.68E+00 | ||
|
Methylation in Case |
7.14E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26569315) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:1.58E-13; Z-score:1.33E+00 | ||
|
Methylation in Case |
9.89E-01 (Median) | Methylation in Control | 9.70E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:7.38E-12; Z-score:1.06E+00 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:8.41E-11; Z-score:1.73E+00 | ||
|
Methylation in Case |
8.03E-01 (Median) | Methylation in Control | 7.26E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.04E+00 | Statistic Test | p-value:3.48E-10; Z-score:1.29E+00 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:6.24E-06; Z-score:9.73E-01 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.16E-05; Z-score:1.16E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.06E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26637881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:7.55E-05; Z-score:1.02E+00 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.50E-04; Z-score:4.00E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.19E+00 | Statistic Test | p-value:1.17E-03; Z-score:1.31E+00 | ||
|
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg27555036) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.07E-03; Z-score:-8.35E-01 | ||
|
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.41E+00 | Statistic Test | p-value:2.02E-02; Z-score:7.62E-01 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 1.21E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:2.22E-02; Z-score:1.51E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:3.01E-02; Z-score:5.40E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:3.53E-02; Z-score:8.21E-01 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 9.64E-02 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:4.24E-02; Z-score:4.81E-01 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.83E-02; Z-score:-7.63E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.61E-02; Z-score:6.14E-01 | ||
|
Methylation in Case |
8.47E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:4.25E-02; Z-score:-5.72E-01 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.73E-01 (Median) | ||
|
Studied Phenotype |
HIV infection[ ICD-11:1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-5.56E-01 | Statistic Test | p-value:3.09E-02; Z-score:-4.22E-01 | ||
|
Methylation in Case |
-4.15E-01 (Median) | Methylation in Control | -2.31E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:2.53E-03; Z-score:-4.45E-01 | ||
|
Methylation in Case |
7.24E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:9.00E-03; Z-score:5.16E-01 | ||
|
Methylation in Case |
2.02E+00 (Median) | Methylation in Control | 1.84E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg00069417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.96E-02; Z-score:4.78E-01 | ||
|
Methylation in Case |
3.05E+00 (Median) | Methylation in Control | 2.81E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder[ ICD-11:6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg00858400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:1.46E-12; Z-score:-2.26E+00 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
TSS200 (cg08710629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:2.51E-07; Z-score:1.71E+00 | ||
|
Methylation in Case |
2.76E-01 (Median) | Methylation in Control | 2.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.85E+00 | Statistic Test | p-value:1.03E-21; Z-score:-3.31E+00 | ||
|
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 3.25E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:7.70E-13; Z-score:-2.46E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:3.83E-11; Z-score:1.41E+00 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg10099957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:7.21E-08; Z-score:1.11E+00 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:1.03E-07; Z-score:-1.32E+00 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.15E+00 | Statistic Test | p-value:6.32E-07; Z-score:1.35E+00 | ||
|
Methylation in Case |
6.66E-01 (Median) | Methylation in Control | 5.79E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.34E+00 | Statistic Test | p-value:6.93E-07; Z-score:-7.40E-01 | ||
|
Methylation in Case |
7.79E-02 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26569315) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:3.50E-06; Z-score:-1.39E+00 | ||
|
Methylation in Case |
5.94E-01 (Median) | Methylation in Control | 6.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:4.22E-05; Z-score:-7.72E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03801429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:6.87E-05; Z-score:-7.39E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:7.89E-05; Z-score:-7.80E-01 | ||
|
Methylation in Case |
9.47E-01 (Median) | Methylation in Control | 9.55E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:9.56E-05; Z-score:1.14E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 7.75E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:2.13E-04; Z-score:-8.86E-01 | ||
|
Methylation in Case |
9.20E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26619943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.21E-03; Z-score:-8.41E-01 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 9.31E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.42E+00 | Statistic Test | p-value:6.00E-03; Z-score:-6.47E-01 | ||
|
Methylation in Case |
4.53E-02 (Median) | Methylation in Control | 6.43E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.54E-02; Z-score:-6.40E-01 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.61E-02; Z-score:5.45E-01 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 6.85E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:2.00E-02; Z-score:-6.30E-01 | ||
|
Methylation in Case |
7.90E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.03E+00 | Statistic Test | p-value:2.29E-02; Z-score:6.06E-01 | ||
|
Methylation in Case |
7.85E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.31E-02; Z-score:-4.32E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.35E-02; Z-score:-5.80E-01 | ||
|
Methylation in Case |
8.93E-01 (Median) | Methylation in Control | 9.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.12E+00 | Statistic Test | p-value:9.46E-04; Z-score:1.00E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.16E+00 | Statistic Test | p-value:2.38E-03; Z-score:8.82E-01 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC7A5 in papillary thyroid cancer | [ 10 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:2.76E-02; Z-score:6.51E-01 | ||
|
Methylation in Case |
6.59E-01 (Median) | Methylation in Control | 6.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer[ ICD-11:2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg11123744) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.44E+00 | Statistic Test | p-value:4.26E-02; Z-score:-1.57E+00 | ||
|
Methylation in Case |
2.79E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
TSS200 (cg13438631) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.54E+00 | Statistic Test | p-value:2.27E-02; Z-score:-1.85E+00 | ||
|
Methylation in Case |
2.01E-02 (Median) | Methylation in Control | 3.10E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg06888094) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.91E+00 | Statistic Test | p-value:3.15E-04; Z-score:6.54E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 2.61E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg02606369) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.20E+00 | Statistic Test | p-value:2.98E-02; Z-score:6.59E+00 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 5.04E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg22689016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.58E+00 | Statistic Test | p-value:3.11E-02; Z-score:-4.61E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg14224786) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:3.63E-02; Z-score:5.06E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 5.77E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in prostate cancer | [ 11 ] | |||
|
Location |
3'UTR (cg19991086) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.02E-02; Z-score:1.59E+00 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer[ ICD-11:2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
42 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
1stExon (cg07067659) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.57E+00 | Statistic Test | p-value:2.23E-21; Z-score:3.12E+00 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 4.85E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
1stExon (cg26695445) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:5.93E-16; Z-score:-3.34E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg00069417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.10E+00 | Statistic Test | p-value:1.61E-05; Z-score:-1.04E+00 | ||
|
Methylation in Case |
