General Information of Drug Transporter (DT)
DT ID DTD0464 Transporter Info
Gene Name SLC7A11
Transporter Name Cystine/glutamate transporter
Gene ID
23657
UniProt ID
Q9UPY5
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

5'UTR (cg10265016)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.29E+00 Statistic Test p-value:1.02E-06; Z-score:1.35E+00

Methylation in Case

5.69E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg18935813)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.80E+00 Statistic Test p-value:5.22E-18; Z-score:1.56E+00

Methylation in Case

7.22E-02 (Median) Methylation in Control 4.02E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

TSS1500 (cg07354253)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.22E+00 Statistic Test p-value:1.98E-07; Z-score:-1.35E+00

Methylation in Case

1.23E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

1stExon (cg25437385)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.35E+00 Statistic Test p-value:5.50E-07; Z-score:4.92E-01

Methylation in Case

7.68E-02 (Median) Methylation in Control 5.68E-02 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg03731131)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:2.18E-07; Z-score:1.55E+00

Methylation in Case

6.38E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg24733435)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:4.47E-03; Z-score:7.17E-01

Methylation in Case

7.93E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A11 in pancretic ductal adenocarcinoma [ 1 ]

Location

Body (cg04433051)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:6.56E-03; Z-score:-9.30E-01

Methylation in Case

3.47E-01 (Median) Methylation in Control 4.84E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma[ ICD-11:2C10.0]

Experimental Material

Patient tissue samples

  Breast cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

TSS1500 (cg00361146)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.17E+00 Statistic Test p-value:1.55E-02; Z-score:4.19E-01

Methylation in Case

4.76E-02 (Median) Methylation in Control 4.06E-02 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

TSS1500 (cg02102889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.04E-02; Z-score:-4.66E-01

Methylation in Case

7.06E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg21877274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:4.72E-12; Z-score:-2.66E+00

Methylation in Case

8.24E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:8.41E-10; Z-score:-1.78E+00

Methylation in Case

7.52E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg02734904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.88E-07; Z-score:-1.42E+00

Methylation in Case

8.59E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg01309945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:5.23E-05; Z-score:-1.22E+00

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg04487857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:5.55E-05; Z-score:1.88E+00

Methylation in Case

6.12E-01 (Median) Methylation in Control 5.06E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg06206831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:8.72E-05; Z-score:-1.09E+00

Methylation in Case

8.75E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A11 in breast cancer [ 2 ]

Location

Body (cg15867963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.25E-04; Z-score:1.35E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 5.95E-01 (Median)

Studied Phenotype

Breast cancer[ ICD-11:2C60-2C6Z]

Experimental Material

Patient tissue samples

  Colorectal cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in colorectal cancer [ 3 ]

Location

TSS1500 (cg02102889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.20E+00 Statistic Test p-value:4.78E-08; Z-score:-2.02E+00

Methylation in Case

7.50E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in colorectal cancer [ 3 ]

Location

Body (cg15867963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.37E+00 Statistic Test p-value:2.01E-07; Z-score:1.77E+00

Methylation in Case

7.51E-01 (Median) Methylation in Control 5.47E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in colorectal cancer [ 3 ]

Location

Body (cg01309945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:3.45E-07; Z-score:-1.78E+00

Methylation in Case

8.72E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in colorectal cancer [ 3 ]

Location

Body (cg04487857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.42E+00 Statistic Test p-value:1.75E-05; Z-score:1.54E+00

Methylation in Case

6.75E-01 (Median) Methylation in Control 4.76E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in colorectal cancer [ 3 ]

Location

Body (cg15441006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.09E-02; Z-score:-5.70E-01

Methylation in Case

7.73E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Colorectal cancer[ ICD-11:2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

TSS1500 (cg02102889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:5.81E-08; Z-score:-8.95E-01

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

1stExon (cg16399511)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.59E+00 Statistic Test p-value:2.78E-23; Z-score:-4.76E+00

Methylation in Case

4.45E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg21460403)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.01E+00 Statistic Test p-value:4.49E-22; Z-score:-5.12E+00

Methylation in Case

3.38E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg07845352)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.72E+00 Statistic Test p-value:3.05E-17; Z-score:-2.86E+00

Methylation in Case

3.75E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg20141652)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.21E+00 Statistic Test p-value:2.65E-12; Z-score:1.87E+00

Methylation in Case

5.21E-01 (Median) Methylation in Control 4.30E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg19063061)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:2.25E+00 Statistic Test p-value:5.72E-11; Z-score:3.86E+00

