Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0464 Transporter Info
Gene Name	SLC7A11
Transporter Name	Cystine/glutamate transporter
Gene ID	23657
UniProt ID	Q9UPY5

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg10265016)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.29E+00	Statistic Test	p-value:1.02E-06; Z-score:1.35E+00
Methylation in Case	5.69E-01 (Median)	Methylation in Control	4.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg18935813)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.80E+00	Statistic Test	p-value:5.22E-18; Z-score:1.56E+00
Methylation in Case	7.22E-02 (Median)	Methylation in Control	4.02E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg07354253)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.22E+00	Statistic Test	p-value:1.98E-07; Z-score:-1.35E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	1stExon (cg25437385)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.35E+00	Statistic Test	p-value:5.50E-07; Z-score:4.92E-01
Methylation in Case	7.68E-02 (Median)	Methylation in Control	5.68E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg03731131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:2.18E-07; Z-score:1.55E+00
Methylation in Case	6.38E-01 (Median)	Methylation in Control	4.49E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg24733435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:4.47E-03; Z-score:7.17E-01
Methylation in Case	7.93E-01 (Median)	Methylation in Control	7.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC7A11 in pancretic ductal adenocarcinoma			[ 1 ]
Location	Body (cg04433051)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.39E+00	Statistic Test	p-value:6.56E-03; Z-score:-9.30E-01
Methylation in Case	3.47E-01 (Median)	Methylation in Control	4.84E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]
Experimental Material	Patient tissue samples
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	TSS1500 (cg00361146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.17E+00	Statistic Test	p-value:1.55E-02; Z-score:4.19E-01
Methylation in Case	4.76E-02 (Median)	Methylation in Control	4.06E-02 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	TSS1500 (cg02102889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.04E-02; Z-score:-4.66E-01
Methylation in Case	7.06E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg21877274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:4.72E-12; Z-score:-2.66E+00
Methylation in Case	8.24E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:8.41E-10; Z-score:-1.78E+00
Methylation in Case	7.52E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg02734904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.88E-07; Z-score:-1.42E+00
Methylation in Case	8.59E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg01309945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:5.23E-05; Z-score:-1.22E+00
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg04487857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:5.55E-05; Z-score:1.88E+00
Methylation in Case	6.12E-01 (Median)	Methylation in Control	5.06E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg06206831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:8.72E-05; Z-score:-1.09E+00
Methylation in Case	8.75E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC7A11 in breast cancer			[ 2 ]
Location	Body (cg15867963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.25E-04; Z-score:1.35E+00
Methylation in Case	6.73E-01 (Median)	Methylation in Control	5.95E-01 (Median)
Studied Phenotype	Breast cancer[ ICD-11:2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in colorectal cancer			[ 3 ]
Location	TSS1500 (cg02102889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.20E+00	Statistic Test	p-value:4.78E-08; Z-score:-2.02E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in colorectal cancer			[ 3 ]
Location	Body (cg15867963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.37E+00	Statistic Test	p-value:2.01E-07; Z-score:1.77E+00
Methylation in Case	7.51E-01 (Median)	Methylation in Control	5.47E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in colorectal cancer			[ 3 ]
Location	Body (cg01309945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:3.45E-07; Z-score:-1.78E+00
Methylation in Case	8.72E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in colorectal cancer			[ 3 ]
Location	Body (cg04487857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.42E+00	Statistic Test	p-value:1.75E-05; Z-score:1.54E+00
Methylation in Case	6.75E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in colorectal cancer			[ 3 ]
Location	Body (cg15441006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.09E-02; Z-score:-5.70E-01
Methylation in Case	7.73E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Colorectal cancer[ ICD-11:2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	17 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	TSS1500 (cg02102889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:5.81E-08; Z-score:-8.95E-01
Methylation in Case	7.03E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	1stExon (cg16399511)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.59E+00	Statistic Test	p-value:2.78E-23; Z-score:-4.76E+00