7.21E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:8.94E-05; Z-score:9.16E-01 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:9.06E-05; Z-score:-8.04E-01 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02203067) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:1.22E-04; Z-score:1.09E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02454636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.63E-04; Z-score:8.92E-01 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg02614661) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.86E-04; Z-score:-5.38E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03408354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:3.26E-04; Z-score:1.18E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:3.67E-04; Z-score:1.07E+00 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 6.35E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03801429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.33E-04; Z-score:-6.40E-01 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.14E+00 | Statistic Test | p-value:4.41E-04; Z-score:-9.18E-01 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03879320) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.14E+00 | Statistic Test | p-value:4.52E-04; Z-score:8.35E-01 | ||
|
Methylation in Case |
6.37E-01 (Median) | Methylation in Control | 5.58E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.17E+00 | Statistic Test | p-value:5.92E-04; Z-score:1.13E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04264781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.33E+00 | Statistic Test | p-value:6.57E-04; Z-score:6.25E-01 | ||
|
Methylation in Case |
3.03E-01 (Median) | Methylation in Control | 2.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04802238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-2.29E+00 | Statistic Test | p-value:9.54E-04; Z-score:-5.36E-01 | ||
|
Methylation in Case |
5.63E-02 (Median) | Methylation in Control | 1.29E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04963199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.68E+00 | Statistic Test | p-value:1.03E-03; Z-score:-8.06E-01 | ||
|
Methylation in Case |
1.82E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.08E+00 | Statistic Test | p-value:1.42E-03; Z-score:5.20E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.12E+00 | Statistic Test | p-value:1.69E-03; Z-score:-8.13E-01 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:1.81E-03; Z-score:-6.89E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:2.44E-03; Z-score:8.14E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.37E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon22 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06492111) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:2.48E-03; Z-score:-5.39E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.08E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon23 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.29E+00 | Statistic Test | p-value:2.79E-03; Z-score:5.64E-01 | ||
|
Methylation in Case |
2.78E-01 (Median) | Methylation in Control | 2.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon24 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06727993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:2.91E-03; Z-score:4.48E-01 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 9.73E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon25 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06867910) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:2.99E-03; Z-score:-7.92E-01 | ||
|
Methylation in Case |
6.17E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon26 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07021906) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.24E-03; Z-score:-3.61E-01 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon27 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07558761) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.04E+00 | Statistic Test | p-value:4.29E-03; Z-score:-5.41E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon28 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.18E+00 | Statistic Test | p-value:6.12E-03; Z-score:-6.96E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 1.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon29 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-3.26E+00 | Statistic Test | p-value:7.64E-03; Z-score:-5.74E-01 | ||
|
Methylation in Case |
3.42E-02 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon30 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:8.54E-03; Z-score:6.60E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon31 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:9.77E-03; Z-score:-3.02E-01 | ||
|
Methylation in Case |
6.70E-01 (Median) | Methylation in Control | 6.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon32 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg10099957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.08E+00 | Statistic Test | p-value:1.36E-02; Z-score:-3.01E-01 | ||
|
Methylation in Case |
4.99E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon33 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg10169763) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:1.40E-02; Z-score:-2.60E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon34 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg00653312) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.11E+00 | Statistic Test | p-value:1.19E-15; Z-score:-3.65E+00 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon35 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg03486383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.78E+00 | Statistic Test | p-value:1.18E-14; Z-score:-2.59E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 3.78E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon36 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg04481596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:2.86E-14; Z-score:-3.09E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon37 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg06071246) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.41E+00 | Statistic Test | p-value:6.17E-14; Z-score:2.20E+00 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 5.21E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon38 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.82E+00 | Statistic Test | p-value:1.73E-13; Z-score:-2.34E+00 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon39 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.93E+00 | Statistic Test | p-value:3.78E-13; Z-score:-1.95E+00 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon40 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.62E+00 | Statistic Test | p-value:1.41E-12; Z-score:-1.95E+00 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 5.83E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon41 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg10034481) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.33E+00 | Statistic Test | p-value:2.06E-12; Z-score:-2.00E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon42 |
Methylation of SLC7A5 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg27135163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:3.32E-09; Z-score:-1.59E+00 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in celiac disease | [ 13 ] | |||
|
Location |
Body (cg05834639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.06E+00 | Statistic Test | p-value:4.43E-02; Z-score:-3.71E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease[ ICD-11:DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16925177) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.21E+00 | Statistic Test | p-value:1.51E-04; Z-score:-3.72E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer[ ICD-11:2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in depression | [ 15 ] | |||
|
Location |
Body (cg10169763) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:2.33E-02; Z-score:3.88E-01 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in depression | [ 15 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.01E+00 | Statistic Test | p-value:3.66E-02; Z-score:-5.58E-01 | ||
|
Methylation in Case |
8.98E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Depression[ ICD-11:6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg01829163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:2.52E-04; Z-score:2.43E+00 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.01E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg05911082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:4.52E-04; Z-score:2.00E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 7.47E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg06665333) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:6.60E-04; Z-score:2.21E+00 | ||
|
Methylation in Case |
9.14E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.13E+00 | Statistic Test | p-value:7.37E-04; Z-score:-3.56E+00 | ||
|
Methylation in Case |
6.87E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.09E+00 | Statistic Test | p-value:1.02E-03; Z-score:1.55E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg10099957) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.10E-03; Z-score:2.88E+00 | ||
|
Methylation in Case |