Methylation in Case

4.57E-01 (Median) Methylation in Control 2.03E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg06690548)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:9.71E-09; Z-score:-1.89E+00

Methylation in Case

5.53E-01 (Median) Methylation in Control 6.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg02734904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.11E+00 Statistic Test p-value:4.02E-08; Z-score:-2.11E+00

Methylation in Case

7.36E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon9

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg21877274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:9.67E-08; Z-score:-2.65E+00

Methylation in Case

7.19E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon10

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg07661704)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.07E+00 Statistic Test p-value:5.68E-06; Z-score:-8.84E-01

Methylation in Case

6.11E-01 (Median) Methylation in Control 6.56E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon11

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg04474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.11E-05; Z-score:-1.06E+00

Methylation in Case

6.59E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon12

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg15867963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:1.34E-05; Z-score:-1.94E+00

Methylation in Case

6.27E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon13

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg06206831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.42E-05; Z-score:-8.87E-01

Methylation in Case

8.33E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon14

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg01309945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.50E-05; Z-score:-8.60E-01

Methylation in Case

7.77E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon15

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg06623625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.09E+00 Statistic Test p-value:1.43E-04; Z-score:-6.03E-01

Methylation in Case

7.00E-01 (Median) Methylation in Control 7.64E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon16

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg15441006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:2.36E-03; Z-score:-2.62E-01

Methylation in Case

6.89E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon17

Methylation of SLC7A11 in hepatocellular carcinoma [ 4 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.04E-02; Z-score:-3.20E-01

Methylation in Case

5.90E-01 (Median) Methylation in Control 6.11E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma[ ICD-11:2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in HIV infection [ 5 ]

Location

TSS1500 (cg02102889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.05E-02; Z-score:-4.46E-01

Methylation in Case

8.22E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in HIV infection [ 5 ]

Location

Body (cg07661704)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.27E+00 Statistic Test p-value:6.38E-10; Z-score:2.08E+00

Methylation in Case

7.24E-01 (Median) Methylation in Control 5.69E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in HIV infection [ 5 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:1.97E-06; Z-score:-1.50E+00

Methylation in Case

7.83E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in HIV infection [ 5 ]

Location

Body (cg21877274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.71E-05; Z-score:-1.89E+00

Methylation in Case

8.56E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in HIV infection [ 5 ]

Location

Body (cg06623625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.02E+00 Statistic Test p-value:9.46E-03; Z-score:-8.07E-01

Methylation in Case

9.26E-01 (Median) Methylation in Control 9.41E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in HIV infection [ 5 ]

Location

Body (cg06206831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:4.18E-02; Z-score:-6.84E-01

Methylation in Case

9.20E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

HIV infection[ ICD-11:1C62.Z]

Experimental Material

Patient tissue samples

  Panic disorder

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in panic disorder [ 6 ]

Location

TSS1500 (cg02102889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-8.38E-01 Statistic Test p-value:3.71E-04; Z-score:-5.16E-01

Methylation in Case

-8.51E-01 (Median) Methylation in Control -7.14E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in panic disorder [ 6 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-4.41E-01 Statistic Test p-value:1.08E-06; Z-score:-9.06E-01

Methylation in Case

-5.96E-01 (Median) Methylation in Control -2.63E-01 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in panic disorder [ 6 ]

Location

Body (cg02734904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.36E+00 Statistic Test p-value:7.18E-04; Z-score:-5.25E-01

Methylation in Case

7.46E-01 (Median) Methylation in Control 1.01E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in panic disorder [ 6 ]

Location

Body (cg04487857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.21E-02; Z-score:5.65E-01

Methylation in Case

2.47E+00 (Median) Methylation in Control 2.33E+00 (Median)

Studied Phenotype

Panic disorder[ ICD-11:6B01]

Experimental Material

Patient tissue samples

  Prostate cancer

           3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in prostate cancer [ 7 ]

Location

TSS1500 (cg11200963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.36E+00 Statistic Test p-value:2.95E-02; Z-score:2.45E+00

Methylation in Case

7.33E-01 (Median) Methylation in Control 5.37E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in prostate cancer [ 7 ]

Location

3'UTR (cg19926635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.13E+00 Statistic Test p-value:1.62E-02; Z-score:1.95E+00

Methylation in Case

7.42E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Prostate cancer[ ICD-11:2C82]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in systemic lupus erythematosus [ 8 ]