Methylation in Case	4.45E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg21460403)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.01E+00	Statistic Test	p-value:4.49E-22; Z-score:-5.12E+00
Methylation in Case	3.38E-01 (Median)	Methylation in Control	6.79E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg07845352)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.72E+00	Statistic Test	p-value:3.05E-17; Z-score:-2.86E+00
Methylation in Case	3.75E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg20141652)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.21E+00	Statistic Test	p-value:2.65E-12; Z-score:1.87E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg19063061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:2.25E+00	Statistic Test	p-value:5.72E-11; Z-score:3.86E+00
Methylation in Case	4.57E-01 (Median)	Methylation in Control	2.03E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg06690548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:9.71E-09; Z-score:-1.89E+00
Methylation in Case	5.53E-01 (Median)	Methylation in Control	6.94E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg02734904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.11E+00	Statistic Test	p-value:4.02E-08; Z-score:-2.11E+00
Methylation in Case	7.36E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon9	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg21877274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:9.67E-08; Z-score:-2.65E+00
Methylation in Case	7.19E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon10	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg07661704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.07E+00	Statistic Test	p-value:5.68E-06; Z-score:-8.84E-01
Methylation in Case	6.11E-01 (Median)	Methylation in Control	6.56E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon11	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg04474257)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.11E-05; Z-score:-1.06E+00
Methylation in Case	6.59E-01 (Median)	Methylation in Control	7.20E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon12	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg15867963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:1.34E-05; Z-score:-1.94E+00
Methylation in Case	6.27E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon13	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg06206831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.42E-05; Z-score:-8.87E-01
Methylation in Case	8.33E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon14	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg01309945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.50E-05; Z-score:-8.60E-01
Methylation in Case	7.77E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon15	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg06623625)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.09E+00	Statistic Test	p-value:1.43E-04; Z-score:-6.03E-01
Methylation in Case	7.00E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon16	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg15441006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:2.36E-03; Z-score:-2.62E-01
Methylation in Case	6.89E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon17	Methylation of SLC7A11 in hepatocellular carcinoma			[ 4 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.04E-02; Z-score:-3.20E-01
Methylation in Case	5.90E-01 (Median)	Methylation in Control	6.11E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma[ ICD-11:2C12.02]
Experimental Material	Patient tissue samples
HIV infection	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in HIV infection			[ 5 ]
Location	TSS1500 (cg02102889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.05E-02; Z-score:-4.46E-01
Methylation in Case	8.22E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in HIV infection			[ 5 ]
Location	Body (cg07661704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.27E+00	Statistic Test	p-value:6.38E-10; Z-score:2.08E+00
Methylation in Case	7.24E-01 (Median)	Methylation in Control	5.69E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in HIV infection			[ 5 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:1.97E-06; Z-score:-1.50E+00
Methylation in Case	7.83E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in HIV infection			[ 5 ]
Location	Body (cg21877274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.71E-05; Z-score:-1.89E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in HIV infection			[ 5 ]
Location	Body (cg06623625)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.02E+00	Statistic Test	p-value:9.46E-03; Z-score:-8.07E-01
Methylation in Case	9.26E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in HIV infection			[ 5 ]
Location	Body (cg06206831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:4.18E-02; Z-score:-6.84E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	HIV infection[ ICD-11:1C62.Z]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in panic disorder			[ 6 ]
Location	TSS1500 (cg02102889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-8.38E-01	Statistic Test	p-value:3.71E-04; Z-score:-5.16E-01
Methylation in Case	-8.51E-01 (Median)	Methylation in Control	-7.14E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in panic disorder			[ 6 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-4.41E-01	Statistic Test	p-value:1.08E-06; Z-score:-9.06E-01