9.34E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg00069417) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:1.35E-03; Z-score:1.75E+00 | ||
|
Methylation in Case |
8.84E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg08860287) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:2.44E-03; Z-score:1.78E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.16E+00 | Statistic Test | p-value:3.05E-03; Z-score:-1.95E+00 | ||
|
Methylation in Case |
1.79E-01 (Median) | Methylation in Control | 2.07E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon10 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg03850117) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.32E+00 | Statistic Test | p-value:3.90E-03; Z-score:-5.21E+00 | ||
|
Methylation in Case |
3.40E-01 (Median) | Methylation in Control | 4.50E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon11 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg04171052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:7.26E-03; Z-score:8.44E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon12 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg02454636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:8.67E-03; Z-score:1.16E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon13 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg26529851) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.22E+00 | Statistic Test | p-value:1.54E-02; Z-score:4.05E+00 | ||
|
Methylation in Case |
7.11E-01 (Median) | Methylation in Control | 5.81E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon14 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg26982544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.45E+00 | Statistic Test | p-value:1.96E-02; Z-score:2.84E+00 | ||
|
Methylation in Case |
1.50E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon15 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg05393733) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.01E+00 | Statistic Test | p-value:1.97E-02; Z-score:8.46E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon16 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.36E+00 | Statistic Test | p-value:3.96E-02; Z-score:1.95E+00 | ||
|
Methylation in Case |
1.87E-01 (Median) | Methylation in Control | 1.37E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon17 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.05E+00 | Statistic Test | p-value:4.85E-02; Z-score:1.07E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon18 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg09618385) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.11E+00 | Statistic Test | p-value:8.68E-04; Z-score:1.85E+00 | ||
|
Methylation in Case |
7.44E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon19 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg04481596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:2.89E-02; Z-score:7.18E-01 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon20 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg08094280) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.02E+00 | Statistic Test | p-value:3.36E-02; Z-score:7.30E-01 | ||
|
Methylation in Case |
8.58E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon21 |
Methylation of SLC7A5 in lung adenocarcinoma | [ 16 ] | |||
|
Location |
3'UTR (cg06770731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.67E-02; Z-score:-2.69E+00 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma[ ICD-11:2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg26907768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.05E+00 | Statistic Test | p-value:3.96E-04; Z-score:-2.74E-01 | ||
|
Methylation in Case |
1.90E-01 (Median) | Methylation in Control | 1.99E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon2 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg09285525) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.07E-03; Z-score:-2.35E-01 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon3 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg06867910) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.10E+00 | Statistic Test | p-value:2.74E-03; Z-score:2.33E-01 | ||
|
Methylation in Case |
1.62E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon4 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg06372223) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.03E+00 | Statistic Test | p-value:3.04E-03; Z-score:-2.32E-01 | ||
|
Methylation in Case |
6.74E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon5 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg08401758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.13E+00 | Statistic Test | p-value:1.09E-02; Z-score:2.64E-01 | ||
|
Methylation in Case |
2.35E-01 (Median) | Methylation in Control | 2.09E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon6 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg27560818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:2.54E-02; Z-score:-9.08E-02 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon7 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg08617020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.02E+00 | Statistic Test | p-value:3.00E-02; Z-score:-2.78E-01 | ||
|
Methylation in Case |
7.96E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon8 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
Body (cg03553613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:-1.00E+00 | Statistic Test | p-value:4.91E-02; Z-score:-1.63E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon9 |
Methylation of SLC7A5 in systemic lupus erythematosus | [ 17 ] | |||
|
Location |
3'UTR (cg27135163) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change:1.00E+00 | Statistic Test | p-value:4.26E-04; Z-score:9.39E-03 | ||
|
Methylation in Case |
9.21E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus[ ICD-11:4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Small cell lung cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Lower expression of miR-126 in small cell lung cancer | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofSLC7A5 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-126 | miRNA Mature ID | miR-126-3p | ||
|
miRNA Sequence |
UCGUACCGUGAGUAAUAAUGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Small cell lung cancer[ ICD-11:2C25.1] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Overexpression of miR-126 suppresses SLC7A5 expression at both the RNA and the protein level. | ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
Lower expression of miR-126 in small gastric cancer | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofSLC7A5 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-126 | miRNA Mature ID | miR-126-3p | ||
|
miRNA Sequence |
UCGUACCGUGAGUAAUAAUGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Gastric cancer[ ICD-11:2B72] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-126 was down-regulated in gastric cancer and regulated SLC7A5 expression via binding to the SLC7A5 mRNA. | ||||
|
Thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-193a-3p regulates SLC7A5 in thyroid carcinoma | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Dual-luciferase reporter assay | ||
|
Related Molecular Changes | Down regulation ofSLC7A5 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-193a | miRNA Mature ID | miR-193a-3p | ||
|
miRNA Sequence |
AACUGGCCUACAAAGUCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Thyroid cancer[ ICD-11:2D10] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-193a-3p regulates SLC7A5 expression via binding to the SLC7A5 mRNA. | ||||
|
Unclear Phenotype |
256 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon1 |
miR-122 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon2 |
miR-1224 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-3p | ||
|
miRNA Sequence |
CCCCACCUCCUCUCUCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon3 |
miR-1226 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1226 | miRNA Mature ID | miR-1226-5p | ||
|
miRNA Sequence |
GUGAGGGCAUGCAGGCCUGGAUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon4 |
miR-1227 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1227 | miRNA Mature ID | miR-1227-5p | ||
|
miRNA Sequence |
GUGGGGCCAGGCGGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon5 |
miR-1237 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1237 | miRNA Mature ID | miR-1237-5p | ||
|
miRNA Sequence |
CGGGGGCGGGGCCGAAGCGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon6 |
miR-1249 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1249 | miRNA Mature ID | miR-1249-5p | ||
|
miRNA Sequence |
AGGAGGGAGGAGAUGGGCCAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon7 |
miR-1255a directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1255a | miRNA Mature ID | miR-1255a | ||
|
miRNA Sequence |
AGGAUGAGCAAAGAAAGUAGAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon8 |
miR-1255b directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1255b | miRNA Mature ID | miR-1255b-5p | ||
|
miRNA Sequence |
CGGAUGAGCAAAGAAAGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon9 |
miR-1260a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1260a | miRNA Mature ID | miR-1260a | ||
|
miRNA Sequence |
AUCCCACCUCUGCCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon10 |
miR-1260b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
|
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon11 |
miR-1264 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1264 | miRNA Mature ID | miR-1264 | ||
|
miRNA Sequence |
CAAGUCUUAUUUGAGCACCUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon12 |
miR-1273h directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1273h | miRNA Mature ID | miR-1273h-5p | ||
|
miRNA Sequence |
CUGGGAGGUCAAGGCUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon13 |
miR-1285 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1285 | miRNA Mature ID | miR-1285-3p | ||
|
miRNA Sequence |
UCUGGGCAACAAAGUGAGACCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon14 |
miR-1292 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1292 | miRNA Mature ID | miR-1292-5p | ||
|
miRNA Sequence |
UGGGAACGGGUUCCGGCAGACGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon15 |
miR-1295a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1295a | miRNA Mature ID | miR-1295a | ||
|
miRNA Sequence |
UUAGGCCGCAGAUCUGGGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon16 |
miR-132 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-132 | miRNA Mature ID | miR-132-5p | ||
|
miRNA Sequence |
ACCGUGGCUUUCGAUUGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon17 |
miR-140 directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-140 | miRNA Mature ID | miR-140-3p | ||
|
miRNA Sequence |
UACCACAGGGUAGAACCACGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon18 |
miR-149 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
|
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon19 |
miR-1539 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1539 | miRNA Mature ID | miR-1539 | ||
|
miRNA Sequence |
UCCUGCGCGUCCCAGAUGCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon20 |
miR-15a directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
|
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon21 |
miR-15b directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
|
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon22 |
miR-16 directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
|
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon23 |
miR-184 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-184 | miRNA Mature ID | miR-184 | ||
|
miRNA Sequence |
UGGACGGAGAACUGAUAAGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon24 |
miR-185 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-3p | ||
|
miRNA Sequence |
AGGGGCUGGCUUUCCUCUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon25 |
miR-186 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
|
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon26 |
miR-1908 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1908 | miRNA Mature ID | miR-1908-5p | ||
|
miRNA Sequence |
CGGCGGGGACGGCGAUUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon27 |
miR-193a directly targets SLC7A5 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunoflourescence//Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-193a | miRNA Mature ID | miR-193a-3p | ||
|
miRNA Sequence |
AACUGGCCUACAAAGUCCCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon28 |
miR-193b directly targets SLC7A5 | [ 27 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
|
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon29 |
miR-194 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-194 | miRNA Mature ID | miR-194-3p | ||
|
miRNA Sequence |
CCAGUGGGGCUGCUGUUAUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon30 |
miR-195 directly targets SLC7A5 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
|
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon31 |
miR-205 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-205 | miRNA Mature ID | miR-205-3p | ||
|
miRNA Sequence |
GAUUUCAGUGGAGUGAAGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon32 |
miR-214 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-214 | miRNA Mature ID | miR-214-3p | ||
|
miRNA Sequence |
ACAGCAGGCACAGACAGGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon33 |
miR-219b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-219b | miRNA Mature ID | miR-219b-5p | ||
|
miRNA Sequence |
AGAUGUCCAGCCACAAUUCUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon34 |
miR-22 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-22 | miRNA Mature ID | miR-22-3p | ||
|
miRNA Sequence |
AAGCUGCCAGUUGAAGAACUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon35 |
miR-223 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-223 | miRNA Mature ID | miR-223-3p | ||
|
miRNA Sequence |
UGUCAGUUUGUCAAAUACCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon36 |
miR-24-1 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-24-1 | miRNA Mature ID | miR-24-1-5p | ||
|
miRNA Sequence |
UGCCUACUGAGCUGAUAUCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon37 |
miR-24-2 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-24-2 | miRNA Mature ID | miR-24-2-5p | ||
|
miRNA Sequence |
UGCCUACUGAGCUGAAACACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon38 |
miR-28 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-28 | miRNA Mature ID | miR-28-5p | ||
|
miRNA Sequence |
AAGGAGCUCACAGUCUAUUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon39 |
miR-296 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-296 | miRNA Mature ID | miR-296-5p | ||
|
miRNA Sequence |
AGGGCCCCCCCUCAAUCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon40 |
miR-296 directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-296 | miRNA Mature ID | miR-296-3p | ||
|
miRNA Sequence |
GAGGGUUGGGUGGAGGCUCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon41 |
miR-3065 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3065 | miRNA Mature ID | miR-3065-3p | ||
|
miRNA Sequence |
UCAGCACCAGGAUAUUGUUGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon42 |
miR-30a directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon43 |
miR-30b directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUACACUCAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon44 |
miR-30b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGGAUGUUUACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon45 |
miR-30c directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30c | miRNA Mature ID | miR-30c-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUACACUCUCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon46 |
miR-30d directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30d | miRNA Mature ID | miR-30d-5p | ||
|
miRNA Sequence |
UGUAAACAUCCCCGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon47 |
miR-30e directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-30e | miRNA Mature ID | miR-30e-5p | ||
|
miRNA Sequence |
UGUAAACAUCCUUGACUGGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon48 |
miR-3126 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3126 | miRNA Mature ID | miR-3126-5p | ||
|
miRNA Sequence |
UGAGGGACAGAUGCCAGAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon49 |
miR-3133 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3133 | miRNA Mature ID | miR-3133 | ||
|
miRNA Sequence |
UAAAGAACUCUUAAAACCCAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon50 |
miR-3135a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3135a | miRNA Mature ID | miR-3135a | ||
|
miRNA Sequence |
UGCCUAGGCUGAGACUGCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon51 |
miR-3136 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3136 | miRNA Mature ID | miR-3136-3p | ||
|
miRNA Sequence |
UGGCCCAACCUAUUCAGUUAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon52 |
miR-3139 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3139 | miRNA Mature ID | miR-3139 | ||
|
miRNA Sequence |
UAGGAGCUCAACAGAUGCCUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon53 |
miR-3148 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
|
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon54 |
miR-3154 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3154 | miRNA Mature ID | miR-3154 | ||
|
miRNA Sequence |
CAGAAGGGGAGUUGGGAGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon55 |
miR-3155a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3155a | miRNA Mature ID | miR-3155a | ||
|
miRNA Sequence |
CCAGGCUCUGCAGUGGGAACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon56 |
miR-3155b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3155b | miRNA Mature ID | miR-3155b | ||
|
miRNA Sequence |
CCAGGCUCUGCAGUGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon57 |
miR-3173 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3173 | miRNA Mature ID | miR-3173-3p | ||
|
miRNA Sequence |
AAAGGAGGAAAUAGGCAGGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon58 |
miR-3179 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3179 | miRNA Mature ID | miR-3179 | ||
|
miRNA Sequence |
AGAAGGGGUGAAAUUUAAACGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon59 |
miR-3180 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180 | ||
|
miRNA Sequence |
UGGGGCGGAGCUUCCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon60 |