Location

TSS1500 (cg00361146)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.12E+00 Statistic Test p-value:1.38E-03; Z-score:-2.21E-01

Methylation in Case

8.24E-02 (Median) Methylation in Control 9.21E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in systemic lupus erythematosus [ 8 ]

Location

TSS1500 (cg02102889)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:2.70E-02; Z-score:3.66E-01

Methylation in Case

7.43E-01 (Median) Methylation in Control 7.00E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in systemic lupus erythematosus [ 8 ]

Location

Body (cg07661704)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.07E+00 Statistic Test p-value:2.08E-07; Z-score:5.52E-01

Methylation in Case

6.34E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in systemic lupus erythematosus [ 8 ]

Location

Body (cg01309945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.29E-03; Z-score:-1.95E-01

Methylation in Case

8.95E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in systemic lupus erythematosus [ 8 ]

Location

Body (cg06623625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.00E+00 Statistic Test p-value:2.67E-02; Z-score:-1.57E-01

Methylation in Case

9.18E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in systemic lupus erythematosus [ 8 ]

Location

Body (cg21877274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:2.72E-02; Z-score:-1.61E-01

Methylation in Case

8.76E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus[ ICD-11:4A40.0]

Experimental Material

Patient tissue samples

  Bladder cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

TSS200 (cg13028471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.33E+00 Statistic Test p-value:5.55E-03; Z-score:-2.15E+00

Methylation in Case

3.83E-02 (Median) Methylation in Control 8.90E-02 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg15867963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.65E+00 Statistic Test p-value:6.57E-07; Z-score:5.61E+00

Methylation in Case

7.30E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg06690548)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.57E+00 Statistic Test p-value:6.76E-07; Z-score:-5.59E+00

Methylation in Case

3.93E-01 (Median) Methylation in Control 6.16E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.25E+00 Statistic Test p-value:2.06E-05; Z-score:-7.07E+00

Methylation in Case

6.96E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg02734904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:1.16E-03; Z-score:-3.93E+00

Methylation in Case

8.83E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg04487857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.92E+00 Statistic Test p-value:1.81E-03; Z-score:-3.67E+00

Methylation in Case

1.97E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg06206831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:3.66E-03; Z-score:-2.16E+00

Methylation in Case

8.83E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A11 in bladder cancer [ 9 ]

Location

Body (cg21877274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:9.83E-03; Z-score:-1.95E+00

Methylation in Case

8.38E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in lung adenocarcinoma [ 10 ]

Location

TSS200 (cg13028471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-2.00E+00 Statistic Test p-value:1.44E-03; Z-score:-1.77E+00

Methylation in Case

1.06E-01 (Median) Methylation in Control 2.12E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in lung adenocarcinoma [ 10 ]

Location

Body (cg21877274)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.06E+00 Statistic Test p-value:1.74E-03; Z-score:-1.85E+00

Methylation in Case

8.23E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in lung adenocarcinoma [ 10 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.10E+00 Statistic Test p-value:5.63E-03; Z-score:-2.74E+00

Methylation in Case

7.60E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in lung adenocarcinoma [ 10 ]

Location

Body (cg06623625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.03E+00 Statistic Test p-value:2.46E-02; Z-score:9.92E-01

Methylation in Case

8.74E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in lung adenocarcinoma [ 10 ]

Location

Body (cg04474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.05E+00 Statistic Test p-value:3.49E-02; Z-score:-2.06E+00

Methylation in Case

7.89E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

Lung adenocarcinoma[ ICD-11:2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

TSS200 (cg13028471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.13E+00 Statistic Test p-value:2.70E-06; Z-score:-7.00E-01

Methylation in Case

5.14E-02 (Median) Methylation in Control 5.80E-02 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg04487857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.62E+00 Statistic Test p-value:3.83E-11; Z-score:2.00E+00

Methylation in Case

3.43E-01 (Median) Methylation in Control 2.12E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg15441006)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.04E+00 Statistic Test p-value:2.06E-08; Z-score:-1.46E+00

Methylation in Case

7.89E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg06623625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.06E+00 Statistic Test p-value:7.43E-07; Z-score:1.57E+00

Methylation in Case

9.07E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg15867963)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.31E+00 Statistic Test p-value:1.21E-06; Z-score:1.34E+00

Methylation in Case

4.16E-01 (Median) Methylation in Control 3.17E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg24869834)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:1.15E-03; Z-score:-7.38E-01

Methylation in Case

8.69E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg07661704)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.02E+00 Statistic Test p-value:1.28E-02; Z-score:5.33E-01