Methylation in Case	-5.96E-01 (Median)	Methylation in Control	-2.63E-01 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in panic disorder			[ 6 ]
Location	Body (cg02734904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.36E+00	Statistic Test	p-value:7.18E-04; Z-score:-5.25E-01
Methylation in Case	7.46E-01 (Median)	Methylation in Control	1.01E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in panic disorder			[ 6 ]
Location	Body (cg04487857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:2.21E-02; Z-score:5.65E-01
Methylation in Case	2.47E+00 (Median)	Methylation in Control	2.33E+00 (Median)
Studied Phenotype	Panic disorder[ ICD-11:6B01]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in prostate cancer			[ 7 ]
Location	TSS1500 (cg11200963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.36E+00	Statistic Test	p-value:2.95E-02; Z-score:2.45E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	5.37E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in prostate cancer			[ 7 ]
Location	3'UTR (cg19926635)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.13E+00	Statistic Test	p-value:1.62E-02; Z-score:1.95E+00
Methylation in Case	7.42E-01 (Median)	Methylation in Control	6.55E-01 (Median)
Studied Phenotype	Prostate cancer[ ICD-11:2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in systemic lupus erythematosus			[ 8 ]
Location	TSS1500 (cg00361146)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.12E+00	Statistic Test	p-value:1.38E-03; Z-score:-2.21E-01
Methylation in Case	8.24E-02 (Median)	Methylation in Control	9.21E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in systemic lupus erythematosus			[ 8 ]
Location	TSS1500 (cg02102889)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:2.70E-02; Z-score:3.66E-01
Methylation in Case	7.43E-01 (Median)	Methylation in Control	7.00E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in systemic lupus erythematosus			[ 8 ]
Location	Body (cg07661704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.07E+00	Statistic Test	p-value:2.08E-07; Z-score:5.52E-01
Methylation in Case	6.34E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in systemic lupus erythematosus			[ 8 ]
Location	Body (cg01309945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.29E-03; Z-score:-1.95E-01
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in systemic lupus erythematosus			[ 8 ]
Location	Body (cg06623625)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.00E+00	Statistic Test	p-value:2.67E-02; Z-score:-1.57E-01
Methylation in Case	9.18E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in systemic lupus erythematosus			[ 8 ]
Location	Body (cg21877274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:2.72E-02; Z-score:-1.61E-01
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.87E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus[ ICD-11:4A40.0]
Experimental Material	Patient tissue samples
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	TSS200 (cg13028471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.33E+00	Statistic Test	p-value:5.55E-03; Z-score:-2.15E+00
Methylation in Case	3.83E-02 (Median)	Methylation in Control	8.90E-02 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg15867963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.65E+00	Statistic Test	p-value:6.57E-07; Z-score:5.61E+00
Methylation in Case	7.30E-01 (Median)	Methylation in Control	4.42E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg06690548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.57E+00	Statistic Test	p-value:6.76E-07; Z-score:-5.59E+00
Methylation in Case	3.93E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.25E+00	Statistic Test	p-value:2.06E-05; Z-score:-7.07E+00
Methylation in Case	6.96E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg02734904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:1.16E-03; Z-score:-3.93E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg04487857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.92E+00	Statistic Test	p-value:1.81E-03; Z-score:-3.67E+00
Methylation in Case	1.97E-01 (Median)	Methylation in Control	3.78E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg06206831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:3.66E-03; Z-score:-2.16E+00
Methylation in Case	8.83E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC7A11 in bladder cancer			[ 9 ]
Location	Body (cg21877274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:9.83E-03; Z-score:-1.95E+00
Methylation in Case	8.38E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in lung adenocarcinoma			[ 10 ]
Location	TSS200 (cg13028471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-2.00E+00	Statistic Test	p-value:1.44E-03; Z-score:-1.77E+00
Methylation in Case	1.06E-01 (Median)	Methylation in Control	2.12E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in lung adenocarcinoma			[ 10 ]
Location	Body (cg21877274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.06E+00	Statistic Test	p-value:1.74E-03; Z-score:-1.85E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.70E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in lung adenocarcinoma			[ 10 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.10E+00	Statistic Test	p-value:5.63E-03; Z-score:-2.74E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.32E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in lung adenocarcinoma			[ 10 ]