miR-3180 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3180 | miRNA Mature ID | miR-3180-3p | ||
|
miRNA Sequence |
UGGGGCGGAGCUUCCGGAGGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon61 |
miR-3187 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-3p | ||
|
miRNA Sequence |
UUGGCCAUGGGGCUGCGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon62 |
miR-3187 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-5p | ||
|
miRNA Sequence |
CCUGGGCAGCGUGUGGCUGAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon63 |
miR-3189 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3189 | miRNA Mature ID | miR-3189-3p | ||
|
miRNA Sequence |
CCCUUGGGUCUGAUGGGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon64 |
miR-3192 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3192 | miRNA Mature ID | miR-3192-5p | ||
|
miRNA Sequence |
UCUGGGAGGUUGUAGCAGUGGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon65 |
miR-3196 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3196 | miRNA Mature ID | miR-3196 | ||
|
miRNA Sequence |
CGGGGCGGCAGGGGCCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon66 |
miR-3199 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3199 | miRNA Mature ID | miR-3199 | ||
|
miRNA Sequence |
AGGGACUGCCUUAGGAGAAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon67 |
miR-3202 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3202 | miRNA Mature ID | miR-3202 | ||
|
miRNA Sequence |
UGGAAGGGAGAAGAGCUUUAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon68 |
miR-338 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-338 | miRNA Mature ID | miR-338-3p | ||
|
miRNA Sequence |
UCCAGCAUCAGUGAUUUUGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon69 |
miR-33a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-33a | miRNA Mature ID | miR-33a-5p | ||
|
miRNA Sequence |
GUGCAUUGUAGUUGCAUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon70 |
miR-33b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-33b | miRNA Mature ID | miR-33b-5p | ||
|
miRNA Sequence |
GUGCAUUGCUGUUGCAUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon71 |
miR-3611 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3611 | miRNA Mature ID | miR-3611 | ||
|
miRNA Sequence |
UUGUGAAGAAAGAAAUUCUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon72 |
miR-3612 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3612 | miRNA Mature ID | miR-3612 | ||
|
miRNA Sequence |
AGGAGGCAUCUUGAGAAAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon73 |
miR-3619 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3619 | miRNA Mature ID | miR-3619-5p | ||
|
miRNA Sequence |
UCAGCAGGCAGGCUGGUGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon74 |
miR-3661 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3661 | miRNA Mature ID | miR-3661 | ||
|
miRNA Sequence |
UGACCUGGGACUCGGACAGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon75 |
miR-3664 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3664 | miRNA Mature ID | miR-3664-3p | ||
|
miRNA Sequence |
UCUCAGGAGUAAAGACAGAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon76 |
miR-3689a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689a | miRNA Mature ID | miR-3689a-3p | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUCGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon77 |
miR-3689b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689b | miRNA Mature ID | miR-3689b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon78 |
miR-3689c directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689c | miRNA Mature ID | miR-3689c | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon79 |
miR-3689d directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3689d | miRNA Mature ID | miR-3689d | ||
|
miRNA Sequence |
GGGAGGUGUGAUCUCACACUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon80 |
miR-383 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
|
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon81 |
miR-3911 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3911 | miRNA Mature ID | miR-3911 | ||
|
miRNA Sequence |
UGUGUGGAUCCUGGAGGAGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon82 |
miR-3929 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3929 | miRNA Mature ID | miR-3929 | ||
|
miRNA Sequence |
GAGGCUGAUGUGAGUAGACCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon83 |
miR-3934 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3934 | miRNA Mature ID | miR-3934-3p | ||
|
miRNA Sequence |
UGCUCAGGUUGCACAGCUGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon84 |
miR-3937 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3937 | miRNA Mature ID | miR-3937 | ||
|
miRNA Sequence |
ACAGGCGGCUGUAGCAAUGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon85 |
miR-4260 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4260 | miRNA Mature ID | miR-4260 | ||
|
miRNA Sequence |
CUUGGGGCAUGGAGUCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon86 |
miR-4264 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4264 | miRNA Mature ID | miR-4264 | ||
|
miRNA Sequence |
ACUCAGUCAUGGUCAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon87 |
miR-4267 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
|
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon88 |
miR-4270 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4270 | miRNA Mature ID | miR-4270 | ||
|
miRNA Sequence |
UCAGGGAGUCAGGGGAGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon89 |
miR-4271 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4271 | miRNA Mature ID | miR-4271 | ||
|
miRNA Sequence |
GGGGGAAGAAAAGGUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon90 |
miR-4285 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4285 | miRNA Mature ID | miR-4285 | ||
|
miRNA Sequence |
GCGGCGAGUCCGACUCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon91 |
miR-4302 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4302 | miRNA Mature ID | miR-4302 | ||
|
miRNA Sequence |
CCAGUGUGGCUCAGCGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon92 |
miR-4434 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
|
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon93 |
miR-4435 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4435 | miRNA Mature ID | miR-4435 | ||
|
miRNA Sequence |
AUGGCCAGAGCUCACACAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon94 |
miR-4436a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4436a | miRNA Mature ID | miR-4436a | ||
|
miRNA Sequence |
GCAGGACAGGCAGAAGUGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon95 |
miR-4441 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4441 | miRNA Mature ID | miR-4441 | ||
|
miRNA Sequence |
ACAGGGAGGAGAUUGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon96 |
miR-4443 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4443 | miRNA Mature ID | miR-4443 | ||
|
miRNA Sequence |
UUGGAGGCGUGGGUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon97 |
miR-4471 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4471 | miRNA Mature ID | miR-4471 | ||
|
miRNA Sequence |
UGGGAACUUAGUAGAGGUUUAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon98 |
miR-4475 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4475 | miRNA Mature ID | miR-4475 | ||
|
miRNA Sequence |
CAAGGGACCAAGCAUUCAUUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon99 |
miR-4476 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4476 | miRNA Mature ID | miR-4476 | ||
|
miRNA Sequence |
CAGGAAGGAUUUAGGGACAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon100 |
miR-4478 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4478 | miRNA Mature ID | miR-4478 | ||
|
miRNA Sequence |
GAGGCUGAGCUGAGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon101 |
miR-4481 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4481 | miRNA Mature ID | miR-4481 | ||
|
miRNA Sequence |
GGAGUGGGCUGGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon102 |
miR-4488 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4488 | miRNA Mature ID | miR-4488 | ||
|
miRNA Sequence |
AGGGGGCGGGCUCCGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon103 |
miR-449b directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-449b | miRNA Mature ID | miR-449b-3p | ||
|
miRNA Sequence |
CAGCCACAACUACCCUGCCACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon104 |
miR-4510 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4510 | miRNA Mature ID | miR-4510 | ||
|
miRNA Sequence |
UGAGGGAGUAGGAUGUAUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon105 |
miR-4515 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4515 | miRNA Mature ID | miR-4515 | ||
|
miRNA Sequence |
AGGACUGGACUCCCGGCAGCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon106 |
miR-4516 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
|
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon107 |
miR-4530 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4530 | miRNA Mature ID | miR-4530 | ||
|
miRNA Sequence |
CCCAGCAGGACGGGAGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon108 |
miR-4531 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4531 | miRNA Mature ID | miR-4531 | ||
|
miRNA Sequence |
AUGGAGAAGGCUUCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon109 |
miR-4650 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4650 | miRNA Mature ID | miR-4650-5p | ||
|
miRNA Sequence |
UCAGGCCUCUUUCUACCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon110 |
miR-4663 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4663 | miRNA Mature ID | miR-4663 | ||
|
miRNA Sequence |
AGCUGAGCUCCAUGGACGUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon111 |
miR-4668 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4668 | miRNA Mature ID | miR-4668-5p | ||
|
miRNA Sequence |
AGGGAAAAAAAAAAGGAUUUGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon112 |
miR-4690 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4690 | miRNA Mature ID | miR-4690-5p | ||
|
miRNA Sequence |
GAGCAGGCGAGGCUGGGCUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon113 |
miR-4691 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4691 | miRNA Mature ID | miR-4691-3p | ||
|
miRNA Sequence |
CCAGCCACGGACUGAGAGUGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon114 |
miR-4697 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4697 | miRNA Mature ID | miR-4697-3p | ||
|
miRNA Sequence |
UGUCAGUGACUCCUGCCCCUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon115 |
miR-4697 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4697 | miRNA Mature ID | miR-4697-5p | ||
|
miRNA Sequence |
AGGGGGCGCAGUCACUGACGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon116 |
miR-4700 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4700 | miRNA Mature ID | miR-4700-3p | ||
|
miRNA Sequence |
CACAGGACUGACUCCUCACCCCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon117 |
miR-4701 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
|
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon118 |
miR-4704 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4704 | miRNA Mature ID | miR-4704-3p | ||
|
miRNA Sequence |
UCAGUCACAUAUCUAGUGUCUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon119 |
miR-4706 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4706 | miRNA Mature ID | miR-4706 | ||
|
miRNA Sequence |
AGCGGGGAGGAAGUGGGCGCUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon120 |
miR-4711 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4711 | miRNA Mature ID | miR-4711-5p | ||
|
miRNA Sequence |
UGCAUCAGGCCAGAAGACAUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon121 |
miR-4716 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4716 | miRNA Mature ID | miR-4716-3p | ||
|
miRNA Sequence |
AAGGGGGAAGGAAACAUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon122 |
miR-4722 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-5p | ||
|
miRNA Sequence |
GGCAGGAGGGCUGUGCCAGGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon123 |
miR-4723 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
|
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon124 |
miR-4725 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4725 | miRNA Mature ID | miR-4725-3p | ||
|
miRNA Sequence |
UGGGGAAGGCGUCAGUGUCGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon125 |
miR-4728 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
|
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon126 |
miR-4734 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4734 | miRNA Mature ID | miR-4734 | ||
|
miRNA Sequence |
GCUGCGGGCUGCGGUCAGGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon127 |
miR-4745 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4745 | miRNA Mature ID | miR-4745-5p | ||
|
miRNA Sequence |
UGAGUGGGGCUCCCGGGACGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon128 |
miR-4747 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4747 | miRNA Mature ID | miR-4747-5p | ||
|
miRNA Sequence |
AGGGAAGGAGGCUUGGUCUUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon129 |
miR-4749 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4749 | miRNA Mature ID | miR-4749-5p | ||
|
miRNA Sequence |
UGCGGGGACAGGCCAGGGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon130 |
miR-4755 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4755 | miRNA Mature ID | miR-4755-3p | ||
|
miRNA Sequence |
AGCCAGGCUCUGAAGGGAAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon131 |
miR-4779 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4779 | miRNA Mature ID | miR-4779 | ||
|
miRNA Sequence |
UAGGAGGGAAUAGUAAAAGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon132 |
miR-4781 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4781 | miRNA Mature ID | miR-4781-5p | ||
|
miRNA Sequence |
UAGCGGGGAUUCCAAUAUUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon133 |
miR-4796 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4796 | miRNA Mature ID | miR-4796-3p | ||
|
miRNA Sequence |
UAAAGUGGCAGAGUAUAGACAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon134 |
miR-4797 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4797 | miRNA Mature ID | miR-4797-5p | ||
|
miRNA Sequence |
GACAGAGUGCCACUUACUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon135 |
miR-484 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
|
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon136 |
miR-485 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-485 | miRNA Mature ID | miR-485-5p | ||
|
miRNA Sequence |
AGAGGCUGGCCGUGAUGAAUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon137 |
miR-493 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-493 | miRNA Mature ID | miR-493-3p | ||
|
miRNA Sequence |
UGAAGGUCUACUGUGUGCCAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon138 |
miR-5000 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5000 | miRNA Mature ID | miR-5000-3p | ||
|
miRNA Sequence |
UCAGGACACUUCUGAACUUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon139 |
miR-5008 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5008 | miRNA Mature ID | miR-5008-5p | ||
|
miRNA Sequence |
UGAGGCCCUUGGGGCACAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon140 |
miR-504 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
|
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon141 |
miR-513b directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-513b | miRNA Mature ID | miR-513b-3p | ||
|
miRNA Sequence |
AAAUGUCACCUUUUUGAGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon142 |
miR-5186 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5186 | miRNA Mature ID | miR-5186 | ||
|
miRNA Sequence |
AGAGAUUGGUAGAAAUCAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon143 |
miR-5187 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5187 | miRNA Mature ID | miR-5187-5p | ||
|
miRNA Sequence |
UGGGAUGAGGGAUUGAAGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon144 |
miR-5189 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5189 | miRNA Mature ID | miR-5189-5p | ||
|
miRNA Sequence |
UCUGGGCACAGGCGGAUGGACAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon145 |
miR-5195 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5195 | miRNA Mature ID | miR-5195-5p | ||
|
miRNA Sequence |
AACCCCUAAGGCAACUGGAUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon146 |
miR-5196 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5196 | miRNA Mature ID | miR-5196-5p | ||
|
miRNA Sequence |
AGGGAAGGGGACGAGGGUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon147 |
miR-5197 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-3p | ||
|
miRNA Sequence |
AAGAAGAGACUGAGUCAUCGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon148 |
miR-532 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-532 | miRNA Mature ID | miR-532-3p | ||
|
miRNA Sequence |
CCUCCCACACCCAAGGCUUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon149 |
miR-542 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-542 | miRNA Mature ID | miR-542-3p | ||
|
miRNA Sequence |
UGUGACAGAUUGAUAACUGAAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon150 |
miR-548ag directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ag | miRNA Mature ID | miR-548ag | ||
|
miRNA Sequence |
AAAGGUAAUUGUGGUUUCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon151 |
miR-548ai directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ai | miRNA Mature ID | miR-548ai | ||
|
miRNA Sequence |
AAAGGUAAUUGCAGUUUUUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon152 |
miR-548ba directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ba | miRNA Mature ID | miR-548ba | ||
|
miRNA Sequence |
AAAGGUAACUGUGAUUUUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon153 |
miR-548c directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-3p | ||
|
miRNA Sequence |
CAAAAAUCUCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon154 |
miR-548s directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon155 |
miR-551b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-551b | miRNA Mature ID | miR-551b-5p | ||
|
miRNA Sequence |
GAAAUCAAGCGUGGGUGAGACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon156 |
miR-5584 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5584 | miRNA Mature ID | miR-5584-5p | ||
|
miRNA Sequence |
CAGGGAAAUGGGAAGAACUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon157 |
miR-5693 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5693 | miRNA Mature ID | miR-5693 | ||