Methylation in Case

8.13E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A11 in papillary thyroid cancer [ 11 ]

Location

Body (cg06206831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.01E+00 Statistic Test p-value:1.36E-02; Z-score:-5.09E-01

Methylation in Case

9.46E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

Papillary thyroid cancer[ ICD-11:2D10.1]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg01309945)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.24E+00 Statistic Test p-value:6.08E-05; Z-score:-1.05E+00

Methylation in Case

4.03E-01 (Median) Methylation in Control 5.01E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon2

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg02734904)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.49E+00 Statistic Test p-value:2.23E-04; Z-score:-1.06E+00

Methylation in Case

2.18E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon3

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04474257)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.39E+00 Statistic Test p-value:7.96E-04; Z-score:-1.11E+00

Methylation in Case

3.33E-01 (Median) Methylation in Control 4.61E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon4

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg04487857)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.03E+00 Statistic Test p-value:8.25E-04; Z-score:-5.86E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon5

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06206831)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.31E+00 Statistic Test p-value:2.24E-03; Z-score:-5.75E-01

Methylation in Case

2.75E-01 (Median) Methylation in Control 3.60E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon6

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06623625)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.11E+00 Statistic Test p-value:2.69E-03; Z-score:7.31E-01

Methylation in Case

9.29E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon7

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg06690548)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:-1.15E+00 Statistic Test p-value:2.81E-03; Z-score:-6.57E-01

Methylation in Case

5.47E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon8

Methylation of SLC7A11 in atypical teratoid rhabdoid tumor [ 12 ]

Location

Body (cg07661704)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change:1.04E+00 Statistic Test p-value:4.69E-03; Z-score:4.54E-01

Methylation in Case

8.54E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor[ ICD-11:2A00.1Y]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC7A11 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:8.25E-07; Fold-change:0.261444373; Z-score:1.115094393
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Brain neuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypermethylation of SLC7A11 in brain neuroblastoma than that in healthy individual

Studied Phenotype

Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.08E-05; Fold-change:0.283373055; Z-score:1.202963567
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Ovarian cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC7A11 in ovarian cancer than that in healthy individual

Studied Phenotype

Ovarian cancer [ICD-11:2C73]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.013425961; Fold-change:-0.231306815; Z-score:-1.638472872
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  RELA YAP fusion ependymoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC7A11 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:2.98E-05; Fold-change:-0.206680629; Z-score:-1.196204455
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Cerebellar liponeurocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC7A11 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.59E-09; Fold-change:0.742532468; Z-score:4.38326707
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Medulloblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC7A11 in medulloblastoma than that in healthy individual

Studied Phenotype

Medulloblastoma [ICD-11:2A00.10]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.78E-79; Fold-change:0.659515713; Z-score:4.783181087
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Melanocytoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC7A11 in melanocytoma than that in healthy individual

Studied Phenotype

Melanocytoma [ICD-11:2F36.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:1.36E-08; Fold-change:0.434857324; Z-score:2.742889307
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Multilayered rosettes embryonal tumour

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC7A11 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:5.66E-10; Fold-change:0.454182284; Z-score:1.916855181
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Oligodendroglioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC7A11 in oligodendroglioma than that in healthy individual

Studied Phenotype

Oligodendroglioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:4.88E-17; Fold-change:0.34605996; Z-score:1.714338
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Third ventricle chordoid glioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Significant hypermethylation of SLC7A11 in third ventricle chordoid glioma than that in healthy individual

Studied Phenotype

Third ventricle chordoid glioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value:0.002176722; Fold-change:0.379485646; Z-score:2.569119328
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Lung cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Moderate hypomethylation of SLC7A11 in lung cancer than that in adjacent tissue

Studied Phenotype

Lung cancer [ICD-11:2C25]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

p-value:0.00234939; Fold-change:-0.230223429; Z-score:-1.916233374
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients

microRNA

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

Higher expression of miR-27a in bladder cancer (compare with cisplatin-resistant counterpart cells) [ 13 ]

Epigenetic Type

microRNA Experiment Method Dual-luciferase reporter assay

Related Molecular Changes

Down regulation ofSLC7A11 Experiment Method Western Blot

miRNA Stemloop ID

miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

Direct

Studied Phenotype

Bladder cancer[ ICD-11:2C94]

Experimental Material

Multiple cell lines of human

Additional Notes

miR-27a overexpression may increase the sensitivity of bladder cancer cells to cisplatin by targeting SLC7A11.