Location	Body (cg06623625)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.03E+00	Statistic Test	p-value:2.46E-02; Z-score:9.92E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in lung adenocarcinoma			[ 10 ]
Location	Body (cg04474257)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.05E+00	Statistic Test	p-value:3.49E-02; Z-score:-2.06E+00
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Lung adenocarcinoma[ ICD-11:2C25.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg13028471)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.13E+00	Statistic Test	p-value:2.70E-06; Z-score:-7.00E-01
Methylation in Case	5.14E-02 (Median)	Methylation in Control	5.80E-02 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg04487857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.62E+00	Statistic Test	p-value:3.83E-11; Z-score:2.00E+00
Methylation in Case	3.43E-01 (Median)	Methylation in Control	2.12E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg15441006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.04E+00	Statistic Test	p-value:2.06E-08; Z-score:-1.46E+00
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg06623625)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.06E+00	Statistic Test	p-value:7.43E-07; Z-score:1.57E+00
Methylation in Case	9.07E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg15867963)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.31E+00	Statistic Test	p-value:1.21E-06; Z-score:1.34E+00
Methylation in Case	4.16E-01 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg24869834)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:1.15E-03; Z-score:-7.38E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg07661704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.02E+00	Statistic Test	p-value:1.28E-02; Z-score:5.33E-01
Methylation in Case	8.13E-01 (Median)	Methylation in Control	7.95E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC7A11 in papillary thyroid cancer			[ 11 ]
Location	Body (cg06206831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.01E+00	Statistic Test	p-value:1.36E-02; Z-score:-5.09E-01
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.51E-01 (Median)
Studied Phenotype	Papillary thyroid cancer[ ICD-11:2D10.1]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg01309945)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.24E+00	Statistic Test	p-value:6.08E-05; Z-score:-1.05E+00
Methylation in Case	4.03E-01 (Median)	Methylation in Control	5.01E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon2	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg02734904)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.49E+00	Statistic Test	p-value:2.23E-04; Z-score:-1.06E+00
Methylation in Case	2.18E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon3	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg04474257)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.39E+00	Statistic Test	p-value:7.96E-04; Z-score:-1.11E+00
Methylation in Case	3.33E-01 (Median)	Methylation in Control	4.61E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon4	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg04487857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.03E+00	Statistic Test	p-value:8.25E-04; Z-score:-5.86E-01
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon5	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg06206831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.31E+00	Statistic Test	p-value:2.24E-03; Z-score:-5.75E-01
Methylation in Case	2.75E-01 (Median)	Methylation in Control	3.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon6	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg06623625)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.11E+00	Statistic Test	p-value:2.69E-03; Z-score:7.31E-01
Methylation in Case	9.29E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon7	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg06690548)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:-1.15E+00	Statistic Test	p-value:2.81E-03; Z-score:-6.57E-01
Methylation in Case	5.47E-01 (Median)	Methylation in Control	6.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon8	Methylation of SLC7A11 in atypical teratoid rhabdoid tumor			[ 12 ]
Location	Body (cg07661704)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change:1.04E+00	Statistic Test	p-value:4.69E-03; Z-score:4.54E-01
Methylation in Case	8.54E-01 (Median)	Methylation in Control	8.20E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC7A11 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:8.25E-07; Fold-change:0.261444373; Z-score:1.115094393
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypermethylation of SLC7A11 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.08E-05; Fold-change:0.283373055; Z-score:1.202963567
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Ovarian cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC7A11 in ovarian cancer than that in healthy individual
Studied Phenotype	Ovarian cancer [ICD-11:2C73]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.013425961; Fold-change:-0.231306815; Z-score:-1.638472872
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