|
miRNA Sequence |
GCAGUGGCUCUGAAAUGAACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon158 |
miR-5698 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon159 |
miR-570 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-570 | miRNA Mature ID | miR-570-5p | ||
|
miRNA Sequence |
AAAGGUAAUUGCAGUUUUUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon160 |
miR-5700 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5700 | miRNA Mature ID | miR-5700 | ||
|
miRNA Sequence |
UAAUGCAUUAAAUUAUUGAAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon161 |
miR-5703 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
|
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon162 |
miR-574 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
|
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon163 |
miR-586 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-586 | miRNA Mature ID | miR-586 | ||
|
miRNA Sequence |
UAUGCAUUGUAUUUUUAGGUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon164 |
miR-588 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-588 | miRNA Mature ID | miR-588 | ||
|
miRNA Sequence |
UUGGCCACAAUGGGUUAGAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon165 |
miR-598 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-598 | miRNA Mature ID | miR-598-3p | ||
|
miRNA Sequence |
UACGUCAUCGUUGUCAUCGUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon166 |
miR-604 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-604 | miRNA Mature ID | miR-604 | ||
|
miRNA Sequence |
AGGCUGCGGAAUUCAGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon167 |
miR-6085 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6085 | miRNA Mature ID | miR-6085 | ||
|
miRNA Sequence |
AAGGGGCUGGGGGAGCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon168 |
miR-612 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-612 | miRNA Mature ID | miR-612 | ||
|
miRNA Sequence |
GCUGGGCAGGGCUUCUGAGCUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon169 |
miR-6127 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6127 | miRNA Mature ID | miR-6127 | ||
|
miRNA Sequence |
UGAGGGAGUGGGUGGGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon170 |
miR-6129 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6129 | miRNA Mature ID | miR-6129 | ||
|
miRNA Sequence |
UGAGGGAGUUGGGUGUAUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon171 |
miR-6130 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6130 | miRNA Mature ID | miR-6130 | ||
|
miRNA Sequence |
UGAGGGAGUGGAUUGUAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon172 |
miR-6133 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6133 | miRNA Mature ID | miR-6133 | ||
|
miRNA Sequence |
UGAGGGAGGAGGUUGGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon173 |
miR-6165 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6165 | miRNA Mature ID | miR-6165 | ||
|
miRNA Sequence |
CAGCAGGAGGUGAGGGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon174 |
miR-619 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
|
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon175 |
miR-625 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-625 | miRNA Mature ID | miR-625-5p | ||
|
miRNA Sequence |
AGGGGGAAAGUUCUAUAGUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon176 |
miR-631 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-631 | miRNA Mature ID | miR-631 | ||
|
miRNA Sequence |
AGACCUGGCCCAGACCUCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon177 |
miR-647 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-647 | miRNA Mature ID | miR-647 | ||
|
miRNA Sequence |
GUGGCUGCACUCACUUCCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon178 |
miR-6499 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon179 |
miR-650 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-650 | miRNA Mature ID | miR-650 | ||
|
miRNA Sequence |
AGGAGGCAGCGCUCUCAGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon180 |
miR-6506 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
|
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon181 |
miR-6509 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6509 | miRNA Mature ID | miR-6509-3p | ||
|
miRNA Sequence |
UUCCACUGCCACUACCUAAUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon182 |
miR-6512 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6512 | miRNA Mature ID | miR-6512-3p | ||
|
miRNA Sequence |
UUCCAGCCCUUCUAAUGGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon183 |
miR-6515 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6515 | miRNA Mature ID | miR-6515-5p | ||
|
miRNA Sequence |
UUGGAGGGUGUGGAAGACAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon184 |
miR-658 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-658 | miRNA Mature ID | miR-658 | ||
|
miRNA Sequence |
GGCGGAGGGAAGUAGGUCCGUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon185 |
miR-663a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-663a | miRNA Mature ID | miR-663a | ||
|
miRNA Sequence |
AGGCGGGGCGCCGCGGGACCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon186 |
miR-665 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-665 | miRNA Mature ID | miR-665 | ||
|
miRNA Sequence |
ACCAGGAGGCUGAGGCCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon187 |
miR-671 directly targets SLC7A5 | [ 28 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-671 | miRNA Mature ID | miR-671-5p | ||
|
miRNA Sequence |
AGGAAGCCCUGGAGGGGCUGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon188 |
miR-6720 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-5p | ||
|
miRNA Sequence |
UUCCAGCCCUGGUAGGCGCCGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon189 |
miR-6721 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6721 | miRNA Mature ID | miR-6721-5p | ||
|
miRNA Sequence |
UGGGCAGGGGCUUAUUGUAGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon190 |
miR-6724 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6724 | miRNA Mature ID | miR-6724-5p | ||
|
miRNA Sequence |
CUGGGCCCGCGGCGGGCGUGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon191 |
miR-6728 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6728 | miRNA Mature ID | miR-6728-5p | ||
|
miRNA Sequence |
UUGGGAUGGUAGGACCAGAGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon192 |
miR-6731 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6731 | miRNA Mature ID | miR-6731-5p | ||
|
miRNA Sequence |
UGGGAGAGCAGGGUAUUGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon193 |
miR-6734 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6734 | miRNA Mature ID | miR-6734-5p | ||
|
miRNA Sequence |
UUGAGGGGAGAAUGAGGUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon194 |
miR-6754 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6754 | miRNA Mature ID | miR-6754-5p | ||
|
miRNA Sequence |
CCAGGGAGGCUGGUUUGGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon195 |
miR-6755 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6755 | miRNA Mature ID | miR-6755-5p | ||
|
miRNA Sequence |
UAGGGUAGACACUGACAACGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon196 |
miR-6757 directly targets SLC7A5 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6757 | miRNA Mature ID | miR-6757-5p | ||
|
miRNA Sequence |
UAGGGAUGGGAGGCCAGGAUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon197 |
miR-6760 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6760 | miRNA Mature ID | miR-6760-5p | ||
|
miRNA Sequence |
CAGGGAGAAGGUGGAAGUGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon198 |
miR-6762 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6762 | miRNA Mature ID | miR-6762-3p | ||
|
miRNA Sequence |
UGGCUGCUUCCCUUGGUCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon199 |
miR-6773 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6773 | miRNA Mature ID | miR-6773-5p | ||
|
miRNA Sequence |
UUGGGCCCAGGAGUAAACAGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon200 |
miR-6777 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6777 | miRNA Mature ID | miR-6777-5p | ||
|
miRNA Sequence |
ACGGGGAGUCAGGCAGUGGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon201 |
miR-6778 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
|
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon202 |
miR-6779 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6779 | miRNA Mature ID | miR-6779-5p | ||
|
miRNA Sequence |
CUGGGAGGGGCUGGGUUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon203 |
miR-6780a directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-5p | ||
|
miRNA Sequence |
UUGGGAGGGAAGACAGCUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon204 |
miR-6781 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6781 | miRNA Mature ID | miR-6781-5p | ||
|
miRNA Sequence |
CGGGCCGGAGGUCAAGGGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon205 |
miR-6785 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
|
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon206 |
miR-6786 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6786 | miRNA Mature ID | miR-6786-3p | ||
|
miRNA Sequence |
UGACGCCCCUUCUGAUUCUGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon207 |
miR-6787 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6787 | miRNA Mature ID | miR-6787-5p | ||
|
miRNA Sequence |
UGGCGGGGGUAGAGCUGGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon208 |
miR-6791 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
|
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon209 |
miR-6794 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6794 | miRNA Mature ID | miR-6794-5p | ||
|
miRNA Sequence |
CAGGGGGACUGGGGGUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon210 |
miR-6797 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6797 | miRNA Mature ID | miR-6797-5p | ||
|
miRNA Sequence |
AGGAGGGAAGGGGCUGAGAACAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon211 |
miR-6799 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
|
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon212 |
miR-6813 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6813 | miRNA Mature ID | miR-6813-5p | ||
|
miRNA Sequence |
CAGGGGCUGGGGUUUCAGGUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon213 |
miR-6816 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6816 | miRNA Mature ID | miR-6816-5p | ||
|
miRNA Sequence |
UGGGGCGGGGCAGGUCCCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon214 |
miR-6820 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6820 | miRNA Mature ID | miR-6820-5p | ||
|
miRNA Sequence |
UGCGGCAGAGCUGGGGUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon215 |
miR-6821 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-5p | ||
|
miRNA Sequence |
GUGCGUGGUGGCUCGAGGCGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon216 |
miR-6823 directly targets SLC7A5 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6823 | miRNA Mature ID | miR-6823-5p | ||
|
miRNA Sequence |
UCAGGGUUGGUAGGGGUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon217 |
miR-6825 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6825 | miRNA Mature ID | miR-6825-5p | ||
|
miRNA Sequence |
UGGGGAGGUGUGGAGUCAGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon218 |
miR-6828 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6828 | miRNA Mature ID | miR-6828-5p | ||
|
miRNA Sequence |
AGGAAGCAAGAGAACCCUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon219 |
miR-6829 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
|
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon220 |
miR-6829 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-5p | ||
|
miRNA Sequence |
UGGGCUGCUGAGAAGGGGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon221 |
miR-6834 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6834 | miRNA Mature ID | miR-6834-5p | ||
|
miRNA Sequence |
GUGAGGGACUGGGAUUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon222 |
miR-6836 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6836 | miRNA Mature ID | miR-6836-3p | ||
|
miRNA Sequence |
AUGCCUCCCCCGGCCCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon223 |
miR-6846 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6846 | miRNA Mature ID | miR-6846-3p | ||
|
miRNA Sequence |
UGACCCCUUCUGUCUCCCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon224 |
miR-6851 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-5p | ||
|
miRNA Sequence |
AGGAGGUGGUACUAGGGGCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon225 |
miR-6853 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6853 | miRNA Mature ID | miR-6853-5p | ||
|
miRNA Sequence |
AGCGUGGGAUGUCCAUGAAGUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon226 |
miR-6854 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6854 | miRNA Mature ID | miR-6854-5p | ||
|
miRNA Sequence |
AAGCUCAGGUUUGAGAACUGCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon227 |
miR-6860 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6860 | miRNA Mature ID | miR-6860 | ||
|
miRNA Sequence |
ACUGGGCAGGGCUGUGGUGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon228 |
miR-6870 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
|
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon229 |
miR-6875 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6875 | miRNA Mature ID | miR-6875-5p | ||
|
miRNA Sequence |
UGAGGGACCCAGGACAGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon230 |
miR-6876 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6876 | miRNA Mature ID | miR-6876-5p | ||
|
miRNA Sequence |
CAGGAAGGAGACAGGCAGUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon231 |
miR-6877 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6877 | miRNA Mature ID | miR-6877-5p | ||
|
miRNA Sequence |
AGGGCCGAAGGGUGGAAGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon232 |
miR-6882 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6882 | miRNA Mature ID | miR-6882-3p | ||
|
miRNA Sequence |
UGCUGCCUCUCCUCUUGCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon233 |
miR-6883 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
|
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon234 |
miR-6884 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6884 | miRNA Mature ID | miR-6884-5p | ||
|
miRNA Sequence |
AGAGGCUGAGAAGGUGAUGUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon235 |
miR-6889 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6889 | miRNA Mature ID | miR-6889-5p | ||
|
miRNA Sequence |
UCGGGGAGUCUGGGGUCCGGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon236 |
miR-6890 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
|
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon237 |
miR-6891 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6891 | miRNA Mature ID | miR-6891-5p | ||
|
miRNA Sequence |
UAAGGAGGGGGAUGAGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon238 |
miR-708 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-708 | miRNA Mature ID | miR-708-5p | ||
|
miRNA Sequence |
AAGGAGCUUACAAUCUAGCUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon239 |
miR-7106 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
|
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon240 |
miR-7111 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
|
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon241 |
miR-7155 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7155 | miRNA Mature ID | miR-7155-3p | ||
|
miRNA Sequence |
UGGCCCAAGACCUCAGACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon242 |
miR-7160 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-3p | ||
|
miRNA Sequence |
CAGGGCCCUGGCUUUAGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon243 |
miR-7160 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-5p | ||
|
miRNA Sequence |
UGCUGAGGUCCGGGCUGUGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon244 |
miR-7515 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7515 | miRNA Mature ID | miR-7515 | ||
|
miRNA Sequence |
AGAAGGGAAGAUGGUGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon245 |
miR-761 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-761 | miRNA Mature ID | miR-761 | ||
|
miRNA Sequence |
GCAGCAGGGUGAAACUGACACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon246 |
miR-765 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-765 | miRNA Mature ID | miR-765 | ||
|
miRNA Sequence |
UGGAGGAGAAGGAAGGUGAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon247 |
miR-769 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-769 | miRNA Mature ID | miR-769-5p | ||
|
miRNA Sequence |
UGAGACCUCUGGGUUCUGAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon248 |
miR-7847 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7847 | miRNA Mature ID | miR-7847-3p | ||
|
miRNA Sequence |
CGUGGAGGACGAGGAGGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon249 |
miR-7851 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7851 | miRNA Mature ID | miR-7851-3p | ||
|
miRNA Sequence |
UACCUGGGAGACUGAGGUUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon250 |
miR-7977 directly targets SLC7A5 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
|
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon251 |
miR-8052 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8052 | miRNA Mature ID | miR-8052 | ||
|
miRNA Sequence |
CGGGACUGUAGAGGGCAUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon252 |
miR-8059 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8059 | miRNA Mature ID | miR-8059 | ||
|
miRNA Sequence |
GGGGAACUGUAGAUGAAAAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon253 |
miR-8085 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8085 | miRNA Mature ID | miR-8085 | ||
|
miRNA Sequence |
UGGGAGAGAGGACUGUGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon254 |
miR-873 directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-873 | miRNA Mature ID | miR-873-5p | ||
|
miRNA Sequence |
GCAGGAACUUGUGAGUCUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon255 |
miR-92b directly targets SLC7A5 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-5p | ||
|
miRNA Sequence |
AGGGACGGGACGCGGUGCAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon256 |
miR-9500 directly targets SLC7A5 | [ 23 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-9500 | miRNA Mature ID | miR-9500 | ||
|
miRNA Sequence |
AAGGGAAGAUGGUGACCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.