  Unclear Phenotype

         95 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon1

miR-1 directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1 miRNA Mature ID miR-1-5p

miRNA Sequence

ACAUACUUCUUUAUAUGCCCAU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon2

miR-106a directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon3

miR-106b directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon4

miR-1247 directly targets SLC7A11 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon5

miR-1277 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon6

miR-1279 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1279 miRNA Mature ID miR-1279

miRNA Sequence

UCAUAUUGCUUCUUUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon7

miR-128 directly targets SLC7A11 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

UCACAGUGAACCGGUCUCUUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon8

miR-1281 directly targets SLC7A11 [ 16 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1281 miRNA Mature ID miR-1281

miRNA Sequence

UCGCCUCCUCCUCUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon9

miR-142 directly targets SLC7A11 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-142 miRNA Mature ID miR-142-3p

miRNA Sequence

UGUAGUGUUUCCUACUUUAUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon10

miR-148b directly targets SLC7A11 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon11

miR-150 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-150 miRNA Mature ID miR-150-5p

miRNA Sequence

UCUCCCAACCCUUGUACCAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon12

miR-155 directly targets SLC7A11 [ 21 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon13

miR-17 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon14

miR-181a directly targets SLC7A11 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon15

miR-186 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon16

miR-190a directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon17

miR-192 directly targets SLC7A11 [ 22 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

CUGACCUAUGAAUUGACAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon18

miR-1976 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon19

miR-19a directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19a miRNA Mature ID miR-19a-3p

miRNA Sequence

UGUGCAAAUCUAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon20

miR-19b directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-19b miRNA Mature ID miR-19b-3p

miRNA Sequence

UGUGCAAAUCCAUGCAAAACUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon21

miR-20a directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon22

miR-20b directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon23

miR-215 directly targets SLC7A11 [ 22 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

AUGACCUAUGAAUUGACAGAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon24

miR-218 directly targets SLC7A11 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon25

miR-223 directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-223 miRNA Mature ID miR-223-5p

miRNA Sequence

CGUGUAUUUGACAAGCUGAGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon26

miR-25 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-25 miRNA Mature ID miR-25-3p

miRNA Sequence

CAUUGCACUUGUCUCGGUCUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon27

miR-26b directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon28

miR-27a directly targets SLC7A11 [ 13 ]

Epigenetic Type

microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR

miRNA Stemloop ID

miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon29

miR-302a directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon30

miR-302b directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon31

miR-302c directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon32

miR-302d directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon33

miR-302e directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302e miRNA Mature ID miR-302e

miRNA Sequence

UAAGUGCUUCCAUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon34

miR-30a directly targets SLC7A11 [ 21 ]

Epigenetic Type

microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

miR-30a miRNA Mature ID miR-30a-5p

miRNA Sequence

UGUAAACAUCCUCGACUGGAAG

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon35

miR-3163 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3163 miRNA Mature ID miR-3163

miRNA Sequence

UAUAAAAUGAGGGCAGUAAGAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon36

miR-32 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-32 miRNA Mature ID miR-32-5p

miRNA Sequence

UAUUGCACAUUACUAAGUUGCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon37

miR-329 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

AACACACCUGGUUAACCUCUUU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon38

miR-340 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon39

miR-362 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

AACACACCUAUUCAAGGAUUCA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon40

miR-363 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-363 miRNA Mature ID miR-363-3p

miRNA Sequence

AAUUGCACGGUAUCCAUCUGUA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon41

miR-367 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-367 miRNA Mature ID miR-367-3p

miRNA Sequence

AAUUGCACUUUAGCAAUGGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon42

miR-372 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon43

miR-373 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon44

miR-3913 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3913 miRNA Mature ID miR-3913-3p

miRNA Sequence

AGACAUCAAGAUCAGUCCCAAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon45

miR-3941 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

UUACACACAACUGAGGAUCAUA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon46

miR-410 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-410 miRNA Mature ID miR-410-3p

miRNA Sequence

AAUAUAACACAGAUGGCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon47

miR-4279 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

CUCUCCUCCCGGCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon48

miR-4282 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4282 miRNA Mature ID miR-4282

miRNA Sequence

UAAAAUUUGCAUCCAGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon49

miR-4640 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4640 miRNA Mature ID miR-4640-3p