RELA YAP fusion ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC7A11 in rela yap fusion ependymoma than that in healthy individual
Studied Phenotype	RELA YAP fusion ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:2.98E-05; Fold-change:-0.206680629; Z-score:-1.196204455
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC7A11 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.59E-09; Fold-change:0.742532468; Z-score:4.38326707
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC7A11 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.78E-79; Fold-change:0.659515713; Z-score:4.783181087
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC7A11 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:1.36E-08; Fold-change:0.434857324; Z-score:2.742889307
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC7A11 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:5.66E-10; Fold-change:0.454182284; Z-score:1.916855181
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC7A11 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:4.88E-17; Fold-change:0.34605996; Z-score:1.714338
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Third ventricle chordoid glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Significant hypermethylation of SLC7A11 in third ventricle chordoid glioma than that in healthy individual
Studied Phenotype	Third ventricle chordoid glioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value:0.002176722; Fold-change:0.379485646; Z-score:2.569119328
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Moderate hypomethylation of SLC7A11 in lung cancer than that in adjacent tissue
Studied Phenotype	Lung cancer [ICD-11:2C25]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value:0.00234939; Fold-change:-0.230223429; Z-score:-1.916233374
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Bladder cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	Higher expression of miR-27a in bladder cancer (compare with cisplatin-resistant counterpart cells)			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	Dual-luciferase reporter assay
Related Molecular Changes	Down regulation ofSLC7A11	Experiment Method	Western Blot
miRNA Stemloop ID	miR-27a	miRNA Mature ID	miR-27a-3p
miRNA Sequence	UUCACAGUGGCUAAGUUCCGC
miRNA Target Type	Direct
Studied Phenotype	Bladder cancer[ ICD-11:2C94]
Experimental Material	Multiple cell lines of human
Additional Notes	miR-27a overexpression may increase the sensitivity of bladder cancer cells to cisplatin by targeting SLC7A11.
Unclear Phenotype	95 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon1	miR-1 directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1	miRNA Mature ID	miR-1-5p
miRNA Sequence	ACAUACUUCUUUAUAUGCCCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon2	miR-106a directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106a	miRNA Mature ID	miR-106a-5p
miRNA Sequence	AAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon3	miR-106b directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon4	miR-1247 directly targets SLC7A11			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1247	miRNA Mature ID	miR-1247-3p
miRNA Sequence	CCCCGGGAACGUCGAGACUGGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon5	miR-1277 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1277	miRNA Mature ID	miR-1277-5p
miRNA Sequence	AAAUAUAUAUAUAUAUGUACGUAU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon6	miR-1279 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1279	miRNA Mature ID	miR-1279
miRNA Sequence	UCAUAUUGCUUCUUUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon7	miR-128 directly targets SLC7A11			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-128	miRNA Mature ID	miR-128-3p
miRNA Sequence	UCACAGUGAACCGGUCUCUUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon8	miR-1281 directly targets SLC7A11			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1281	miRNA Mature ID	miR-1281
miRNA Sequence	UCGCCUCCUCCUCUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon9	miR-142 directly targets SLC7A11			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-142	miRNA Mature ID	miR-142-3p
miRNA Sequence	UGUAGUGUUUCCUACUUUAUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon10	miR-148b directly targets SLC7A11			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-148b	miRNA Mature ID	miR-148b-3p
miRNA Sequence	UCAGUGCAUCACAGAACUUUGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon11	miR-150 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-150	miRNA Mature ID	miR-150-5p
miRNA Sequence	UCUCCCAACCCUUGUACCAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon12	miR-155 directly targets SLC7A11			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	miR-155	miRNA Mature ID	miR-155-5p
miRNA Sequence	UUAAUGCUAAUCGUGAUAGGGGUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon13	miR-17 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-5p
miRNA Sequence	CAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon14	miR-181a directly targets SLC7A11			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-181a	miRNA Mature ID	miR-181a-5p
miRNA Sequence	AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon15	miR-186 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-3p
miRNA Sequence	GCCCAAAGGUGAAUUUUUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon16	miR-190a directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-190a	miRNA Mature ID	miR-190a-3p
miRNA Sequence	CUAUAUAUCAAACAUAUUCCU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon17	miR-192 directly targets SLC7A11			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-192	miRNA Mature ID	miR-192-5p
miRNA Sequence	CUGACCUAUGAAUUGACAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon18	miR-1976 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1976	miRNA Mature ID	miR-1976
miRNA Sequence	CCUCCUGCCCUCCUUGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon19	miR-19a directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-3p
miRNA Sequence	UGUGCAAAUCUAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon20	miR-19b directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-19b	miRNA Mature ID	miR-19b-3p
miRNA Sequence	UGUGCAAAUCCAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon21	miR-20a directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20a	miRNA Mature ID	miR-20a-5p
miRNA Sequence	UAAAGUGCUUAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon22	miR-20b directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20b	miRNA Mature ID	miR-20b-5p
miRNA Sequence	CAAAGUGCUCAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon23	miR-215 directly targets SLC7A11			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-215	miRNA Mature ID	miR-215-5p
miRNA Sequence	AUGACCUAUGAAUUGACAGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon24	miR-218 directly targets SLC7A11			[ 24 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-218	miRNA Mature ID	miR-218-5p
miRNA Sequence	UUGUGCUUGAUCUAACCAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon25	miR-223 directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-223	miRNA Mature ID	miR-223-5p
miRNA Sequence	CGUGUAUUUGACAAGCUGAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon26	miR-25 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-25	miRNA Mature ID	miR-25-3p
miRNA Sequence	CAUUGCACUUGUCUCGGUCUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon27	miR-26b directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon28	miR-27a directly targets SLC7A11			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	Immunohistochemistry//Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID	miR-27a	miRNA Mature ID	miR-27a-3p
miRNA Sequence	UUCACAGUGGCUAAGUUCCGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon29	miR-302a directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302a	miRNA Mature ID	miR-302a-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUGGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon30	miR-302b directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302b	miRNA Mature ID	miR-302b-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUAGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon31	miR-302c directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302c	miRNA Mature ID	miR-302c-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUCAGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon32	miR-302d directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302d	miRNA Mature ID	miR-302d-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon33	miR-302e directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302e	miRNA Mature ID	miR-302e
miRNA Sequence	UAAGUGCUUCCAUGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon34	miR-30a directly targets SLC7A11			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	pSILAC//Proteomics;Other
miRNA Stemloop ID	miR-30a	miRNA Mature ID	miR-30a-5p
miRNA Sequence	UGUAAACAUCCUCGACUGGAAG
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon35	miR-3163 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3163	miRNA Mature ID	miR-3163
miRNA Sequence	UAUAAAAUGAGGGCAGUAAGAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon36	miR-32 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-32	miRNA Mature ID	miR-32-5p
miRNA Sequence	UAUUGCACAUUACUAAGUUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon37	miR-329 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-329	miRNA Mature ID	miR-329-3p
miRNA Sequence	AACACACCUGGUUAACCUCUUU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon38	miR-340 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-340	miRNA Mature ID	miR-340-5p
miRNA Sequence	UUAUAAAGCAAUGAGACUGAUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon39	miR-362 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-362	miRNA Mature ID	miR-362-3p
miRNA Sequence	AACACACCUAUUCAAGGAUUCA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon40	miR-363 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-363	miRNA Mature ID	miR-363-3p
miRNA Sequence	AAUUGCACGGUAUCCAUCUGUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon41	miR-367 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-367	miRNA Mature ID	miR-367-3p
miRNA Sequence	AAUUGCACUUUAGCAAUGGUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon42	miR-372 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-3p
miRNA Sequence	AAAGUGCUGCGACAUUUGAGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon43	miR-373 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-3p