miRNA Sequence

CACCCCCUGUUUCCUGGCCCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon50

miR-4722 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon51

miR-4731 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon52

miR-4789 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

CACACAUAGCAGGUGUAUAUA

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon53

miR-4789 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon54

miR-489 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-489 miRNA Mature ID miR-489-3p

miRNA Sequence

GUGACAUCACAUAUACGGCAGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon55

miR-500a directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-500a miRNA Mature ID miR-500a-3p

miRNA Sequence

AUGCACCUGGGCAAGGAUUCUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon56

miR-5011 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

UAUAUAUACAGCCAUGCACUC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon57

miR-505 directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-505 miRNA Mature ID miR-505-5p

miRNA Sequence

GGGAGCCAGGAAGUAUUGAUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon58

miR-5089 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon59

miR-512 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-512 miRNA Mature ID miR-512-3p

miRNA Sequence

AAGUGCUGUCAUAGCUGAGGUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon60

miR-5193 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5193 miRNA Mature ID miR-5193

miRNA Sequence

UCCUCCUCUACCUCAUCCCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon61

miR-519d directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon62

miR-520a directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon63

miR-520c directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon64

miR-520d directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon65

miR-520g directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon66

miR-520h directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520h miRNA Mature ID miR-520h

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon67

miR-526b directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon68

miR-548az directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548az miRNA Mature ID miR-548az-5p

miRNA Sequence

CAAAAGUGAUUGUGGUUUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon69

miR-548e directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548e miRNA Mature ID miR-548e-5p

miRNA Sequence

CAAAAGCAAUCGCGGUUUUUGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon70

miR-548t directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-548t miRNA Mature ID miR-548t-5p

miRNA Sequence

CAAAAGUGAUCGUGGUUUUUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon71

miR-5571 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5571 miRNA Mature ID miR-5571-5p

miRNA Sequence

CAAUUCUCAAAGGAGCCUCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon72

miR-5589 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon73

miR-5589 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5589 miRNA Mature ID miR-5589-3p

miRNA Sequence

UGCACAUGGCAACCUAGCUCCCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon74

miR-5683 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5683 miRNA Mature ID miR-5683

miRNA Sequence

UACAGAUGCAGAUUCUCUGACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon75

miR-574 directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-574 miRNA Mature ID miR-574-5p

miRNA Sequence

UGAGUGUGUGUGUGUGAGUGUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon76

miR-587 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-587 miRNA Mature ID miR-587

miRNA Sequence

UUUCCAUAGGUGAUGAGUCAC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon77

miR-595 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-595 miRNA Mature ID miR-595

miRNA Sequence

GAAGUGUGCCGUGGUGUGUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon78

miR-603 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-603 miRNA Mature ID miR-603

miRNA Sequence

CACACACUGCAAUUACUUUUGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon79

miR-619 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon80

miR-6504 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

CAUUACAGCACAGCCAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon81

miR-6506 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon82

miR-6727 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon83

miR-6747 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon84

miR-6778 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

UGCCUCCCUGACAUUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon85

miR-6791 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon86

miR-6826 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6826 miRNA Mature ID miR-6826-5p

miRNA Sequence

UCAAUAGGAAAGAGGUGGGACCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon87

miR-6829 directly targets SLC7A11 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon88

miR-6835 directly targets SLC7A11 [ 25 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon89

miR-6867 directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6867 miRNA Mature ID miR-6867-5p

miRNA Sequence

UGUGUGUGUAGAGGAAGAAGGGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon90

miR-6874 directly targets SLC7A11 [ 14 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6874 miRNA Mature ID miR-6874-5p

miRNA Sequence

AUGGAGCUGGAACCAGAUCAGGC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon91

miR-767 directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-767 miRNA Mature ID miR-767-5p

miRNA Sequence

UGCACCAUGGUUGUCUGAGCAUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon92

miR-8485 directly targets SLC7A11 [ 17 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

CACACACACACACACACGUAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon93

miR-92a directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon94

miR-92b directly targets SLC7A11 [ 18 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon95

miR-93 directly targets SLC7A11 [ 15 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
8 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
9 DNA Methylation Dynamics in Urological Tumors.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 Reduced expression of miRNA-27a modulates cisplatin resistance in bladder cancer by targeting the cystine/glutamate exchanger SLC7A11. Clin Cancer Res. 2014 Apr 1;20(7):1990-2000.
14 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
15 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
16 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
17 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
18 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
19 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
20 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
21 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
22 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
23 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
24 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
25 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Li and Dr. Fu.