miRNA Sequence	GAAGUGCUUCGAUUUUGGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon44	miR-3913 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3913	miRNA Mature ID	miR-3913-3p
miRNA Sequence	AGACAUCAAGAUCAGUCCCAAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon45	miR-3941 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3941	miRNA Mature ID	miR-3941
miRNA Sequence	UUACACACAACUGAGGAUCAUA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon46	miR-410 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-410	miRNA Mature ID	miR-410-3p
miRNA Sequence	AAUAUAACACAGAUGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon47	miR-4279 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4279	miRNA Mature ID	miR-4279
miRNA Sequence	CUCUCCUCCCGGCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon48	miR-4282 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4282	miRNA Mature ID	miR-4282
miRNA Sequence	UAAAAUUUGCAUCCAGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon49	miR-4640 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4640	miRNA Mature ID	miR-4640-3p
miRNA Sequence	CACCCCCUGUUUCCUGGCCCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon50	miR-4722 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-3p
miRNA Sequence	ACCUGCCAGCACCUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon51	miR-4731 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4731	miRNA Mature ID	miR-4731-5p
miRNA Sequence	UGCUGGGGGCCACAUGAGUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon52	miR-4789 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4789	miRNA Mature ID	miR-4789-3p
miRNA Sequence	CACACAUAGCAGGUGUAUAUA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon53	miR-4789 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4789	miRNA Mature ID	miR-4789-5p
miRNA Sequence	GUAUACACCUGAUAUGUGUAUG
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon54	miR-489 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-489	miRNA Mature ID	miR-489-3p
miRNA Sequence	GUGACAUCACAUAUACGGCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon55	miR-500a directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-500a	miRNA Mature ID	miR-500a-3p
miRNA Sequence	AUGCACCUGGGCAAGGAUUCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon56	miR-5011 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5011	miRNA Mature ID	miR-5011-5p
miRNA Sequence	UAUAUAUACAGCCAUGCACUC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon57	miR-505 directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-505	miRNA Mature ID	miR-505-5p
miRNA Sequence	GGGAGCCAGGAAGUAUUGAUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon58	miR-5089 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5089	miRNA Mature ID	miR-5089-5p
miRNA Sequence	GUGGGAUUUCUGAGUAGCAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon59	miR-512 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-512	miRNA Mature ID	miR-512-3p
miRNA Sequence	AAGUGCUGUCAUAGCUGAGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon60	miR-5193 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5193	miRNA Mature ID	miR-5193
miRNA Sequence	UCCUCCUCUACCUCAUCCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon61	miR-519d directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-3p
miRNA Sequence	CAAAGUGCCUCCCUUUAGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon62	miR-520a directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520a	miRNA Mature ID	miR-520a-3p
miRNA Sequence	AAAGUGCUUCCCUUUGGACUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon63	miR-520c directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520c	miRNA Mature ID	miR-520c-3p
miRNA Sequence	AAAGUGCUUCCUUUUAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon64	miR-520d directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520d	miRNA Mature ID	miR-520d-3p
miRNA Sequence	AAAGUGCUUCUCUUUGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon65	miR-520g directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520g	miRNA Mature ID	miR-520g-3p
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon66	miR-520h directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520h	miRNA Mature ID	miR-520h
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon67	miR-526b directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-526b	miRNA Mature ID	miR-526b-3p
miRNA Sequence	GAAAGUGCUUCCUUUUAGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon68	miR-548az directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548az	miRNA Mature ID	miR-548az-5p
miRNA Sequence	CAAAAGUGAUUGUGGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon69	miR-548e directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548e	miRNA Mature ID	miR-548e-5p
miRNA Sequence	CAAAAGCAAUCGCGGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon70	miR-548t directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548t	miRNA Mature ID	miR-548t-5p
miRNA Sequence	CAAAAGUGAUCGUGGUUUUUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon71	miR-5571 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5571	miRNA Mature ID	miR-5571-5p
miRNA Sequence	CAAUUCUCAAAGGAGCCUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon72	miR-5589 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5589	miRNA Mature ID	miR-5589-5p
miRNA Sequence	GGCUGGGUGCUCUUGUGCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon73	miR-5589 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5589	miRNA Mature ID	miR-5589-3p
miRNA Sequence	UGCACAUGGCAACCUAGCUCCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon74	miR-5683 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5683	miRNA Mature ID	miR-5683
miRNA Sequence	UACAGAUGCAGAUUCUCUGACUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon75	miR-574 directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-574	miRNA Mature ID	miR-574-5p
miRNA Sequence	UGAGUGUGUGUGUGUGAGUGUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon76	miR-587 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-587	miRNA Mature ID	miR-587
miRNA Sequence	UUUCCAUAGGUGAUGAGUCAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon77	miR-595 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-595	miRNA Mature ID	miR-595
miRNA Sequence	GAAGUGUGCCGUGGUGUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon78	miR-603 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-603	miRNA Mature ID	miR-603
miRNA Sequence	CACACACUGCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon79	miR-619 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-619	miRNA Mature ID	miR-619-5p
miRNA Sequence	GCUGGGAUUACAGGCAUGAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon80	miR-6504 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6504	miRNA Mature ID	miR-6504-3p
miRNA Sequence	CAUUACAGCACAGCCAUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon81	miR-6506 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6506	miRNA Mature ID	miR-6506-5p
miRNA Sequence	ACUGGGAUGUCACUGAAUAUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon82	miR-6727 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6727	miRNA Mature ID	miR-6727-3p
miRNA Sequence	UCCUGCCACCUCCUCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon83	miR-6747 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6747	miRNA Mature ID	miR-6747-3p
miRNA Sequence	UCCUGCCUUCCUCUGCACCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon84	miR-6778 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-3p
miRNA Sequence	UGCCUCCCUGACAUUCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon85	miR-6791 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6791	miRNA Mature ID	miR-6791-3p
miRNA Sequence	UGCCUCCUUGGUCUCCGGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon86	miR-6826 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6826	miRNA Mature ID	miR-6826-5p
miRNA Sequence	UCAAUAGGAAAGAGGUGGGACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon87	miR-6829 directly targets SLC7A11			[ 23 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6829	miRNA Mature ID	miR-6829-3p
miRNA Sequence	UGCCUCCUCCGUGGCCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon88	miR-6835 directly targets SLC7A11			[ 25 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6835	miRNA Mature ID	miR-6835-3p
miRNA Sequence	AAAAGCACUUUUCUGUCUCCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon89	miR-6867 directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-5p
miRNA Sequence	UGUGUGUGUAGAGGAAGAAGGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon90	miR-6874 directly targets SLC7A11			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6874	miRNA Mature ID	miR-6874-5p
miRNA Sequence	AUGGAGCUGGAACCAGAUCAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon91	miR-767 directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-767	miRNA Mature ID	miR-767-5p
miRNA Sequence	UGCACCAUGGUUGUCUGAGCAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon92	miR-8485 directly targets SLC7A11			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8485	miRNA Mature ID	miR-8485
miRNA Sequence	CACACACACACACACACGUAU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon93	miR-92a directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon94	miR-92b directly targets SLC7A11			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-92b	miRNA Mature ID	miR-92b-3p
miRNA Sequence	UAUUGCACUCGUCCCGGCCUCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon95	miR-93 directly targets SLC7A11			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-93	miRNA Mature ID	miR-93-5p
miRNA Sequence	CAAAGUGCUGUUCGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
8	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9	DNA Methylation Dynamics in Urological Tumors.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13	Reduced expression of miRNA-27a modulates cisplatin resistance in bladder cancer by targeting the cystine/glutamate exchanger SLC7A11. Clin Cancer Res. 2014 Apr 1;20(7):1990-2000.
14	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
15	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
16	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
17	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
18	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
19	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
20	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
21	Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
22	Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
23	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
24	MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
25	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence